ID: 908489359

View in Genome Browser
Species Human (GRCh38)
Location 1:64627573-64627595
Sequence ACTGTTGCACCTGAGTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489354_908489359 24 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489359 1:64627573-64627595 ACTGTTGCACCTGAGTTCACAGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489359 Original CRISPR ACTGTTGCACCTGAGTTCAC AGG Intronic
902880281 1:19367663-19367685 ATTGTTGCACCTGTGTGTACTGG - Intronic
904400645 1:30254295-30254317 TGTGTTTCACCTGAGCTCACAGG - Intergenic
905314940 1:37076406-37076428 ATTGTTGCACCTGTGATCCCTGG + Intergenic
907268636 1:53277488-53277510 ACTGTTCCACCTGAGTCCCCTGG + Intronic
908489359 1:64627573-64627595 ACTGTTGCACCTGAGTTCACAGG + Intronic
909765907 1:79355540-79355562 ACTGCTGCAACTGAGTCCTCAGG - Intergenic
915119461 1:153619627-153619649 ACTGTTGCCATTGATTTCACAGG - Intronic
918334810 1:183498241-183498263 ACTGTTTCAGCTGAGTGCAGTGG + Intronic
922137035 1:222839306-222839328 ACTGTTCCACCTCAGATCATCGG - Intergenic
1062932270 10:1361132-1361154 AAGGTTGCACCTAAGGTCACGGG + Intronic
1063956640 10:11273423-11273445 ACTGCTCCACCTCAGTTCATCGG - Intronic
1067717903 10:48703957-48703979 ACTGGTGCTGCTGAGGTCACAGG + Intronic
1072612714 10:97029442-97029464 ACAGTTGCACCTGAGGTGCCAGG + Intronic
1077497790 11:2894902-2894924 ACAGTTGCCCCTGAGGTCCCAGG - Intronic
1078718829 11:13864771-13864793 ACTGTTCCACCTCAGATCATCGG - Intergenic
1080357270 11:31464510-31464532 ATTGTTGCATCTGAGCTCATTGG - Intronic
1085170294 11:74444132-74444154 ATTATTGCTCCTGAGTTCACAGG + Intergenic
1086895649 11:92309199-92309221 ACTGCTGCCCCAGAGTGCACCGG + Intergenic
1089716165 11:120361361-120361383 ACTGTTCCACCTCAGATCATCGG - Intronic
1090186413 11:124741862-124741884 ACTGTTGCTCTTGAGTGCCCAGG + Intronic
1092164753 12:6336083-6336105 ACTGGAGCACCTAAGGTCACTGG + Intronic
1095150489 12:38789305-38789327 TCTGTTGAAAATGAGTTCACTGG - Intronic
1096625382 12:52892321-52892343 ACTGTTCCTCCTAAGATCACAGG - Intergenic
1097518451 12:60637276-60637298 TTTGTTGCTCCTAAGTTCACTGG + Intergenic
1097906654 12:64926719-64926741 ACTGTTCCACCTCAGATCACTGG - Intergenic
1102818175 12:115885758-115885780 ACTCTTGCACCTGGGGCCACGGG + Intergenic
1103214270 12:119189536-119189558 ACTGTTCCACCTCAGATCATCGG + Intronic
1105989756 13:25607144-25607166 ACTGTTCCACCTCAGATCATCGG - Intronic
1106142211 13:27020833-27020855 ACTGTTCCACCTCAGATCATCGG - Intergenic
1108252317 13:48579454-48579476 CCTGTTACAGCTGAATTCACCGG + Intergenic
1108820854 13:54347483-54347505 CCTGGTGCACTTGAGTTCAGAGG + Intergenic
1111735388 13:92132528-92132550 ACTGGTATACCTGAGTTTACAGG + Intronic
1111864133 13:93746753-93746775 GCTGTTGCACCTTGGTCCACTGG - Intronic
1112917095 13:104565258-104565280 ACTGTTCCACCTCAGATCACTGG + Intergenic
1118155859 14:63241011-63241033 ACTGTTTCTCCTGAGCTCTCTGG - Intronic
1119019266 14:71093252-71093274 GATGTTGCACATGACTTCACAGG + Intronic
1120111106 14:80558326-80558348 ACTGTTGCACTGGAGTGCAGTGG + Intronic
1202890635 14_KI270722v1_random:153974-153996 ATTGTTGCACCTCAGATCATCGG - Intergenic
1123399963 15:19974248-19974270 ATTATTGCACCTGAGAACACTGG + Intergenic
1124236586 15:27994288-27994310 ACTGTTCCACCTCAGATCATCGG - Intronic
1124864465 15:33475401-33475423 ACTGTTCCACCTCAGATCATCGG + Intronic
1127014248 15:54665581-54665603 ACTGTTTCACCTCAGATCATTGG + Intergenic
1127077088 15:55337525-55337547 ACTGTTCCACCTCAGATCACTGG - Intronic
1129050021 15:72773283-72773305 ACTGTCCCACCTGAATTCAGAGG - Intronic
1132138424 15:99367628-99367650 ACCATAGCACTTGAGTTCACTGG + Intronic
1135551769 16:23404022-23404044 ACTACTGCATCAGAGTTCACTGG + Intronic
1137703539 16:50517747-50517769 ACTGTAGAACTTGAGTTCAGAGG + Intergenic
1138804114 16:60073768-60073790 ATTATTGCTCCTGAGTCCACAGG - Intergenic
1141657373 16:85423381-85423403 TCTGCTGCACCTGAGATCCCTGG + Intergenic
1142607836 17:1091706-1091728 ACTGTTGCACCTTGGGGCACAGG + Exonic
1142618552 17:1151133-1151155 ACAGTAGCACCCAAGTTCACAGG + Intronic
1146286090 17:31575043-31575065 TCTGTAGCCCCTGTGTTCACAGG - Intronic
1147466777 17:40616667-40616689 ACTGTAGGACCTGGGTACACAGG + Intergenic
1149951891 17:60997047-60997069 ACGGTTCCATCTGAGATCACCGG + Intronic
1155158285 18:23176254-23176276 ACTGTTCCACCTGAGATCATTGG + Intronic
1157634341 18:49135349-49135371 ACTGTGGCACAAGAGTTAACAGG + Intronic
1158032857 18:52987777-52987799 AGTGTTGCTCCTGAATTCTCTGG + Intronic
1160606821 18:80057892-80057914 ACTGTTCCACCTCAGATCATCGG - Intronic
1162189997 19:8937506-8937528 ACTGTTTCACCTGAGGTACCAGG - Exonic
1162190044 19:8937836-8937858 ACTGTTTCACCTGAGGTACCAGG - Exonic
1162441447 19:10694892-10694914 ATTTTTGCAGCTGAGTCCACTGG + Intergenic
1163870633 19:19818713-19818735 ACTGATGCAGCTGAGTGCAGTGG + Intronic
1164726668 19:30469956-30469978 ACTGTTGCTGCTGATTTCTCTGG - Intronic
1202666057 1_KI270708v1_random:120812-120834 ATTGTTGCACCTCAGATCATCGG - Intergenic
926652242 2:15359046-15359068 TCTGTTCCAACTGAGTTCTCAGG - Intronic
926701525 2:15807385-15807407 ACTGTTCCACCTCAGATCATCGG - Intergenic
926705155 2:15831970-15831992 ACTGTTGGCCATGAGTTCAATGG - Intergenic
926798831 2:16641030-16641052 ACTGTAGGATCAGAGTTCACGGG - Intronic
927229773 2:20810901-20810923 ACTGTTCCATCTCAGATCACTGG - Intronic
929215603 2:39408568-39408590 GATGTTGCACATGACTTCACAGG + Intronic
929815802 2:45230343-45230365 ATTGTTCCACCTCAGATCACTGG - Intergenic
938985381 2:136570460-136570482 ACTATTTCACCTCAGATCACAGG + Intergenic
939376328 2:141372933-141372955 AATGTTGCACCTCAATTAACTGG - Intronic
940233241 2:151481846-151481868 ACTGTTCCACCTCAGATCATCGG - Exonic
941160313 2:162027811-162027833 ACTGATGCACGTGAGTTTCCTGG - Intronic
941991720 2:171563436-171563458 AGTGTTCCAGGTGAGTTCACTGG - Intergenic
945260188 2:207835961-207835983 ACAGCTGCACCAGAGTTAACTGG + Intronic
947378970 2:229526545-229526567 ACTGTTCCACCTCAGCTCATCGG + Intronic
947387321 2:229604502-229604524 GCTCTTGCACCTGGTTTCACAGG - Intronic
947896512 2:233678903-233678925 GATGTTGCACATGACTTCACAGG - Intronic
948165382 2:235857296-235857318 ACTGTTCCACCTTAGATCATCGG - Intronic
1168879663 20:1195738-1195760 ACTGTTCCACCTGAGATCTGAGG + Intergenic
1176052589 20:63128207-63128229 ACTGGCACACCTGTGTTCACAGG - Intergenic
1176889326 21:14295014-14295036 TCTGTTACCCCTTAGTTCACAGG + Intergenic
1177931321 21:27287553-27287575 ACATTTGCTCCAGAGTTCACAGG + Intergenic
1178157864 21:29875472-29875494 GCTGTTGCAGCTGAGTGCAAAGG - Intronic
1179201545 21:39227371-39227393 ACTGTAGTACCTGTTTTCACAGG - Intronic
1179380869 21:40897831-40897853 ACCCTTGCACCTGTGTTCCCTGG + Intergenic
1180210305 21:46291970-46291992 ACTGTAGCCTCTGAGTTCTCTGG - Intronic
1182857359 22:33529578-33529600 AGTGATTCACCTAAGTTCACTGG - Intronic
1183616320 22:38947979-38948001 AGTGCTGACCCTGAGTTCACTGG - Intergenic
1184958070 22:47905876-47905898 ACTGTTCCACCTCAGATCATCGG + Intergenic
953678592 3:45022460-45022482 ACTGTTCCACCTCAGATCATTGG + Intronic
953748396 3:45592434-45592456 ACTGTTCCACCTCAGATCATCGG + Intronic
954635066 3:52066756-52066778 ACTGTTCCACCTCAGATCATAGG - Intergenic
955072865 3:55586117-55586139 ACTGGTGCACCTGAGGTGACTGG + Intronic
955444185 3:58991627-58991649 ACTGTTCCACCTGAGATCTCAGG + Intronic
957668092 3:83262636-83262658 ACTGTTCCACCTCAGATTACTGG - Intergenic
964537981 3:157746626-157746648 AATGTTGTACATGACTTCACAGG - Intergenic
965347277 3:167567454-167567476 CGTGTTGCACATGACTTCACAGG - Intronic
968265966 3:197363658-197363680 AGTGTTCCTGCTGAGTTCACTGG - Intergenic
970466996 4:16334197-16334219 GCTGATGCACCTGAGTTCCCTGG + Intergenic
972100059 4:35404222-35404244 ACTATGGGACCTGAGTTCTCAGG - Intergenic
974593702 4:63988918-63988940 ACTTTTGCACCTATGTTTACGGG - Intergenic
975902982 4:79175054-79175076 ACTGTTCCAGCTGACTCCACAGG - Intergenic
977872600 4:102110458-102110480 ATTTTTGCACCTGTGTTCATCGG - Intergenic
981609457 4:146577871-146577893 ACTGTTCCACCTCAGATCATCGG + Intergenic
981755915 4:148141833-148141855 ACTGTTCCACCTCAGATCATCGG - Intronic
981758843 4:148171507-148171529 ACTGTTCCACCTCAGATCATCGG + Intronic
984499217 4:180537098-180537120 ACTCTTCTACCTGAGTGCACTGG - Intergenic
985003598 4:185510695-185510717 ACTGTTGACCCTGAGAACACGGG - Intronic
986663962 5:10083865-10083887 ACTTTAGCACCTTATTTCACAGG - Intergenic
991163985 5:63540165-63540187 ACTGTTCCACCTCAGATCAAAGG - Intergenic
994060921 5:95475749-95475771 ACTCTTGCACTTGGTTTCACAGG + Intronic
994501440 5:100583702-100583724 GATGTTGCACATGACTTCACAGG - Intronic
995403249 5:111765144-111765166 ACTGTTCCACCTCAGATCATCGG + Intronic
995428122 5:112046752-112046774 TTGGTTGCTCCTGAGTTCACTGG - Intergenic
995942938 5:117607191-117607213 ACTGTTGCATTTGATTTCCCAGG + Intergenic
998276008 5:140753870-140753892 ACTGTTGGACATGAGCTCTCAGG - Intergenic
1000183843 5:158839831-158839853 ACTGTACCACCTGTGCTCACTGG - Intronic
1002410409 5:179070225-179070247 ACTGTTCCATCTCAGATCACAGG - Intronic
1002779179 6:353416-353438 ACTGTTCCATCTCAGATCACTGG - Intergenic
1006272996 6:32978600-32978622 ACTGTTCCACCTCAGATCATTGG + Intronic
1013195970 6:107845878-107845900 CGTGTGGCACCTGAGTTCAATGG - Intergenic
1013894067 6:115063663-115063685 ACTGTTGAACCTCAATTCTCAGG + Intergenic
1014127331 6:117791977-117791999 ACTCTTGCACCCGAGTGCAGGGG + Intergenic
1015821166 6:137261579-137261601 ACTTTTACATCTGAGTTCAATGG + Intergenic
1018780494 6:167059611-167059633 ACTGTTTCCCCTGAGTTCTGTGG - Intergenic
1021554385 7:21904636-21904658 ACTGTTCCACCTCAGATCATCGG - Intronic
1021749999 7:23787636-23787658 ACTGTTCCACCTCAGATCACAGG - Intronic
1024526768 7:50355827-50355849 ACTGTGGCCTCGGAGTTCACAGG - Intronic
1026057504 7:66997088-66997110 ACTGTTGCACTTGACAGCACCGG + Intronic
1026386185 7:69850257-69850279 CCTGTTGCACTGGAGTACACTGG - Intronic
1026720604 7:72827944-72827966 ACTGTTGCACTTGACAGCACCGG - Intronic
1028162549 7:87501721-87501743 TTTGTTGCATCTGAGATCACTGG + Intergenic
1029101470 7:98134127-98134149 ACTGTCCCACCTGGGTTCATGGG + Intronic
1034135239 7:148761882-148761904 ACTGTTCCACCTCAGATCAAAGG + Intronic
1034623592 7:152475318-152475340 ACTGGTTCACCTGAGGTCACGGG + Intergenic
1036967480 8:13316669-13316691 ACTTTTGCACCTAAGGTCATTGG + Intronic
1037212564 8:16409257-16409279 ACTCTAGCTTCTGAGTTCACAGG - Intronic
1039474354 8:37831634-37831656 ACCCTTGCACCTGACATCACAGG + Intronic
1039645214 8:39274912-39274934 ACTGTTACACTGGAGTTCATGGG + Intronic
1039715756 8:40107032-40107054 ACTTTTGGACCTGAGGTCAGGGG - Intergenic
1040711920 8:50199018-50199040 ACTTTTGCTCCTGACTTCCCAGG - Intronic
1041704539 8:60831957-60831979 AGTGTTGCACCTGGGATCATTGG + Intronic
1041850236 8:62382873-62382895 GATGTTGCACATGACTTCACAGG - Intronic
1042386065 8:68176154-68176176 AATTTTACATCTGAGTTCACTGG - Intronic
1045568733 8:103348254-103348276 ATTATTGCACTTCAGTTCACTGG - Intergenic
1046668201 8:117028412-117028434 ACTGTTGCCCCTGATTTCTGGGG + Intronic
1046908822 8:119603947-119603969 AATGTTGCACCTAAGGTCAGAGG - Intronic
1047322092 8:123796366-123796388 GATGTTGTACCTGACTTCACAGG + Intronic
1051055560 9:12980957-12980979 AGTGTTGCACCTGGTTTCCCTGG + Intergenic
1053630101 9:39928646-39928668 ACTGTTCCACCTCAGATCATCGG + Intergenic
1054213786 9:62322056-62322078 ACTGTTCCACCTCAGATCATCGG - Intergenic
1055019568 9:71655209-71655231 ACTCTTGCATGTGAGTTCAGAGG - Intergenic
1055083061 9:72286299-72286321 ACTGTGACATCTGAGTTCTCTGG + Intergenic
1055224823 9:73983834-73983856 ACTGTTGCAGCTCAGCTCCCTGG - Intergenic
1056300970 9:85241123-85241145 ATTTTTGCATCTGTGTTCACAGG - Intergenic
1056443295 9:86641394-86641416 ACTGATGCACCGTAGCTCACAGG + Intergenic
1057218410 9:93242498-93242520 AATGGTGCACCTGAAGTCACAGG - Intronic
1058263033 9:102860247-102860269 ACTGTTGAATTTGAGTTCTCTGG + Intergenic
1058665641 9:107312885-107312907 ATTGATGCTCCTGAGTTCCCGGG + Intronic
1059045714 9:110863941-110863963 ACTATTTCTCCTTAGTTCACAGG + Intergenic
1060788586 9:126469813-126469835 ACTTTTCCACATGAGTTCAAAGG - Intronic
1186653092 X:11582301-11582323 TCTGTTGCCCCTGTGTTGACCGG - Intronic
1187639243 X:21269853-21269875 ATTTTTGCATCTGTGTTCACTGG - Intergenic
1196354277 X:114771729-114771751 TTTGTTACAACTGAGTTCACAGG + Intronic
1196513150 X:116538059-116538081 ACTTTTGCATCTGCGTTAACTGG + Intergenic
1196516695 X:116621677-116621699 ACTTTTGCATCTGTGTTCATCGG + Intergenic
1197521640 X:127505738-127505760 ACTGTGGCTCCTGAGGTCATCGG + Intergenic
1198783428 X:140260813-140260835 TTGGTTGCTCCTGAGTTCACTGG - Intergenic
1198968912 X:142258123-142258145 GCCGCTGGACCTGAGTTCACAGG + Intergenic
1199441436 X:147872733-147872755 TTTGTTGCAAATGAGTTCACTGG - Intergenic
1199594313 X:149494438-149494460 AGTGTGGCCCCTGAGGTCACTGG + Intronic
1199596483 X:149510025-149510047 ACTGCTGCACCTTAGTCCTCAGG - Intronic