ID: 908489357

View in Genome Browser
Species Human (GRCh38)
Location 1:64627543-64627565
Sequence ATGCTCTAGAGGAGAAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489351_908489357 23 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489354_908489357 -6 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489353_908489357 5 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489357 Original CRISPR ATGCTCTAGAGGAGAAGAGG CGG Intronic
900624136 1:3600476-3600498 ATGCTCTGAAGGAGGACAGGCGG + Intronic
902418155 1:16255031-16255053 GGGCTTTAGAGGAGAAGAGGGGG - Intronic
902665844 1:17937423-17937445 ATGCTCTTCAGTAGAGGAGGGGG - Intergenic
903080888 1:20811447-20811469 TGGCTCTACAAGAGAAGAGGAGG + Intronic
903189277 1:21647747-21647769 ATGCTCTGTAGCAGCAGAGGAGG + Intronic
903478671 1:23637798-23637820 ATGATCCAGAGGAGTAAAGGAGG + Intronic
904415332 1:30357982-30358004 AGGCTCAAGAGGAGCAGAGTTGG - Intergenic
906343509 1:45001357-45001379 GTGCCCTAGAGGACAAGAAGGGG + Intergenic
907745168 1:57206198-57206220 AGGCTTTGGAGGAGAAGAGGAGG + Intronic
908215207 1:61944156-61944178 TTTCTTTGGAGGAGAAGAGGCGG - Intronic
908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG + Intronic
911523614 1:98958890-98958912 AAGCTGCAGTGGAGAAGAGGAGG - Intronic
912299700 1:108502337-108502359 ATGGTCAAGAGGTCAAGAGGTGG - Intergenic
912474666 1:109927974-109927996 ATGCTCTAGAGGGAAAGAAGGGG - Intronic
915085777 1:153387840-153387862 ATGCTCAAGAGGAGAAGAGGAGG - Intergenic
915086423 1:153391934-153391956 ATGCCTAAGAGGAGAAGAGGAGG + Intergenic
915248690 1:154573157-154573179 ATACACTAGAGGAGATGGGGTGG + Intronic
915254586 1:154616584-154616606 ATGCTCCAAAAGAGAGGAGGGGG - Intronic
915705739 1:157841901-157841923 ATGTTCCAGAGGAAAGGAGGTGG + Intronic
917237508 1:172910140-172910162 ACGCTCTGGAGGAGCAGATGTGG + Intergenic
917255752 1:173114532-173114554 ATGCACTAGAGCAGTAAAGGAGG + Intergenic
917437390 1:175035183-175035205 ATCCTCAAGAGGACAATAGGGGG + Intergenic
918563616 1:185899141-185899163 ATGTACTAGAGGAGAAGTTGAGG - Intronic
921123006 1:212152976-212152998 ATTCTCATGAGGAGAAGAGGGGG + Intergenic
921712185 1:218384084-218384106 ATGTTCTAGAAGAGGAGAGGGGG - Intronic
922234216 1:223711269-223711291 CTACTGTAGAGAAGAAGAGGAGG + Intronic
923246457 1:232137114-232137136 ATTATCTAGGGGAAAAGAGGAGG + Intergenic
1063344216 10:5296009-5296031 ATGCACTGCAGGAAAAGAGGAGG + Intergenic
1065280635 10:24134213-24134235 ATGGGCTAGTGGAGGAGAGGTGG + Intronic
1065506766 10:26437693-26437715 CAGCTGTAGAGGAGAAGGGGAGG + Intergenic
1066505643 10:36039587-36039609 ATGCACAAGAAGAGAAGAGCTGG - Intergenic
1068018278 10:51545437-51545459 GTGCTCTATAGGAAAAGAGCTGG - Intronic
1068772549 10:60838098-60838120 AAACACTAGAGGTGAAGAGGTGG + Intergenic
1069930802 10:71880444-71880466 ATGCTGGAGAGGTGGAGAGGTGG - Intergenic
1071394526 10:85208181-85208203 ATGCTCTACAGGATGAGTGGAGG + Intergenic
1073382663 10:103091750-103091772 ATCCTGAAGAGGGGAAGAGGAGG - Intronic
1073758921 10:106609926-106609948 ATGCTGCAGATGAGAAGAGATGG + Intronic
1075347427 10:121693846-121693868 GGGCTCTAGGGGAGAACAGGTGG - Intergenic
1075562727 10:123480224-123480246 ATGCCCTAGAGGTGACGGGGAGG + Intergenic
1078258787 11:9684493-9684515 AGGCTCTATAACAGAAGAGGGGG - Intronic
1078518751 11:12047066-12047088 AAGCCCTGGAGGAGAAGGGGAGG - Intergenic
1079896170 11:26121429-26121451 ATGCAATAGAGGAGAAGACTTGG - Intergenic
1082314072 11:50695519-50695541 TTCCTTTGGAGGAGAAGAGGTGG - Intergenic
1082780871 11:57286697-57286719 ATCCTCAAGAGGAGAGGAGAGGG + Intergenic
1082824316 11:57567052-57567074 ATTCTCTGGAGGAAAAGATGCGG - Intronic
1083345086 11:61983868-61983890 AAGCTCTGGAGGAGTAGAGATGG + Intergenic
1083574342 11:63778712-63778734 ATGGACTAGGGGAGAAAAGGGGG + Intergenic
1084843530 11:71879129-71879151 AAGGGCTAGAGGTGAAGAGGTGG + Intronic
1084902624 11:72321228-72321250 ATCCACTAGAGAAGAAGAGAAGG + Intronic
1086093166 11:83024118-83024140 ATTCTCTAGATGAGAAAATGGGG - Intronic
1087693225 11:101346188-101346210 ATGCTTTTGAGGAGAAGAGTGGG + Intergenic
1087910726 11:103750599-103750621 ATGGTCTAGAGGAGAAAAAAAGG + Intergenic
1088691252 11:112330654-112330676 ATCCTTTGGAGGAGAAGAGGTGG + Intergenic
1088976121 11:114817872-114817894 ATGCTGTGGAGGAGCTGAGGGGG + Intergenic
1089022270 11:115228535-115228557 AGGGTCCAGAGGAGAAGATGAGG + Intronic
1089253653 11:117182124-117182146 TTGCTCGAGAGGAGAAATGGGGG + Intronic
1089356267 11:117855878-117855900 ATGGTCTAGAGGGGAAGAGTTGG - Intronic
1090889178 11:130907847-130907869 AAGCCCTAGAGGAAAGGAGGTGG - Intronic
1091041246 11:132283956-132283978 AAGCCCAAGAGGAGGAGAGGAGG - Intronic
1091339009 11:134795784-134795806 ATCTTCTGGAGGAGGAGAGGGGG + Intergenic
1093340351 12:17966633-17966655 ATCATTTGGAGGAGAAGAGGGGG + Intergenic
1093658191 12:21721727-21721749 ATCCAGTAGAGGAGCAGAGGTGG + Intronic
1096185028 12:49573402-49573424 CTGCTCTAGTGGACAAGAGTGGG - Intronic
1096618987 12:52850664-52850686 AGGCTCTAGAAGAGGGGAGGGGG - Intergenic
1099213303 12:79820804-79820826 CTGCTCTAGTGAAGAAGATGAGG - Exonic
1099969790 12:89488997-89489019 ATGCTGTAAATAAGAAGAGGAGG - Intronic
1100287780 12:93183798-93183820 TGGGCCTAGAGGAGAAGAGGTGG - Intergenic
1101306570 12:103534290-103534312 ATGCTCTGGAAGAGAAGAAAGGG + Intergenic
1103176349 12:118866784-118866806 ATGAAATAGATGAGAAGAGGAGG - Intergenic
1106458294 13:29946740-29946762 ATGCTTCAGGGGAGAAGAGTAGG - Intergenic
1106814771 13:33395506-33395528 ATACTAAAGATGAGAAGAGGTGG + Intergenic
1107703436 13:43073509-43073531 ATGCTCTATATGAGTAGAGTAGG + Intronic
1107992163 13:45828225-45828247 ATACTCAAGAGGAGAAGGGCAGG - Intronic
1111591310 13:90350923-90350945 ATGGTTTAGAGGACAAGAAGGGG + Intergenic
1111746886 13:92281836-92281858 TTCCTTTGGAGGAGAAGAGGTGG - Intronic
1112261001 13:97878437-97878459 CTGCTCTAGAAGAGAGGAGAGGG + Intergenic
1112332822 13:98489717-98489739 AGGCTCAGGTGGAGAAGAGGAGG + Intronic
1112679832 13:101751015-101751037 AAGGTCTAGAGGAGAGGGGGAGG + Intronic
1112933794 13:104774525-104774547 ATTCTCTTGAGGAAAAAAGGTGG - Intergenic
1112937057 13:104814067-104814089 AGGCTTTGGAGAAGAAGAGGAGG + Intergenic
1113839292 13:113349709-113349731 ATGCTCCCGAGGAGAAAGGGTGG - Intronic
1117340590 14:54788359-54788381 ATGCAGTAGAGGAGATGGGGTGG - Intronic
1117564671 14:56980732-56980754 ATTCTGGAGAGGTGAAGAGGAGG + Intergenic
1118981661 14:70722024-70722046 ATGCTGTAGAAAAGAGGAGGTGG - Intergenic
1119476916 14:74935578-74935600 ATCCTCAAGAGGAGGTGAGGTGG + Intergenic
1119534035 14:75385700-75385722 ATGTTATAAGGGAGAAGAGGAGG + Intergenic
1119775859 14:77248461-77248483 CTGATCTAGAGAAGAAGAGGCGG - Exonic
1120440347 14:84529080-84529102 TTGCTTTAGGGGAGCAGAGGTGG - Intergenic
1120625884 14:86826000-86826022 AGGCTCTAGGGTAGAAGTGGGGG + Intergenic
1121628693 14:95406761-95406783 AAGCTGCAGAGGAGAAGGGGAGG - Intergenic
1121955150 14:98206839-98206861 ATTCTCTGGAGGATAAAAGGAGG + Intergenic
1124787540 15:32695736-32695758 ACGTTCTAAAGGAGAAGAGTAGG - Intronic
1126621149 15:50641182-50641204 CTGCTCTGAATGAGAAGAGGAGG - Intronic
1127193826 15:56562495-56562517 ATCCTTTGGAGAAGAAGAGGTGG - Intergenic
1127286735 15:57539582-57539604 AGGCGCTGGAGGTGAAGAGGTGG - Intronic
1128569653 15:68724868-68724890 ATGCTTTACAGGAGAAATGGAGG + Intronic
1129857799 15:78837449-78837471 ATGCTGCAGAGGAGGGGAGGAGG + Intronic
1130061941 15:80576687-80576709 AGGCTCCAGGGGAGATGAGGAGG + Intronic
1130184098 15:81662596-81662618 AAGATCTAGAGGAGAAGAATTGG - Intergenic
1130188397 15:81708466-81708488 AAGATCTAGAGGAGAAGAATTGG - Intergenic
1130812516 15:87394745-87394767 CTGACCTAGAGGAGAAGGGGAGG + Intergenic
1131090612 15:89622308-89622330 TTGCAGTAGGGGAGAAGAGGGGG - Intronic
1132087354 15:98919207-98919229 ACGCAATGGAGGAGAAGAGGGGG - Intronic
1133195326 16:4165863-4165885 ATTTTCTAGAGGAGCATAGGAGG - Intergenic
1133598512 16:7316649-7316671 ATGCTCTGAAGGAAAAGAGTGGG + Intronic
1134955733 16:18381440-18381462 AAGCTCTAGGGGAGGGGAGGAGG + Intergenic
1135086127 16:19475769-19475791 ATACTGCAGAGGAGAAAAGGTGG - Intronic
1135344703 16:21679217-21679239 ATGCCCTAGAGGAGAGGGGAAGG + Intronic
1135617060 16:23920662-23920684 ATACTCTTGGGGAGAAGAGTGGG + Intronic
1135933434 16:26759087-26759109 ATCCTCTAGAGGAAAAAAAGAGG - Intergenic
1136246313 16:28978210-28978232 ATGCTCTGGAAGAAAAGGGGAGG - Intronic
1137790517 16:51171002-51171024 ATGCAGTAGATGGGAAGAGGAGG + Intergenic
1138664238 16:58550398-58550420 AGGCTGAGGAGGAGAAGAGGAGG - Intronic
1139233007 16:65304806-65304828 TTTCACTAGGGGAGAAGAGGGGG - Intergenic
1142629612 17:1216298-1216320 CTGCTCCAGAGGAGGAGAGCGGG + Intronic
1143166084 17:4897864-4897886 ATGGGCTAGAAGAGGAGAGGGGG - Exonic
1143180244 17:4980077-4980099 AGGCTCTAGGGCAGAACAGGGGG + Exonic
1148291665 17:46456884-46456906 ATGCTGAAGAGGAGCAAAGGAGG + Intergenic
1148313855 17:46674591-46674613 ATGCTGAAGAGGAGCAAAGGAGG + Exonic
1148603256 17:48909240-48909262 GGGCTCCAGAGGAGAAGAGAGGG - Intronic
1150246706 17:63681408-63681430 GTGCTCTAGAGGAAGAGAGAAGG + Intronic
1150313463 17:64148602-64148624 AAGCTTTGGAGGAGTAGAGGAGG + Exonic
1150383793 17:64741496-64741518 CTGCTCTAGAGAATAGGAGGAGG - Intergenic
1150643968 17:66966601-66966623 ATGGTCTGGAGGGGAAAAGGGGG - Intronic
1150644010 17:66966874-66966896 ATTCTCCAGAGGAGAGGAGTAGG - Intronic
1151098404 17:71526644-71526666 ATGCGTTAGAGGAGAATAGATGG + Intergenic
1151309678 17:73285643-73285665 ATGCTCTGGAGGATGAGGGGTGG - Exonic
1151403316 17:73870571-73870593 ATCCTCTAGGGAGGAAGAGGAGG - Intergenic
1152348607 17:79770229-79770251 ATGCCCTGGAGGAGAAGGGCGGG - Intergenic
1153544893 18:6195265-6195287 ATGTTCTGGAGGAGAGAAGGGGG + Intronic
1153579562 18:6558558-6558580 ATGCTTGAGAGGAAAAAAGGAGG - Intronic
1153820295 18:8826132-8826154 ATGCCTTAAAGGAGGAGAGGAGG + Exonic
1155489949 18:26390795-26390817 ATGCCCAAGAGGGGAAGAGGTGG + Exonic
1155538180 18:26839579-26839601 ATTCTCAAGATGAGAAGGGGAGG - Intergenic
1156370978 18:36470972-36470994 CTGCTCTAGAGGAGTAAAGCAGG - Intronic
1156823501 18:41401606-41401628 AGGCTCTAGAAGAAAACAGGAGG + Intergenic
1157183145 18:45515608-45515630 AGGATCTAGAAAAGAAGAGGAGG + Intronic
1157238349 18:45985130-45985152 ATCCACTTGAGGAGCAGAGGTGG - Exonic
1157322751 18:46646992-46647014 GTGCTCTAGAGCAGAATGGGTGG - Intronic
1157323131 18:46649265-46649287 ATACACTGGAGGAGGAGAGGAGG + Intronic
1157963308 18:52181038-52181060 CTGCTCAAGAGGTGGAGAGGAGG + Intergenic
1157972283 18:52284328-52284350 AAGCTCAAGAGGAGAAGAAAGGG + Intergenic
1159559674 18:69980229-69980251 ATGTTTGAGAAGAGAAGAGGTGG - Intergenic
1159653091 18:71000407-71000429 CTGCTCTATAGGAGAGGATGGGG + Intergenic
1160504653 18:79420159-79420181 TTGCTGCAGAGGGGAAGAGGGGG + Intronic
1163675044 19:18651470-18651492 AGGTTCCAGAGGAGAACAGGGGG + Intronic
1164691681 19:30215542-30215564 TTGCTCTAAAAGAGAAGGGGAGG - Intergenic
1164942188 19:32259297-32259319 ATGCTCTCAAGGAAAAGAGTGGG - Intergenic
1165148009 19:33744272-33744294 TTGGTCTAGTGGAGAAAAGGTGG + Intronic
1165759227 19:38310805-38310827 AAGCCCTTGAGGAGGAGAGGAGG - Intronic
1165930366 19:39354244-39354266 TTACTCTAGAGGAGAAAAGCAGG - Intronic
1166125757 19:40714631-40714653 ATTGCCTGGAGGAGAAGAGGAGG + Exonic
1166353834 19:42215589-42215611 ACGCTCTAGAAGAGAAGATTTGG - Intronic
925283442 2:2700949-2700971 CTGCTCTAGAGGGGAAGGGGAGG - Intergenic
926127297 2:10279438-10279460 ATGATGTGGTGGAGAAGAGGAGG + Intergenic
926241064 2:11085799-11085821 ATGATCCAGAGAAGAACAGGAGG - Intergenic
927014842 2:18948804-18948826 ATGCTCAAGAAGAGAACAGTAGG + Intergenic
928098309 2:28419351-28419373 TTGCCCTATAGGTGAAGAGGTGG - Intergenic
929264361 2:39901807-39901829 TTGCTTTACAGAAGAAGAGGAGG - Intergenic
929587963 2:43127854-43127876 GTGCTGCAGAGGGGAAGAGGCGG + Intergenic
930268879 2:49232722-49232744 ATCCTTTGGAGGAGAAGAGGCGG + Intergenic
931558581 2:63531793-63531815 ATCCTTTGGAGGAGAGGAGGTGG - Intronic
931608229 2:64073426-64073448 GTGCTCCAGAGGAGAAGGAGAGG - Intergenic
931968041 2:67555241-67555263 ATGCTCTATTGGTGAAGAGAGGG + Intergenic
934028835 2:88023420-88023442 AGGCTCAGGAGGAGAAGAGGAGG + Intergenic
935499703 2:103823495-103823517 CTGCTTTGGAGGATAAGAGGAGG + Intergenic
935977576 2:108594115-108594137 ATGCACCAGCAGAGAAGAGGTGG + Intronic
937224477 2:120360325-120360347 TGGCTCTAGAGGATGAGAGGTGG + Intergenic
937527894 2:122793410-122793432 ATGCTTCAGAAGAGAGGAGGAGG + Intergenic
937702214 2:124876421-124876443 ATGCAAAAGAGAAGAAGAGGTGG - Intronic
937884196 2:126889108-126889130 CTGCTGCAGAGGAGGAGAGGAGG - Intergenic
938227264 2:129626753-129626775 ATGCTCTCCTGGAGAAGAAGAGG + Intergenic
938313447 2:130310090-130310112 ATGGTCCAGTGGAGGAGAGGAGG - Intergenic
939296119 2:140266568-140266590 ATGCACAACAGGAGAAGAGAAGG - Intronic
940099768 2:150021297-150021319 AAGCTCAAGAGGGGAAGAGGAGG + Intergenic
940450059 2:153825976-153825998 ATGTTCTAGAGAAAATGAGGAGG - Intergenic
940598649 2:155828412-155828434 ATGTTTTAGAGGACAATAGGTGG + Intergenic
941532487 2:166686869-166686891 TTCCTTTGGAGGAGAAGAGGTGG - Intergenic
941906773 2:170724037-170724059 AGGCTGTAGAGGAGATGTGGTGG + Intergenic
943567921 2:189538671-189538693 AGGCAGAAGAGGAGAAGAGGTGG - Intergenic
943728382 2:191275539-191275561 ATGTTCTAGACTAGAAGTGGGGG + Intronic
944371993 2:198995092-198995114 ATGCTCTAGGGAAGAAGTGGTGG + Intergenic
945952879 2:216056284-216056306 ATCCTCTACAATAGAAGAGGAGG - Intronic
947523104 2:230863664-230863686 ATGGTTTGGAGGAGACGAGGAGG - Intergenic
1169325194 20:4670170-4670192 CTGCTCTACAGGAGAACAGATGG - Intergenic
1169914017 20:10670168-10670190 ATGTTCTAGAGAGGACGAGGAGG - Intronic
1171043626 20:21789619-21789641 GTGGTGTAGAGGAAAAGAGGAGG - Intergenic
1171514022 20:25713570-25713592 ATCCTTTGGAGGAGAAGAGGTGG + Intergenic
1173085206 20:39909471-39909493 ATGCCCTGGGAGAGAAGAGGAGG + Intergenic
1173890512 20:46505612-46505634 ATGCTCTAGAGCATAAGAGTTGG + Intronic
1177169885 21:17643339-17643361 ATGCCCTAGAGAACAAAAGGAGG + Intergenic
1181716402 22:24733231-24733253 ATGATCTTGAGGGGTAGAGGTGG - Intronic
1181976514 22:26734628-26734650 ATGCTATGGAGGAGAACAGAAGG + Intergenic
1182564955 22:31191212-31191234 AGACTCTAGGGGAGAAGTGGAGG - Intronic
1183409081 22:37644572-37644594 GGGGTCTAGAGGGGAAGAGGAGG - Intronic
1184351561 22:43947449-43947471 GTGCTCCAGTGGAGAGGAGGCGG - Exonic
1184537151 22:45094878-45094900 ATGTTCCAGAGGAGAAGCTGTGG - Intergenic
950917426 3:16660086-16660108 CTGCTTCAGAGGAGAAGAGCAGG + Intronic
951318654 3:21218114-21218136 TGGCTTTAGAGGACAAGAGGTGG + Intergenic
951601435 3:24380478-24380500 ATTCTCTGGTGGAGAGGAGGGGG - Intronic
951974456 3:28488648-28488670 ATGTTCTAAATGAGTAGAGGTGG - Intronic
953002638 3:38949876-38949898 ATGTATTAGAGGAGAAGATGAGG - Intronic
953221199 3:40973382-40973404 CTGTTGTAGAGAAGAAGAGGAGG + Intergenic
953518316 3:43618500-43618522 ATGCTCTAGAGGCTGTGAGGTGG + Intronic
954977963 3:54714674-54714696 ATGATCCAGAGGCAAAGAGGTGG - Intronic
955754709 3:62215756-62215778 ACCCTGTAGAGGAGGAGAGGGGG + Intronic
957716755 3:83938090-83938112 ATGACCTGGAGGAGATGAGGAGG - Intergenic
960041233 3:113151766-113151788 AAGCCCCAGAGGTGAAGAGGAGG + Intergenic
961003956 3:123392056-123392078 ATGCTTTAGATGTGAGGAGGAGG - Intronic
961019243 3:123490444-123490466 AGGCTCTACATGAGGAGAGGTGG + Intergenic
961293127 3:125863703-125863725 ATACAGAAGAGGAGAAGAGGAGG - Intergenic
962599736 3:136982629-136982651 CTGCTCTGGAAGTGAAGAGGTGG + Intronic
963984556 3:151576777-151576799 ATGGTCTAAAAGAGGAGAGGCGG + Intergenic
964296502 3:155239855-155239877 ATGCGCCAGCGGGGAAGAGGAGG + Intergenic
965342542 3:167507909-167507931 ATTCTCAAGAGGAGAAGTGATGG + Intronic
967126827 3:186431533-186431555 ATGCTGTAGAGTAAAATAGGTGG + Intergenic
968001818 3:195211782-195211804 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001831 3:195211827-195211849 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001843 3:195211872-195211894 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001866 3:195211962-195211984 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001877 3:195212007-195212029 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001889 3:195212052-195212074 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001901 3:195212096-195212118 AAGATCTGGAGGAGGAGAGGGGG + Intronic
968001914 3:195212141-195212163 AAGATCTGGAGGAGGAGAGGGGG + Intronic
969203169 4:5622130-5622152 ATGATCCACAGGAGCAGAGGGGG - Intronic
969784628 4:9445209-9445231 AAGGGCTAGAGGTGAAGAGGTGG + Intronic
969943822 4:10762204-10762226 ATGTTCTAGTGGAAAAGAGATGG + Intergenic
976064426 4:81167848-81167870 ATACTCTCAAGGAGAAGAGGAGG + Intronic
978464299 4:108992032-108992054 ATGCTCTTGAAAAGAAGTGGAGG - Intronic
980101657 4:128547454-128547476 AAGAGCTTGAGGAGAAGAGGTGG + Intergenic
980157002 4:129119283-129119305 ATACTCTAGAAGAGATTAGGGGG - Intergenic
981918279 4:150058778-150058800 CTTCTATAGAGGAGAAGAGTGGG - Intergenic
982297905 4:153848781-153848803 CTGCTCTCAAGGAGAATAGGGGG - Intergenic
982675783 4:158374276-158374298 ATGTTCTGGAAGAGAAGAGGAGG + Intronic
984300261 4:177907924-177907946 ATGTTCCAGAGGAGAAAAAGAGG - Intronic
984708299 4:182863764-182863786 GTGCTCTGGAGGGGAAGTGGGGG - Intergenic
986185285 5:5430042-5430064 AAGCTCTAGAAGAGGAGAGCAGG + Intronic
986389898 5:7274978-7275000 AGGCTCTAGAGGGGAGGAGAAGG + Intergenic
987604442 5:20114899-20114921 CTGTAGTAGAGGAGAAGAGGTGG + Intronic
989242020 5:39212527-39212549 AAGCTCTAAAGGAGAAGAAATGG - Intronic
990907881 5:60823171-60823193 AAGGTCTAGAGGAGAAAATGAGG + Intronic
991585641 5:68198954-68198976 ATGCACAAGAGAAGAAGAGCTGG - Intergenic
994362507 5:98868865-98868887 ATGCAGTAGAGGAGAATAGTAGG - Intronic
995873469 5:116766140-116766162 CTGCTTTAGGGGAGAAGAGCAGG + Intergenic
996315783 5:122159249-122159271 ATGATCCAGTGGAGAAAAGGAGG + Intronic
997532618 5:134591576-134591598 AGGCACTGGAAGAGAAGAGGAGG + Intergenic
998459125 5:142296383-142296405 AAGCTCTCGAGGGGAAAAGGAGG - Intergenic
999137226 5:149329974-149329996 ATGATGAAGAGGAGAAGAAGAGG - Intronic
1000514416 5:162222129-162222151 TTGCTCTACAGGAAAAGAGTTGG + Intergenic
1002525843 5:179815815-179815837 ATGCTCTGGAGCAGAAGGCGTGG - Intronic
1004075430 6:12340248-12340270 ATTGTCAAGAGGAGAAGAGTTGG + Intergenic
1004880569 6:20003260-20003282 AAGTTCTAGAGGAGAAGAAAGGG + Intergenic
1004947482 6:20631540-20631562 ATGCTCAAGTGGAGAAGAGATGG - Intronic
1005341857 6:24850761-24850783 GTGTTCTGGTGGAGAAGAGGGGG - Intronic
1005816313 6:29555299-29555321 TAGCTTTAAAGGAGAAGAGGGGG + Intergenic
1006474199 6:34244501-34244523 ACTCCCTAGGGGAGAAGAGGAGG - Intronic
1006781219 6:36633645-36633667 ATGTTCTAGAGGAGCAGAATGGG + Intergenic
1007409246 6:41652297-41652319 GTGATCTGGAGGAGAAGAGTGGG + Intronic
1008039269 6:46778730-46778752 ATGATGTTGAGGAGGAGAGGAGG + Intergenic
1008507584 6:52245996-52246018 ATGGTCTTGGGGAGAAAAGGTGG + Intergenic
1009384757 6:63075323-63075345 ATTCTTTGGAGGAGAAGAGGTGG + Intergenic
1010316802 6:74460797-74460819 ATGCTGGAGAGGAGAGGATGTGG + Intergenic
1011229118 6:85140042-85140064 GTGCTGTAGAGGCAAAGAGGGGG - Intergenic
1012754864 6:103215899-103215921 ATGGTTTAGTGGAAAAGAGGTGG - Intergenic
1013437491 6:110125436-110125458 ATGCTTCAGAGGATAAAAGGAGG - Intronic
1013441433 6:110174253-110174275 ATGCTGTAAAGGAAAAGAAGAGG - Intronic
1013464599 6:110406741-110406763 ATGTTGTAGAGGTGAAGTGGGGG - Intronic
1014285669 6:119494627-119494649 AGGCTGTAGAGGAGAAGATAGGG + Intergenic
1014440343 6:121466746-121466768 ATTATCTAGAAGGGAAGAGGAGG + Intergenic
1014754841 6:125291671-125291693 ATTTTCTAGAGGAGAAAATGTGG + Intronic
1015708918 6:136118163-136118185 ATGCTTCCTAGGAGAAGAGGTGG - Intronic
1015734964 6:136389375-136389397 CTGCTGTGGAGGAGAAGCGGAGG - Exonic
1016083663 6:139885848-139885870 ATGCTCTTGTGGAGCATAGGTGG + Intergenic
1016620332 6:146102104-146102126 ATGGACTAGAGGAGAACAAGAGG - Intronic
1017086021 6:150713695-150713717 ATTCTCAAGAGCAGCAGAGGAGG - Intronic
1017135329 6:151142754-151142776 ACTCTCTAGAGGAGAAGCTGCGG + Intergenic
1017473005 6:154758855-154758877 ATGCTGTAGAGGAGGAGGGAAGG - Intronic
1019599561 7:1874453-1874475 AGGCTCTGGTGGAGGAGAGGAGG + Intronic
1023357180 7:39379003-39379025 AAGGTCTAGTGGAAAAGAGGAGG + Intronic
1023760634 7:43462307-43462329 ATGCACTGGAGGAGAGGAGCTGG - Intronic
1024208105 7:47180987-47181009 ATGCACTTGCAGAGAAGAGGGGG + Intergenic
1024388038 7:48775595-48775617 ATGCATTAGGGCAGAAGAGGTGG - Intergenic
1024464769 7:49700621-49700643 TTGCTATACAGGAGAAAAGGAGG - Intergenic
1024666960 7:51557196-51557218 ATCCTCTGGAGGAGAAGAGGTGG + Intergenic
1024887152 7:54156618-54156640 ATTCCCAAGAGCAGAAGAGGGGG - Intergenic
1026479575 7:70766096-70766118 TTGCTCTGGAAGAGAAGAAGAGG - Exonic
1027722596 7:81763394-81763416 ATGCACTAAAGGAGGAGAGAGGG - Intronic
1027768758 7:82380041-82380063 ATGCTATAGTGGAGAGAAGGTGG - Intronic
1028221011 7:88196610-88196632 ATGCTACAGAGGAGAGGAAGCGG + Intronic
1030872309 7:114771824-114771846 ATGCCCAAGATGAGAAGAGAAGG + Intergenic
1032555253 7:132826180-132826202 ATGCTCAAGAGAACAAGAGGAGG + Intronic
1032588601 7:133171420-133171442 TTGCTCTAGAAAAGCAGAGGAGG - Intergenic
1034030133 7:147752568-147752590 AAGCTCTAGAAAATAAGAGGTGG + Intronic
1034313176 7:150108109-150108131 ATGCTGGAGAGGAGAACAGCAGG + Intergenic
1034793686 7:153992558-153992580 ATGCTGGAGAGGAGAACAGCAGG - Intronic
1036086190 8:5615778-5615800 ATGTTCTAGAAAGGAAGAGGAGG + Intergenic
1036834407 8:12048923-12048945 AAGGGCTAGAGGTGAAGAGGTGG - Intergenic
1036856251 8:12295487-12295509 AAGGGCTAGAGGTGAAGAGGTGG - Intergenic
1037466831 8:19169147-19169169 ACGGTATGGAGGAGAAGAGGAGG + Intergenic
1039205368 8:35147090-35147112 ATTCTCTAGAGTAAAGGAGGTGG + Intergenic
1043522748 8:81063881-81063903 ATGCTCCAGAGGAAATGAGGAGG + Intronic
1044842455 8:96348496-96348518 ATGGTCTATAAGAGAAGATGAGG + Intergenic
1046821908 8:118643089-118643111 AGGCTCTAGAGGGTAAAAGGGGG + Intergenic
1047513220 8:125531238-125531260 ATGCTCTGGTGGAGATGGGGTGG + Intergenic
1048704262 8:137133435-137133457 ATTCTGTGGAGGGGAAGAGGAGG + Intergenic
1053068940 9:35089446-35089468 AGAATCTAGAGGAGGAGAGGAGG + Exonic
1053103531 9:35391181-35391203 CTGCTCTATAGGAGAAGTGAGGG - Intronic
1055706771 9:79013997-79014019 AAGCTGTAGAGGAGAGGATGTGG - Intergenic
1056024204 9:82475676-82475698 AGGCTGAGGAGGAGAAGAGGAGG + Intergenic
1057845311 9:98518150-98518172 CTGCTCTGGAGGACAAGGGGAGG - Intronic
1058341529 9:103903504-103903526 GTGAGCTAGAGCAGAAGAGGAGG - Intergenic
1058715496 9:107718836-107718858 ATGCTTTAGAGAAGAATGGGAGG + Intergenic
1058919347 9:109598446-109598468 ATGTTCTAGAGGGGAAGAAGGGG + Intergenic
1059286542 9:113177479-113177501 ATGCTCTAAAAGGGAAGAGATGG + Intronic
1059906179 9:118989551-118989573 ATGCTCTAAAGGATAAGACCAGG - Intergenic
1060088462 9:120722020-120722042 TTGCTCTTAGGGAGAAGAGGCGG - Intergenic
1060586845 9:124791976-124791998 ATGATCTGGAGGAGAGGAGAAGG - Intronic
1061146603 9:128803232-128803254 CTCATCTGGAGGAGAAGAGGAGG - Exonic
1061707140 9:132461853-132461875 AGGCTCTAGAGCAGAAACGGGGG - Intronic
1187570856 X:20499920-20499942 ATGCTCTGAAGGAGAAGGGCAGG + Intergenic
1187595901 X:20772243-20772265 ATCCTTTGGAGGAGAAGAGGCGG - Intergenic
1193447970 X:81628539-81628561 ATGCTCTAGAGGAAAAAAGAAGG - Intergenic
1195621978 X:106966198-106966220 ATGCTCTAGAGAAAAAGCTGAGG + Intronic
1197325609 X:125089867-125089889 ATGCTTAAGAGGATAAAAGGAGG + Intergenic
1198663602 X:138997264-138997286 ATCCTTTGTAGGAGAAGAGGCGG - Intronic
1198848225 X:140936626-140936648 ATGCTCCACAGGAGATGAGAGGG + Intergenic
1199694504 X:150334455-150334477 AAGGTCTAGTGGAGAAGAGATGG - Intergenic
1200754769 Y:6980358-6980380 ATGCTCTAGAGGAAGCTAGGAGG - Intronic