ID: 908504456

View in Genome Browser
Species Human (GRCh38)
Location 1:64782352-64782374
Sequence TAGGGTAAAAACTGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908504456_908504459 15 Left 908504456 1:64782352-64782374 CCTTCTTCACAGTTTTTACCCTA No data
Right 908504459 1:64782390-64782412 AATATTTGTTAATTGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908504456 Original CRISPR TAGGGTAAAAACTGTGAAGA AGG (reversed) Intronic
No off target data available for this crispr