ID: 908494938

View in Genome Browser
Species Human (GRCh38)
Location 1:64685423-64685445
Sequence TGTACCCTTGTACACTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908494936_908494938 28 Left 908494936 1:64685372-64685394 CCTAAGGACACATTTCTCATAAT 0: 1
1: 24
2: 223
3: 613
4: 1402
Right 908494938 1:64685423-64685445 TGTACCCTTGTACACTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908494938 Original CRISPR TGTACCCTTGTACACTGTGG AGG Intronic
No off target data available for this crispr