ID: 908489357

View in Genome Browser
Species Human (GRCh38)
Location 1:64627543-64627565
Sequence ATGCTCTAGAGGAGAAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489354_908489357 -6 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489351_908489357 23 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489353_908489357 5 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489357 Original CRISPR ATGCTCTAGAGGAGAAGAGG CGG Intronic