ID: 908489357 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:64627543-64627565 |
Sequence | ATGCTCTAGAGGAGAAGAGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 328 | |||
Summary | {0: 1, 1: 1, 2: 1, 3: 27, 4: 298} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908489351_908489357 | 23 | Left | 908489351 | 1:64627497-64627519 | CCAAGGAGACAGAGTAGACCATC | No data | ||
Right | 908489357 | 1:64627543-64627565 | ATGCTCTAGAGGAGAAGAGGCGG | 0: 1 1: 1 2: 1 3: 27 4: 298 |
||||
908489353_908489357 | 5 | Left | 908489353 | 1:64627515-64627537 | CCATCGTCTTACCTTCTTGGAGT | No data | ||
Right | 908489357 | 1:64627543-64627565 | ATGCTCTAGAGGAGAAGAGGCGG | 0: 1 1: 1 2: 1 3: 27 4: 298 |
||||
908489354_908489357 | -6 | Left | 908489354 | 1:64627526-64627548 | CCTTCTTGGAGTTCATGATGCTC | No data | ||
Right | 908489357 | 1:64627543-64627565 | ATGCTCTAGAGGAGAAGAGGCGG | 0: 1 1: 1 2: 1 3: 27 4: 298 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908489357 | Original CRISPR | ATGCTCTAGAGGAGAAGAGG CGG | Intronic | ||