ID: 908489358

View in Genome Browser
Species Human (GRCh38)
Location 1:64627544-64627566
Sequence TGCTCTAGAGGAGAAGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489351_908489358 24 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489358 1:64627544-64627566 TGCTCTAGAGGAGAAGAGGCGGG No data
908489353_908489358 6 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489358 1:64627544-64627566 TGCTCTAGAGGAGAAGAGGCGGG No data
908489354_908489358 -5 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489358 1:64627544-64627566 TGCTCTAGAGGAGAAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489358 Original CRISPR TGCTCTAGAGGAGAAGAGGC GGG Intronic
No off target data available for this crispr