ID: 908489360

View in Genome Browser
Species Human (GRCh38)
Location 1:64627574-64627596
Sequence CTGTTGCACCTGAGTTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489354_908489360 25 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489360 1:64627574-64627596 CTGTTGCACCTGAGTTCACAGGG 0: 1
1: 0
2: 0
3: 9
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489360 Original CRISPR CTGTTGCACCTGAGTTCACA GGG Intronic
901529080 1:9842495-9842517 CTGGAGCCCCTGAGGTCACATGG - Intergenic
903317537 1:22520272-22520294 CAGTGGCACCTGAGGTCACCTGG - Exonic
904058346 1:27686842-27686864 CTGTTCCTCCTGGCTTCACACGG + Intergenic
904245546 1:29185331-29185353 CTGTGCCTCCTGGGTTCACACGG + Intergenic
905333186 1:37223116-37223138 CTGTTGCACCTCAGATCATCAGG + Intergenic
906390510 1:45411366-45411388 CTGTTCCACCTGAGATCATCAGG + Intronic
906435684 1:45794503-45794525 CTGTTCCACCTCAGTTCATCAGG - Intronic
906554095 1:46693734-46693756 GTTTTGCTCCAGAGTTCACATGG - Intronic
908489360 1:64627574-64627596 CTGTTGCACCTGAGTTCACAGGG + Intronic
910232364 1:84998953-84998975 CTGTTGCACCTTAGATCAGTAGG + Intergenic
911761159 1:101619000-101619022 CTGTTCCACCTCAGATCACTAGG + Intergenic
916479233 1:165200457-165200479 CTGGTTCACCTGAGCTCAGAAGG - Intergenic
917205616 1:172568100-172568122 CTGTTCCACCTTAGATCATAAGG - Intronic
917456369 1:175189361-175189383 CACTTGCAGCTGAGTCCACATGG - Intronic
918085029 1:181238010-181238032 CTGTTGGCCCTGAGGTCTCAAGG - Intergenic
918236218 1:182582936-182582958 CTGTTGCTCCTGAGGGGACATGG - Intronic
919265072 1:195252287-195252309 CTGTTCCACCTGAGATCATCAGG - Intergenic
920185127 1:204154794-204154816 CTGTTGCATCTGGGTTCACTAGG - Intergenic
920212199 1:204336243-204336265 CTGTTGCCCTTGAGATGACAGGG + Intronic
922382904 1:225050874-225050896 CTGTTCCACCTCAGTTCATCAGG + Intronic
922697993 1:227741287-227741309 CTCATGCACCTGACTGCACAGGG - Intronic
1063199509 10:3774365-3774387 CTGTTTCACCTTAGATCACCAGG + Intergenic
1063584163 10:7336071-7336093 CTGTTGGAACTGAGTTAAGATGG - Intronic
1064931913 10:20637931-20637953 CTGTTGCAGCTCAGGTCTCAAGG + Intergenic
1066183503 10:32986169-32986191 CAGTTGCAACAGAGATCACATGG - Intronic
1067049923 10:43009437-43009459 CTGTTCCACCTTAGATCACCAGG + Intergenic
1067717904 10:48703958-48703980 CTGGTGCTGCTGAGGTCACAGGG + Intronic
1067936680 10:50618665-50618687 CTGTTCCACATCAGTGCACAAGG - Intronic
1068861781 10:61855122-61855144 CTGTTGCATCTCAGATCACTAGG - Intergenic
1070217877 10:74405662-74405684 CTGTTGCACCTCAGATCATCAGG - Intronic
1072755367 10:98017284-98017306 GTGTTACACCTGAGATCACATGG - Intronic
1073054744 10:100692148-100692170 CTGCTTCTCCTGAGTTCCCAAGG - Intergenic
1073682505 10:105719469-105719491 CTGTTTCACCTCAGATCACCAGG + Intergenic
1075817404 10:125275445-125275467 CTGCTGCACCTGATGTCCCACGG - Intergenic
1076063726 10:127432062-127432084 CTGTTGCACCTCAGATCATCAGG - Intronic
1076314227 10:129529359-129529381 CTGTTCCACCTCAGATCACCAGG + Intronic
1077497789 11:2894901-2894923 CAGTTGCCCCTGAGGTCCCAGGG - Intronic
1078778734 11:14417321-14417343 TTTTTGCATGTGAGTTCACATGG - Intergenic
1079149870 11:17888109-17888131 CTGTTCCACCTCAGATCACCAGG - Intronic
1079399556 11:20094971-20094993 CTTTTGCATCTCTGTTCACAGGG - Intronic
1080350452 11:31379355-31379377 CTGTTCCACCTCAGTTCATCAGG - Intronic
1083068091 11:59946260-59946282 CTGTTCCACCTCAGATCACCAGG - Intergenic
1084372758 11:68755228-68755250 GTGTTACACTAGAGTTCACAGGG - Exonic
1086701302 11:89902892-89902914 ATGTTGCTCCTCAGGTCACAGGG - Intergenic
1086704865 11:89941633-89941655 ATGTTGCTCCTCAGGTCACAGGG + Intergenic
1087541520 11:99527681-99527703 CTGCTGAACCTCACTTCACATGG - Intronic
1087811822 11:102616242-102616264 CTGTGGGACCACAGTTCACATGG - Intronic
1089095162 11:115913981-115914003 CTGTTCCACCTTAGATCACCAGG - Intergenic
1089102905 11:115978877-115978899 CAGTAGCATCTGAATTCACAAGG + Intergenic
1089408846 11:118221433-118221455 CTGTTCCACCTCAGATCACCAGG + Intronic
1089594787 11:119571359-119571381 CAGCTGCACCTTGGTTCACAAGG - Intergenic
1090186414 11:124741863-124741885 CTGTTGCTCTTGAGTGCCCAGGG + Intronic
1093269669 12:17044577-17044599 CTGTTCCACCTCAGATCATAAGG + Intergenic
1095322667 12:40847874-40847896 CTGTTCCACCTCAGATCATAAGG + Intronic
1095544360 12:43347353-43347375 CTGTTGGAGCTGAGGTCATATGG + Intergenic
1096691364 12:53324120-53324142 CTGTTACACCTGAGATCATCAGG + Intronic
1096769001 12:53920929-53920951 CTATTGTACCTGAGATCCCAGGG - Intergenic
1097433713 12:59536183-59536205 ATGTTACACCTGATATCACAGGG + Intergenic
1097906653 12:64926718-64926740 CTGTTCCACCTCAGATCACTGGG - Intergenic
1099661556 12:85569404-85569426 CTGTTCTACTTGAGGTCACATGG - Intergenic
1099871625 12:88356592-88356614 CTGTTACACCTCAGTTCATCAGG - Intergenic
1100506390 12:95224863-95224885 CTGTTCCACCTGAGATCATCAGG + Intronic
1101976734 12:109366030-109366052 CTGCTCCACCTGAGATCACCAGG - Intronic
1102862264 12:116346200-116346222 CTGGTCCATCTGACTTCACATGG + Intergenic
1104788189 12:131464825-131464847 ATGTTGTACATGACTTCACAGGG + Intergenic
1105570569 13:21599078-21599100 CTGTTGCACCTCAGATCATCAGG - Intronic
1107011348 13:35673952-35673974 CTCTTGCACCTGAGTCCCTAAGG + Intergenic
1107309172 13:39058480-39058502 CTGTTGCATCTGTGTTCATCAGG + Intergenic
1108252318 13:48579455-48579477 CTGTTACAGCTGAATTCACCGGG + Intergenic
1108519559 13:51234214-51234236 CATTTGTTCCTGAGTTCACAGGG + Intronic
1109050684 13:57477505-57477527 CTTTTGCACCTGTGTTCATAAGG - Intergenic
1110335345 13:74323560-74323582 CTATTCCACCTCAGATCACAAGG - Intergenic
1110615469 13:77536785-77536807 CTGTAGTACTTGAGTTCTCATGG + Intronic
1111034070 13:82647586-82647608 CTGTTGCACCTCAGATCATCAGG + Intergenic
1112917096 13:104565259-104565281 CTGTTCCACCTCAGATCACTGGG + Intergenic
1113202241 13:107878945-107878967 CTGTTGCATCTATGTTCACCAGG - Intergenic
1114576597 14:23719932-23719954 CTGTTGCACCTCAGATCATCAGG - Intergenic
1116957643 14:50941403-50941425 TTGTTGCAGCTGACTTCACGTGG - Intronic
1117439507 14:55746461-55746483 CTTTTGCTCCTCAGATCACAGGG - Intergenic
1117527560 14:56624916-56624938 CTGTTCCACCTGAGATCATCAGG + Intronic
1117717241 14:58593922-58593944 CTGTTCCACCTCAGATCACCAGG - Intergenic
1120311206 14:82830653-82830675 CTGTTCCACCTCAGATCACTAGG + Intergenic
1123571999 15:21622004-21622026 TTGTTGGACCTTTGTTCACAAGG + Intergenic
1123608613 15:22064594-22064616 TTGTTGGACCTTTGTTCACAAGG + Intergenic
1123626161 15:22228137-22228159 CTGTTGCAGCTGAGTGCCAAAGG + Intergenic
1124883315 15:33661591-33661613 CTGTTGCACCTCAGATCATCAGG + Intronic
1125955862 15:43790846-43790868 CTGCTGCTCCTGGGTTCACACGG + Intronic
1126244034 15:46482347-46482369 TTGTTGCAGCTGTGTTCATAAGG + Intergenic
1126474899 15:49055135-49055157 CTGTTCCACCTCAGATCACCAGG - Intergenic
1126892552 15:53222108-53222130 CTGTAGCACTTGAGGTGACAGGG + Intergenic
1129061370 15:72863063-72863085 CTGTTGCACAGGATTTCTCATGG + Intergenic
1202980855 15_KI270727v1_random:356390-356412 TTGTTGGACCTTTGTTCACAAGG + Intergenic
1138756191 16:59488597-59488619 CTCTAGCATCTGATTTCACAAGG - Intergenic
1139031912 16:62894097-62894119 CTGTAGCAGCTTAGTTCATAGGG + Intergenic
1139174331 16:64669408-64669430 CTGTTCCACCTCAGATCACCAGG + Intergenic
1141327082 16:83070994-83071016 ATGATGCACCTGAGTTCTCCTGG + Intronic
1141620359 16:85234032-85234054 CTATTGAACCTGAGTTCCCAAGG - Intergenic
1142015114 16:87741514-87741536 CTGTTGCACCTCAGATCATCAGG - Intronic
1142618553 17:1151134-1151156 CAGTAGCACCCAAGTTCACAGGG + Intronic
1142867455 17:2799361-2799383 CTGTTGTAACTGAGATCAGAAGG + Intronic
1143151984 17:4812915-4812937 CAGTGGCACCTGATCTCACAGGG + Intronic
1143247998 17:5501833-5501855 CTGTTGCACCTGAGGTTCCACGG + Intronic
1147261964 17:39214008-39214030 CTGCTGTACCTGTGGTCACATGG - Intronic
1147466778 17:40616668-40616690 CTGTAGGACCTGGGTACACAGGG + Intergenic
1149350108 17:55778261-55778283 GACTTGCACCTGAGTTCTCAGGG + Intronic
1149808118 17:59638592-59638614 TTGTTTCACCTCAGATCACAAGG + Intronic
1150527852 17:65942268-65942290 CTGTTCCACCTGAGATCATCAGG - Intronic
1153386617 18:4504844-4504866 CTGTTGCACCTCAGATCATCAGG - Intergenic
1153713697 18:7824361-7824383 CTGGTGCACCTGAGACCCCACGG - Intronic
1155158286 18:23176255-23176277 CTGTTCCACCTGAGATCATTGGG + Intronic
1158404038 18:57145633-57145655 ATGTTGCATCTAAGTTCCCATGG + Intergenic
1158858561 18:61569508-61569530 CTGTTGTACCTGAGGACCCAGGG - Intergenic
1162229916 19:9257955-9257977 ATGTTACACCTGATGTCACAGGG + Intergenic
1162833272 19:13299889-13299911 CTGTTTCACCTGAGATCATCAGG + Intronic
1164583201 19:29447926-29447948 CTATTGGACCTGAGTTTTCAAGG + Intergenic
1164760987 19:30728075-30728097 CTGTGGAACATGAGGTCACATGG + Intergenic
1166233745 19:41441370-41441392 CTGTTCCACCTGAGATCATCAGG + Intergenic
1167998633 19:53426734-53426756 CTGTTCCACCTGAGATCATCAGG - Intronic
1168008757 19:53512845-53512867 CTGTTCCACCTGAGATCATCAGG - Intergenic
925034362 2:674378-674400 CTTTTGCCCCTGGGTTCCCAGGG + Intronic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
928432974 2:31235297-31235319 CAGTTGCAGCTGAGTTCTGATGG + Intronic
929650199 2:43671870-43671892 TTTTTGCATCTGTGTTCACAAGG + Intronic
936045616 2:109185655-109185677 CTGGTTCACCTTAGTTCACTAGG + Intronic
938985382 2:136570461-136570483 CTATTTCACCTCAGATCACAGGG + Intergenic
939853323 2:147326117-147326139 ATGTTGTACATGACTTCACAAGG + Intergenic
941075943 2:161006949-161006971 CTGTTCCACCTCAGATCACCAGG + Intergenic
941299349 2:163782121-163782143 CTTTTGCACATGTGTTCCCAAGG + Intergenic
941367302 2:164623059-164623081 CTGTTGCACCTCAGATCATCAGG - Intergenic
943521310 2:188953389-188953411 TTTTTGCACCTATGTTCACAAGG + Intergenic
944123639 2:196269074-196269096 CAGTTTCACCTGGTTTCACATGG - Intronic
944237936 2:197457027-197457049 CTGTTGCACCTCAGATCATCAGG + Intronic
945259183 2:207828559-207828581 CAGCTGCACCTGAGGCCACAGGG - Intronic
1169555372 20:6743888-6743910 CTGTTCCACCTCAGATCACCAGG + Intergenic
1170993159 20:21323908-21323930 TTGTTGCAGCTGAGATCATATGG + Intronic
1171392224 20:24809004-24809026 CTGATACACCTGGGTTGACATGG + Intergenic
1172180622 20:33001232-33001254 CTGCTGGGCCTGAGTTCTCAGGG + Exonic
1173570611 20:44073379-44073401 CTGTTGCACCTCAGGTCATCAGG - Intergenic
1175610265 20:60345374-60345396 CTGCAGCACCTCAGTGCACAAGG - Intergenic
1175651647 20:60729854-60729876 CTGTTTCACCTCAGATCACCAGG - Intergenic
1175765520 20:61590081-61590103 CTGTTGCTCCTGAAATAACAAGG - Intronic
1176052588 20:63128206-63128228 CTGGCACACCTGTGTTCACAGGG - Intergenic
1177931322 21:27287554-27287576 CATTTGCTCCAGAGTTCACAGGG + Intergenic
1178015577 21:28342567-28342589 CTGTTTCAAATGAGTTCCCATGG + Intergenic
1179952545 21:44718128-44718150 CTGTTGCACATCAGTTGATATGG + Intergenic
1181046717 22:20218104-20218126 CTGTCTCACCTGCCTTCACATGG + Intergenic
1181899797 22:26144140-26144162 CTGTTGCACCTGTGATCAGCTGG - Intergenic
1181988636 22:26820040-26820062 CTGTTGCACCTCAGATCATCAGG - Intergenic
1183896454 22:40973228-40973250 CTGTTCCACCTGAGATCATGAGG + Exonic
949615086 3:5744872-5744894 ATGTTTCGCCTGATTTCACAGGG - Intergenic
951011848 3:17690742-17690764 CTGTTCCACCTTAGATCACCAGG - Intronic
954378064 3:50205266-50205288 CTGTTGCAGCCGAGTTCAGCCGG + Exonic
956890364 3:73607372-73607394 CCGTTGGAGCTGAGTTCAGAAGG - Intronic
957404713 3:79762808-79762830 TTGTTGCACATGACTTCAAATGG + Intronic
959209398 3:103357729-103357751 CTGTTGCCCCATAGTCCACAAGG - Intergenic
959775938 3:110162976-110162998 CTGTTCCACCTCAGATCACCAGG - Intergenic
961727267 3:128939761-128939783 CTGTTGCACCTCAGATCACCAGG + Intronic
965853903 3:173065346-173065368 CTGTTGCTTCTTAGTTCAAATGG + Intronic
966090075 3:176123136-176123158 CTGTTCCACCTCAGATCACCAGG - Intergenic
967208667 3:187147613-187147635 CTGTTCCACCTCAGATCACCAGG + Intronic
969139506 4:5056192-5056214 CTGTTCCACCTGAGATCATCAGG - Intronic
969699208 4:8757153-8757175 CTGTTGCACCTCAGATCATCAGG - Intergenic
972100058 4:35404221-35404243 CTATGGGACCTGAGTTCTCAGGG - Intergenic
972105456 4:35479929-35479951 GTGGTGCACCTCAGTTCAAAGGG + Intergenic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
975902981 4:79175053-79175075 CTGTTCCAGCTGACTCCACAGGG - Intergenic
977876688 4:102158077-102158099 CTGTTCCACCTCAGATCACCAGG + Intergenic
978219204 4:106249455-106249477 CTGTGGAACTTGAGTACACATGG + Intronic
979448056 4:120838606-120838628 CTGTTCCACCTCAGATCACCAGG + Intronic
980579354 4:134729777-134729799 CTGTTCCACCTCAGATCACCAGG - Intergenic
980623453 4:135341359-135341381 CTGTTCCACCTCAGATCATAAGG + Intergenic
982009542 4:151093385-151093407 CAGTTGCACCTGAATTCCAAGGG + Intergenic
982714806 4:158795857-158795879 CTGTTGCACCTCAGGTCATCAGG - Intronic
983139072 4:164125875-164125897 CTGTTTCACCTCAGATCACCAGG - Intronic
983167535 4:164496475-164496497 ATGTAGCACCTGAGTACCCAGGG + Intergenic
986395726 5:7327786-7327808 CTGTGGCTTCTGACTTCACAAGG - Intergenic
987298016 5:16571223-16571245 CTGATGCACATCAGTCCACACGG + Intronic
988385652 5:30561231-30561253 CCCTTTCCCCTGAGTTCACAAGG - Intergenic
989768583 5:45115858-45115880 CTGCTGCACTTGACTTTACAAGG - Intergenic
991629204 5:68637549-68637571 CTGTTACACCTGAATTCAATAGG + Intergenic
992209886 5:74468543-74468565 CTGTCGCAACTGAAGTCACAGGG - Intergenic
994777380 5:104051185-104051207 GTTTTCCACCTGAGTGCACATGG - Intergenic
995302970 5:110606629-110606651 CTCTTGCAACTGATTCCACAAGG + Intronic
996619117 5:125478609-125478631 CTGTTGCACCTCAGATCACCAGG + Intergenic
998276007 5:140753869-140753891 CTGTTGGACATGAGCTCTCAGGG - Intergenic
999516880 5:152310571-152310593 CTGTTCCACCTCAGATCATAAGG + Intergenic
999907749 5:156162317-156162339 GTGTTGCACCTGAGTCTAGAAGG + Intronic
1001350216 5:170955068-170955090 CTGTTCCACCTCAGATCACCAGG - Intronic
1001350903 5:170963569-170963591 CTGTTCCACCTCAGATCACCAGG + Intronic
1001842996 5:174895402-174895424 CTGTTGCACCTCAGATCATCAGG + Intergenic
1002213879 5:177614454-177614476 CTGTTGCACCTCAGATCATCAGG - Intergenic
1003408445 6:5841912-5841934 ATGTAGCACCTGTGTTCAAATGG - Intergenic
1008232461 6:49000098-49000120 CAGTTGCAACTGAGTTAACTTGG + Intergenic
1009299396 6:61995616-61995638 CTTTTGCACATGAGATCACATGG - Intronic
1012499798 6:99875779-99875801 CTGTTGCACCTCAGATCATCAGG + Intergenic
1013195969 6:107845877-107845899 GTGTGGCACCTGAGTTCAATGGG - Intergenic
1015306028 6:131709209-131709231 CTGTTCCACCGGAGATGACAGGG + Exonic
1015973870 6:138769672-138769694 CTGTTCCACCTGAGATCATCAGG + Intronic
1016323922 6:142878553-142878575 CGGTTGCCACTGACTTCACATGG - Intronic
1016634290 6:146269742-146269764 CTGTTCCACCTCAGATCACCAGG - Intronic
1018278304 6:162156817-162156839 CTGTTCCACCTGTGTGCAAAGGG - Intronic
1021478188 7:21086385-21086407 CTGTTCCACCTCAGATCACCAGG - Intergenic
1022254250 7:28640290-28640312 ATGTTGTCACTGAGTTCACATGG - Intronic
1022296483 7:29059923-29059945 TTGTTGAAACTGAGGTCACAGGG - Intronic
1024526767 7:50355826-50355848 CTGTGGCCTCGGAGTTCACAGGG - Intronic
1033678953 7:143573604-143573626 CTGTTCCACCGGAGATGACAGGG - Exonic
1033692885 7:143755850-143755872 CTGTTCCACCGGAGATGACAGGG + Exonic
1033731522 7:144185290-144185312 CTGTTCCACCGGAGATGACAGGG - Exonic
1033740142 7:144267442-144267464 CTGTTCCACCGGAGATGACAGGG + Exonic
1034007706 7:147492162-147492184 CTGTTCCACCTCAGATCACCAGG + Intronic
1035001310 7:155614664-155614686 CTGTTCCACCTCAGATCACGAGG + Intronic
1035168337 7:157004441-157004463 CAGTAGCGCCTGAGGTCACAGGG + Intronic
1035416251 7:158689747-158689769 ATGTTTCTCCTGTGTTCACATGG - Intronic
1037140904 8:15519626-15519648 CTGTTGCACCTCAGATCATCAGG - Intronic
1038151612 8:24946021-24946043 CTTTTGCACATGATTTCAAATGG - Intergenic
1040688421 8:49905695-49905717 ATGTTTGACCTGAGATCACAAGG + Intergenic
1042487096 8:69357808-69357830 CTGTTGTTCCTGACTTCAAAGGG + Intergenic
1043214546 8:77569499-77569521 CTCTTGAACCTGCTTTCACAGGG + Intergenic
1045086069 8:98687297-98687319 CTGTTCCACCTCAGTTCATCAGG + Intronic
1045426104 8:102067246-102067268 CTGAAGCACCTGAGGTGACAGGG + Intronic
1046759850 8:118009766-118009788 CTGTTCCACCTGAGATCATCAGG - Intronic
1048599101 8:135899973-135899995 CTGTTTCACCTCAGATCATAAGG - Intergenic
1050301115 9:4259858-4259880 GTTTTACACCTTAGTTCACATGG - Intronic
1050353731 9:4763737-4763759 CTTTTGCACCTGATTTTTCAAGG - Intergenic
1050720454 9:8583079-8583101 CTGTTCCACCTCAGATCATAAGG + Intronic
1054717221 9:68568270-68568292 CTCTTGCAGCTGGGTTTACATGG - Intergenic
1057209765 9:93193357-93193379 GTGTTTCACCTGAGCACACAGGG + Intronic
1058726655 9:107810940-107810962 CTTTTTCATCTGAGGTCACAAGG - Intergenic
1061866579 9:133494475-133494497 CTCGTGTACCTGTGTTCACATGG + Intergenic
1186787574 X:12968046-12968068 CTGTTCCACCTGAGATCATTAGG - Intergenic
1187386236 X:18851311-18851333 CTGTTCCACCTCAGATCACCAGG - Intergenic
1187970021 X:24649648-24649670 CTCTTGGACAAGAGTTCACAAGG - Intronic
1191743630 X:64463283-64463305 CTGTTGGACCTGATCTCTCAGGG - Intergenic
1194818409 X:98474154-98474176 CTGTTCCACCTCAGATCACCAGG - Intergenic
1196484495 X:116189329-116189351 TTTTTGCACCTGTGTTCACTAGG + Intergenic
1197314010 X:124941633-124941655 CTTTTGAACGTGACTTCACAGGG - Intronic
1197483227 X:127013237-127013259 TTGTTGCAGCTTTGTTCACAAGG - Intergenic
1197545117 X:127815183-127815205 CTGTTGCACTCATGTTCACATGG - Intergenic
1197760720 X:130025952-130025974 TTGTTGGACCTGAGTTGAGAAGG + Intronic
1197985852 X:132265983-132266005 CTGTTTCACCTGAGATCATCAGG - Intergenic
1198391387 X:136178837-136178859 CTCTTGCTCCTGGGTTCAAATGG + Intronic
1199596482 X:149510024-149510046 CTGCTGCACCTTAGTCCTCAGGG - Intronic
1201286259 Y:12381322-12381344 CAGTTGCACCTGAATTCCAAAGG + Intergenic