ID: 908509836

View in Genome Browser
Species Human (GRCh38)
Location 1:64842924-64842946
Sequence TGGACTTCCGCTGCCATTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908509832_908509836 -9 Left 908509832 1:64842910-64842932 CCCACCCTGCACTCTGGACTTCC No data
Right 908509836 1:64842924-64842946 TGGACTTCCGCTGCCATTTCCGG No data
908509833_908509836 -10 Left 908509833 1:64842911-64842933 CCACCCTGCACTCTGGACTTCCG 0: 1
1: 0
2: 0
3: 21
4: 212
Right 908509836 1:64842924-64842946 TGGACTTCCGCTGCCATTTCCGG No data
908509830_908509836 5 Left 908509830 1:64842896-64842918 CCTCTTCAATATCTCCCACCCTG No data
Right 908509836 1:64842924-64842946 TGGACTTCCGCTGCCATTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908509836 Original CRISPR TGGACTTCCGCTGCCATTTC CGG Intronic
No off target data available for this crispr