ID: 908501084

View in Genome Browser
Species Human (GRCh38)
Location 1:64744831-64744853
Sequence CGCCACCCGGACACCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908501084_908501089 -3 Left 908501084 1:64744831-64744853 CCCTCACAGGTGTCCGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 908501089 1:64744851-64744873 GCGGCGCCCGGCCCCGCCTGCGG 0: 1
1: 0
2: 1
3: 31
4: 336
908501084_908501098 13 Left 908501084 1:64744831-64744853 CCCTCACAGGTGTCCGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 908501098 1:64744867-64744889 CCTGCGGACCCGCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 101
908501084_908501100 19 Left 908501084 1:64744831-64744853 CCCTCACAGGTGTCCGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 908501100 1:64744873-64744895 GACCCGCGAGAGGCGGGCGCGGG 0: 1
1: 0
2: 2
3: 8
4: 136
908501084_908501096 12 Left 908501084 1:64744831-64744853 CCCTCACAGGTGTCCGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 908501096 1:64744866-64744888 GCCTGCGGACCCGCGAGAGGCGG 0: 1
1: 0
2: 0
3: 10
4: 84
908501084_908501094 9 Left 908501084 1:64744831-64744853 CCCTCACAGGTGTCCGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 908501094 1:64744863-64744885 CCCGCCTGCGGACCCGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 76
908501084_908501099 18 Left 908501084 1:64744831-64744853 CCCTCACAGGTGTCCGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 908501099 1:64744872-64744894 GGACCCGCGAGAGGCGGGCGCGG 0: 1
1: 0
2: 2
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908501084 Original CRISPR CGCCACCCGGACACCTGTGA GGG (reversed) Intergenic
900589789 1:3454545-3454567 CGCGTCCCGGGCACCTGTGGCGG - Exonic
900907964 1:5574176-5574198 CCCCAGCCCGACACCTGTAAAGG - Intergenic
901523543 1:9804435-9804457 CACCACCTGTCCACCTGTGAGGG + Intronic
904946306 1:34201082-34201104 AGCCACCCTGAAGCCTGTGAGGG - Intronic
905227610 1:36489510-36489532 CCCCAGCCCGACACCTGTAAAGG - Intergenic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
906564488 1:46788952-46788974 CCCCAGCCCGACACCTGTAAAGG + Intronic
908022685 1:59914771-59914793 CCCCAGCCTGACACCCGTGAAGG + Intronic
908501084 1:64744831-64744853 CGCCACCCGGACACCTGTGAGGG - Intergenic
911599872 1:99836348-99836370 CCCCAGCCCGACACCTGTAAAGG - Intergenic
916630341 1:166605939-166605961 CCCCAGCCTGACACCTATGAAGG - Intergenic
920666577 1:207967016-207967038 CACCACACGGACCTCTGTGATGG + Intergenic
920851990 1:209634360-209634382 AGCCACACGGACTCCTGAGAAGG - Intronic
921821189 1:219619149-219619171 CTCCAGCCTGACACCCGTGAAGG - Intergenic
1064834466 10:19510340-19510362 CCCCAGCCCGACACCTGTAAAGG - Intronic
1066220817 10:33335372-33335394 CGCCATCCTGAGACCTGTGGCGG + Intronic
1066635288 10:37493726-37493748 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1067051849 10:43026194-43026216 CTCCACCCGGAACCCTGTGCTGG + Intergenic
1070780477 10:79134657-79134679 GGCTATCCGGACACATGTGAGGG + Intronic
1075641992 10:124071310-124071332 GGCCACAAGGCCACCTGTGATGG - Intronic
1076292724 10:129360234-129360256 AGCCACCCGAACCCCTGTGAGGG + Intergenic
1077062530 11:624165-624187 CCCCACCCGGCCACCTCTGCTGG - Intronic
1082716373 11:56618894-56618916 CCCCAGCCTGACACCCGTGAAGG - Intergenic
1083543414 11:63530858-63530880 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1084242335 11:67830557-67830579 CCCCAGCCTGACACCTGTAAAGG - Intergenic
1088032223 11:105265253-105265275 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1089172707 11:116526348-116526370 CCCCACCTGGGCACCTGGGAGGG - Intergenic
1090207968 11:124896305-124896327 GACCCCCCGGACACCTGTCAGGG + Exonic
1091834690 12:3577208-3577230 CGCCACCAGGGCCCCTGTGCTGG - Intronic
1093031632 12:14294293-14294315 TGCCACCTGGACACCAGGGAGGG - Intergenic
1103696679 12:122821125-122821147 CCCCACCCAGACACCTAAGAAGG + Intronic
1103794322 12:123493007-123493029 CCCCAGCCCGACACCTGTAAAGG + Intronic
1104944333 12:132408967-132408989 GGCCCCCAGGACACTTGTGAGGG - Intergenic
1107700355 13:43041083-43041105 CCCCAGCCCGACACCTGTAAAGG - Intronic
1109959802 13:69615420-69615442 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1112507433 13:99983230-99983252 CGCCAGCCGGGGACCTGGGATGG + Intronic
1114168043 14:20242131-20242153 CCCCAGCCGGACACCCGTAAAGG - Intergenic
1115000524 14:28415867-28415889 CCCCAGCCCGACACCCGTGAAGG + Intergenic
1116481297 14:45393986-45394008 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1120641633 14:87020540-87020562 CCCCAGCCGGACACCCGTAAAGG + Intergenic
1121295744 14:92820556-92820578 CCCCAGCCCGACACCTGTCAAGG - Intronic
1121673219 14:95729681-95729703 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1122232237 14:100312334-100312356 CTCCAGCCGGACACCCGTAAAGG - Intergenic
1122997607 14:105273879-105273901 CCCCAGCCCGACACCCGTGAAGG + Intronic
1123052855 14:105555223-105555245 CCCCAGCCCGACACCCGTGAAGG + Intergenic
1123077437 14:105675611-105675633 CCCCAGCCCGACACCCGTGAAGG + Intergenic
1123088877 14:105732830-105732852 CCCCAGCCTGACACCTGTAAAGG + Intergenic
1125277513 15:38008842-38008864 AGCCACCTGCACACCTGTGCAGG + Intergenic
1129406665 15:75323842-75323864 CCCCAGCCTGACACCCGTGAAGG - Intergenic
1129773930 15:78221614-78221636 CCCCAGCCCGACACCTGTAAGGG - Intronic
1133013520 16:2928304-2928326 CCCCAGCCTGACACCTGTGAAGG - Intronic
1136633644 16:31505096-31505118 CCCCAGCCCGACACCTGTAAAGG + Intronic
1136991477 16:35153859-35153881 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1141416529 16:83879760-83879782 CCCCAGCCCGACACCCGTGAAGG - Intergenic
1142153662 16:88523601-88523623 GGCCACCCTGACACCTCTCAGGG - Intronic
1142364446 16:89642598-89642620 TGCCACCCACACTCCTGTGAGGG - Intergenic
1142430185 16:90022244-90022266 CCCCACCCGCCCACCTTTGAAGG - Intronic
1143401398 17:6646778-6646800 CCCCAGCCCGACACCTGTAAAGG + Intronic
1144608694 17:16689957-16689979 CGCCACCCCGAAACCTCCGAGGG + Intergenic
1144904122 17:18625870-18625892 CGCCACCCCGAAACCTCCGAGGG - Intergenic
1145128469 17:20320872-20320894 CGCCACCCCGAAACCTCCGAGGG + Intergenic
1146839479 17:36140454-36140476 CCCCAGCCGGACACCCGTAAAGG + Intergenic
1151933280 17:77246843-77246865 CGCCACCGGCACACCTGGGCTGG - Intergenic
1152149066 17:78587701-78587723 TGTCTCCCCGACACCTGTGAAGG - Intergenic
1152225213 17:79089812-79089834 CGCCACCTGGACACCTGCCTTGG + Intronic
1159091352 18:63852735-63852757 CCCCACCCTGACACCCGTAAAGG + Intergenic
1159413015 18:68105787-68105809 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1159477554 18:68942813-68942835 CCCCAGCCCGACACCTGTAAAGG - Intronic
1163371420 19:16903354-16903376 TGCCACCCCCACACCTGAGAGGG - Intronic
1163628190 19:18402870-18402892 CCCCAGCCCGACACCCGTGAAGG + Intergenic
1163907055 19:20156876-20156898 CGACACCCCGACACCCGTAAAGG - Intergenic
1165328797 19:35129756-35129778 CCCCAGCCCGACACCTGTAAAGG + Intronic
1165633476 19:37321188-37321210 CCCCAGCCCGACACCTGTAAAGG + Intronic
1166864184 19:45826121-45826143 AGCCACTCGGACACGAGTGACGG - Intronic
1167358910 19:49019633-49019655 TTCCACCCAGACACCTGGGAAGG + Intergenic
1167366603 19:49057881-49057903 TTCCACCCAGACACCTGGGAAGG + Exonic
1167831493 19:52026611-52026633 CCCTACCCCGACACCTGTAAAGG + Intronic
1167991381 19:53364202-53364224 CCCCAACCCGACACCCGTGAAGG + Intergenic
1168002512 19:53460492-53460514 CCCCAGCCTGACACCTGTAAAGG - Intergenic
1168614115 19:57824028-57824050 CCCCAGCCTGACACCTGTAAAGG + Intronic
1168638510 19:58014679-58014701 CCCCAGCCTGACACCTGTAAAGG - Intergenic
924967852 2:94464-94486 CCCCAGCCCGACACCTGTAAAGG + Intergenic
933838055 2:86261701-86261723 CCCCAGCCCGACACCTGTAAAGG + Intronic
933992280 2:87642401-87642423 CCCCACCGGGACCCCTGTGAAGG - Intergenic
934123865 2:88867072-88867094 CCCCAGCCTGACACCCGTGAAGG - Intergenic
934550939 2:95261183-95261205 CCCACCACGGACACCTGTGAGGG + Intergenic
936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG + Intergenic
940358333 2:152769652-152769674 CCCCAGCCTGACACCCGTGAAGG - Intergenic
945305792 2:208257320-208257342 CCCCAGCCTGACACCCGTGAAGG - Intronic
947730103 2:232423407-232423429 CCCCAGCCCGACACCTGTAAAGG + Intergenic
948797136 2:240411085-240411107 CGCCTCCCTCACACCTGCGATGG - Intergenic
948797202 2:240411295-240411317 GGCCTCCCTGGCACCTGTGATGG - Intergenic
1169201612 20:3712908-3712930 CTCCTCCCTGACACCTGAGAGGG + Intergenic
1169470980 20:5885406-5885428 CCCCAGCCTGACACCCGTGAAGG + Intergenic
1169543984 20:6631948-6631970 TGCCACCCAGACAACTATGATGG + Intergenic
1170397854 20:15947239-15947261 CCCCAGCCCGACACCTGTGAAGG - Intronic
1171272864 20:23829895-23829917 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1171338888 20:24411841-24411863 AGCCACCAGGATACCTGTGGAGG + Intergenic
1171495328 20:25550906-25550928 CCCCAGCCCGACACCTGTAAAGG - Intronic
1171900329 20:30850456-30850478 CGCCAGCCCGACACCTGTAAAGG - Intergenic
1172374393 20:34425401-34425423 CTCCAGCCCAACACCTGTGAAGG + Intronic
1175448468 20:59042741-59042763 CGCTACCCGGACATCTCTCAGGG - Exonic
1175573477 20:60041725-60041747 CCCCAGCCCGACACCTGTGAAGG - Intergenic
1177116095 21:17088596-17088618 AGCCACCCAGACACCACTGAAGG - Intergenic
1178760710 21:35399936-35399958 AGCCACCAAGACACCTGCGATGG + Intronic
1180333694 22:11556447-11556469 CACCAGCCTGACACCTGTAAAGG - Intergenic
1180766387 22:18348043-18348065 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1180779928 22:18514335-18514357 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1180812642 22:18771656-18771678 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1180968976 22:19805130-19805152 AGCCACCCTGCCTCCTGTGAGGG + Intronic
1181198801 22:21205904-21205926 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG + Intronic
1203228004 22_KI270731v1_random:88933-88955 CCCCAGCCCGACACCTGTAAAGG - Intergenic
950030387 3:9848226-9848248 CCCCAGCCCGACACCTGTAAAGG - Intronic
951886694 3:27531673-27531695 CCCCAGCCTGACACCTGTGAAGG + Intergenic
952901498 3:38114640-38114662 CACCACCTGGACATCTCTGAGGG + Intronic
952905126 3:38134880-38134902 CCCCAGCCCGACACCTGTAAAGG + Intronic
953767793 3:45757301-45757323 CCCCAGCCCGACACCTGTAAAGG - Exonic
954267630 3:49482308-49482330 CCCCAGCCCGACACCTGTAAAGG + Intronic
955257114 3:57343616-57343638 CCCCAGCCCGACACCTGTAAAGG + Intronic
955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG + Intronic
959985276 3:112564623-112564645 CCCCAGCCCGACACCTGTAAAGG - Intronic
963468191 3:145709794-145709816 CCCCAGCCTGACACCTGTAAAGG - Intergenic
966771903 3:183511497-183511519 CCCCAGCCCGACACCCGTGAAGG - Intronic
967072179 3:185971772-185971794 CGCCACGCGGACACTGGTCATGG - Intergenic
968992801 4:3926042-3926064 CCCCAGCCGGACACCCGTAAAGG + Intergenic
969627762 4:8316453-8316475 TGCAACCAGGACACCTGTGACGG + Intergenic
974952364 4:68598431-68598453 CCCCAGCCCGACACCCGTGAAGG + Intronic
980638263 4:135538435-135538457 CCCCAGCCTGACACCTGTAAAGG + Intergenic
983224523 4:165073532-165073554 CCCCAGCCCGACACCTGTAAAGG + Intergenic
983313266 4:166093638-166093660 CCCCAGCCCGACACCTGTAAAGG - Intronic
984033105 4:174629797-174629819 AGCCAGAGGGACACCTGTGAGGG - Intergenic
985461015 4:190106833-190106855 CCCCAGCCTGACACCTGTAAAGG - Intergenic
985734162 5:1567936-1567958 CACCAGCCCGACACCCGTGAAGG - Intergenic
985738079 5:1596521-1596543 CCCCAGCCCGACACCCGTGAAGG - Intergenic
986130489 5:4925330-4925352 CCCCAGCCCGACACCTGTAAAGG + Intergenic
992779100 5:80112116-80112138 CCCCAGCCCGACACCCGTGAAGG + Intronic
994091240 5:95811413-95811435 CCCCAGCCCGACACCTGTAAAGG + Intronic
998820756 5:146055775-146055797 CTACACCCGGATAACTGTGAGGG - Intronic
998870719 5:146548919-146548941 AGCCTCCCAGACACCTGTGCTGG + Intergenic
999148196 5:149409621-149409643 GCCCACCCCGACACCTCTGAGGG + Intergenic
999951705 5:156658250-156658272 CCCCAGCCCGACACCTGTAAAGG - Intronic
999952608 5:156666462-156666484 CCCCAGCCCGACACCTGTAAAGG - Intronic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1005430254 6:25749059-25749081 CCCCAGCCTGACACCTGTGAAGG - Intergenic
1005638745 6:27775004-27775026 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1005644211 6:27826200-27826222 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1007571469 6:42894246-42894268 CCCCAGCCCGACACCCGTGAAGG - Intergenic
1011693486 6:89891221-89891243 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1014396645 6:120931855-120931877 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1015394777 6:132721350-132721372 CCCCAGCCCGACACCCGTGAAGG - Intergenic
1022477185 7:30719153-30719175 CCCCAGCCCGACACCTGTAAAGG - Intronic
1023869223 7:44254024-44254046 TGCCACCCTGACACCTGACAAGG - Intronic
1025932267 7:66005254-66005276 CCCCAGCCTGACACCCGTGAAGG - Intergenic
1029790564 7:102838913-102838935 CCCCAGCCCGACACCCGTGAAGG + Intronic
1030149825 7:106392700-106392722 AGCCTCCCGGGCACCTGTGGGGG - Intergenic
1046221149 8:111216765-111216787 CCCCACCCAGAAAACTGTGAAGG + Intergenic
1048902297 8:139050528-139050550 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1048947208 8:139460450-139460472 CCCCAGCCTGACACCTGTAAAGG - Intergenic
1049959159 9:721822-721844 CCCCAACCAGACACCAGTGAAGG + Intronic
1056567314 9:87785507-87785529 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1056581298 9:87889420-87889442 CCCCACCAGGACATCTGAGAAGG - Intergenic
1056859465 9:90166643-90166665 CCCCAGCCTGACACCTGTAAAGG + Intergenic
1057826882 9:98378351-98378373 CCCCACCCTGCCAGCTGTGATGG + Intronic
1058806256 9:108595006-108595028 CCCCAGCCCGACACCTGTAAAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060545778 9:124458246-124458268 CGCCACCTGGAGGGCTGTGAGGG + Intronic
1060772221 9:126340572-126340594 CACCACCCCGACTCCCGTGATGG - Exonic
1062321020 9:135990635-135990657 CGCCCCCCGGGCACCTCAGAGGG + Intergenic
1188139062 X:26526016-26526038 CCCCAGCCCGACACCTGTAAAGG - Intergenic
1189249296 X:39587621-39587643 CCCCACTGGGACACCTCTGAAGG - Intergenic
1190320770 X:49178010-49178032 CGCCACGCGGAGTACTGTGATGG - Exonic
1194141310 X:90213733-90213755 CCCCAGCCTGACACCTGTAAAGG + Intergenic
1198308575 X:135406500-135406522 CCCCAGCCCGACACCCGTGAAGG + Intergenic
1200259945 X:154608992-154609014 CCCCAGCCTGACACCCGTGAAGG - Intergenic