ID: 908511924

View in Genome Browser
Species Human (GRCh38)
Location 1:64856569-64856591
Sequence GCCTCCTCCTGAAGTGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908511924 Original CRISPR GCCTCCTCCTGAAGTGGAAT TGG (reversed) Intronic
903983003 1:27203475-27203497 GGCTCCTCAGGAAGTGGGATGGG + Intergenic
903983413 1:27206291-27206313 CCCTCCCCTTGAAATGGAATGGG - Intergenic
904349548 1:29896002-29896024 TCCTCCTGCTGTAATGGAATGGG - Intergenic
904671232 1:32167260-32167282 GGTTCCTCCTGATGTGGCATTGG - Exonic
906168204 1:43703640-43703662 TCCTCCTGCTGAAGGGGAAGTGG + Exonic
906972339 1:50528878-50528900 GCCTCTTCATTAAGTGGAAGTGG - Intronic
907761212 1:57362630-57362652 GCGTCCTTCTGCAGTGGAAGGGG - Intronic
908511924 1:64856569-64856591 GCCTCCTCCTGAAGTGGAATTGG - Intronic
909249000 1:73327714-73327736 CCCTCCTACTGAAGTGGCACCGG + Intergenic
912064268 1:105717205-105717227 GCCTCCTCCTGGTATGGAAAAGG - Intergenic
913242859 1:116844898-116844920 GCCTCCTCCTGTGATGCAATAGG + Intergenic
913670355 1:121092532-121092554 GTCTCCTCCTGAACTTGAAGAGG - Intronic
914022122 1:143879973-143879995 GTCTCCTCCTGAACTTGAAGAGG - Intergenic
914660607 1:149787902-149787924 GTCTCCTCCTGAACTTGAAGAGG - Intronic
916455993 1:164971463-164971485 GGCTCTCCCTGAAGTGGAAGAGG + Intergenic
916821448 1:168402752-168402774 TCCTCTTCCTCAAGGGGAATTGG + Intergenic
916933213 1:169600965-169600987 GCCTCCTCCTGCAGAGAAAGGGG + Intronic
920230259 1:204465558-204465580 GTCCCCTCCTGAAGTGGCTTTGG - Intronic
921527853 1:216240231-216240253 GCATCTTCCTGAAGTGTAAGAGG - Intronic
922155409 1:223037049-223037071 GCCTGGACCTGAGGTGGAATGGG - Intergenic
922880893 1:228979575-228979597 GCCCCCTCCTGCAGGGGAAGTGG + Intergenic
923316670 1:232787005-232787027 TCCTCCTCCGGAGGTGGAAGTGG + Intergenic
923354264 1:233138378-233138400 TCCTTGTCCTGAAGTTGAATAGG + Intronic
923665854 1:235997965-235997987 GCCTCCTGCAGCAGTGGAACAGG + Intronic
1068190501 10:53645938-53645960 GGTTCCTCATGAAGTGGACTGGG + Intergenic
1072030615 10:91518569-91518591 GCCTCCTGCTGAAATATAATGGG - Intergenic
1072674108 10:97452792-97452814 GCATCCTGCTGAGGTGGAAAGGG - Intronic
1072707519 10:97691896-97691918 GCCTTCACCAGAAATGGAATTGG - Intergenic
1074713989 10:116201629-116201651 GCTTCCTCCTGCACTGGAAGAGG + Intronic
1076114632 10:127886736-127886758 CCCTGCTCCTCAAGTGGAACTGG + Intronic
1077497088 11:2891616-2891638 CCCTCCTCCTGCAGTGGAGGAGG - Intronic
1077633192 11:3824782-3824804 CCATCCCCCTGAAGTGGAAGCGG + Intronic
1078016319 11:7617999-7618021 GCCTCCTGTTGAAGAGGACTTGG + Intronic
1078017498 11:7627478-7627500 GCCTCTTCCTAAATGGGAATAGG - Intronic
1081693132 11:45091965-45091987 CCTTCTTCCTGAAGTGGAAGGGG + Intergenic
1090485667 11:127109974-127109996 GCCTTCTCCTGAAGGGGGAGGGG + Intergenic
1090515868 11:127426009-127426031 GCCTCATCCTGCAGCGGAAGAGG + Intergenic
1091689610 12:2586819-2586841 CCCTCCTCCTGCAAGGGAATAGG + Intronic
1098334774 12:69391809-69391831 GCCAACTCCTCAAGTAGAATGGG - Intergenic
1098507751 12:71274144-71274166 GCCTCCTGGGGAAGTGGAAAAGG - Intronic
1100294046 12:93244264-93244286 GCTTCCTCCTGAAGTGGGAGGGG - Intergenic
1100371488 12:93972863-93972885 GCCTTCTCACAAAGTGGAATGGG + Intergenic
1102170071 12:110835636-110835658 GCCTCCTCCTCAAGGGAAAATGG - Intergenic
1103860446 12:124008335-124008357 GCCTCCTGCTGTGGTGCAATGGG - Intronic
1105614320 13:21998640-21998662 ACCTGCTTCTGAAGAGGAATGGG - Intergenic
1105889575 13:24672876-24672898 GCCAGCTCCTAAAGTGGACTTGG - Intergenic
1106808252 13:33333500-33333522 GCCTCCTTCTAAGGTGCAATTGG - Intronic
1107308804 13:39053565-39053587 CCCTCCTCTAGCAGTGGAATGGG + Intergenic
1111634047 13:90880942-90880964 GCCATTTCTTGAAGTGGAATGGG + Intergenic
1115763101 14:36595300-36595322 GCCACCTCCTGGTGTGGGATAGG - Intergenic
1119776773 14:77253899-77253921 GGCTCGGCCTGAAGGGGAATGGG + Intronic
1124190051 15:27566647-27566669 GCCTCGTCCTGCAGTGGAAGAGG + Intergenic
1129835462 15:78702722-78702744 GGCTCCTCCTCCTGTGGAATGGG - Intronic
1130576533 15:85097614-85097636 CCCACCTGCTGAAGTGGAAGAGG - Intronic
1131079949 15:89526477-89526499 GCTTCCTCCTGAAATGGCAAGGG + Intergenic
1135194940 16:20386566-20386588 GCCTGCTCCTGCAATGGGATCGG + Intronic
1135729388 16:24881763-24881785 GGCACCCCCTGGAGTGGAATAGG - Intronic
1138408212 16:56816088-56816110 GCTTCCTACTGAAGTGAACTTGG + Intronic
1139474575 16:67196588-67196610 GCCCTCTCCAGGAGTGGAATGGG - Intronic
1139678748 16:68543416-68543438 GGCTCCACCTGAAGCGGGATGGG + Intronic
1142282014 16:89153689-89153711 GCCTCCTCTGGAAGGGGAACGGG + Intronic
1144174857 17:12695277-12695299 GCCTCCTCCCGTGGTGGAAGGGG + Intronic
1146789788 17:35744864-35744886 GACTCCTCCTCAGGTGGAAGTGG + Exonic
1147324023 17:39661878-39661900 GTCCCCTCCTGAAGGGGAAGGGG + Intronic
1152211631 17:79005477-79005499 GCTTCCTGCAGGAGTGGAATAGG + Intronic
1154386175 18:13893965-13893987 GCCTCCTCATGAAGAGGTGTTGG - Intronic
1156076187 18:33282255-33282277 GCCTCCTCGAGAAGTGGTAAGGG + Intronic
1156304972 18:35869502-35869524 GCCTCCTGCTGCACTGGACTTGG + Intergenic
1157538211 18:48476870-48476892 TCATCCTCCTGAATTGGAGTGGG - Intergenic
1160099262 18:75904969-75904991 GCCTCTTCCTGCAGTGAAAGGGG - Intergenic
1162573726 19:11486873-11486895 GCCGCCTCCTGGAGGGGAAGGGG + Exonic
1164455025 19:28399720-28399742 GCCTCCTCCTGACCAGGATTTGG + Intergenic
1168257425 19:55174343-55174365 GTCTCTTCCTGGAGTGGAAGAGG + Intronic
925974975 2:9136065-9136087 GCCTCCCCCTGTACTGGGATGGG - Intergenic
926056913 2:9779129-9779151 GCCTCCTCCTGGAGTGGATCAGG + Intergenic
934724351 2:96605744-96605766 CCCTCATCCTGCACTGGAATCGG + Intronic
937285759 2:120750165-120750187 ACCTCCTCCTGGAGTGGGAGGGG - Intronic
1173146044 20:40525151-40525173 GCCTCCTAAGGAAGTGGAGTGGG - Intergenic
1176105013 20:63381815-63381837 GTTTCCTCCTGAACTGGAAACGG - Intergenic
1179408235 21:41142728-41142750 CCCTCCTCCTGAACAGGAGTTGG + Intergenic
1180036466 21:45252791-45252813 GCCTCTTCTTGAGGTGGAAGCGG + Intergenic
1180252296 21:46597540-46597562 GCCTCGGCCGGAAGTTGAATCGG - Intergenic
1184354422 22:43969474-43969496 GTCTCCTCCTGAAGGGGCTTCGG + Intronic
1184521800 22:44998938-44998960 CCCTCATCCTGAAGAGGGATGGG - Intronic
1185164970 22:49255808-49255830 GCCGCCTGCTGAAGAGGAGTGGG + Intergenic
958420705 3:93927098-93927120 ACTTCCTCCTGAAATGGAAGTGG + Intronic
960404200 3:117239102-117239124 GGCTCCTCCTATTGTGGAATGGG + Intergenic
960949146 3:122987718-122987740 GCCTCCTCCTGACAGGGACTGGG + Intronic
963586998 3:147204822-147204844 TTCTCCTCCTCAAGGGGAATTGG + Intergenic
964494262 3:157271483-157271505 TCCTCCGCCTGAAGAGGAAAGGG + Intronic
966299242 3:178460453-178460475 GCCTCTTCATGAAGTGGCATTGG - Intronic
969109037 4:4829763-4829785 TCCTCATCCTCAAGGGGAATGGG + Intergenic
969947080 4:10794608-10794630 ACCTGCTCCTGAAGGAGAATTGG - Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
977976914 4:103276584-103276606 GGCTCTTCCTCAAGGGGAATTGG + Intergenic
979737940 4:124111889-124111911 GCATCCTCCTGAAACTGAATAGG + Intergenic
982440220 4:155426245-155426267 CCATCCTCCTGAAGTGAAAGTGG - Intergenic
982989636 4:162255660-162255682 GCATCTGCCTAAAGTGGAATGGG - Intergenic
983445320 4:167843165-167843187 GCCTCCGCCTGAAGTACAATGGG - Intergenic
985928559 5:3036340-3036362 GCTTCCTCCTGTAGTTGAAAGGG + Intergenic
996812106 5:127527887-127527909 TAAACCTCCTGAAGTGGAATAGG - Intronic
999021316 5:148168654-148168676 GCTTCCTCCAGAAATGGAACAGG - Intergenic
1000319532 5:160123156-160123178 GCCTCCTCCTGGCATGGAATTGG + Intergenic
1004539354 6:16535087-16535109 GGCTCCTCCTGAAGTGAACTAGG + Intronic
1006154914 6:32008769-32008791 GCCACCTCCTTAAGGGGAACGGG - Intergenic
1014143823 6:117973316-117973338 GTCTCATCCTGAAGTGAACTGGG + Intronic
1015771211 6:136770043-136770065 GCCTCTTCCTGCAATGGAAGGGG + Intronic
1015886944 6:137927230-137927252 GGCTCCTGCTGAACTGGAAGCGG + Intergenic
1016091692 6:139986925-139986947 GCCTCCACCAGAAGTTGACTTGG + Intergenic
1018841976 6:167523986-167524008 GCATCCTCCTGAACCGGAAGAGG - Intergenic
1028198576 7:87934767-87934789 TTCTCCTTCTGAAGAGGAATGGG + Intronic
1031274673 7:119704966-119704988 GCCTCCTCCTAAACAGGACTAGG - Intergenic
1033321614 7:140344853-140344875 GTCTCCTCCTGTGTTGGAATTGG - Intronic
1034040931 7:147875782-147875804 CCCTCCTGCTGAAGTAGAAAGGG - Intronic
1035081854 7:156222701-156222723 GCCTCATCCTGAATTGCAGTAGG + Intergenic
1037140085 8:15508765-15508787 GCTTCCTTTTTAAGTGGAATAGG + Intronic
1039661910 8:39477258-39477280 GCAGCATCCTGAGGTGGAATTGG - Intergenic
1048007429 8:130430887-130430909 GGCTGCTCCTTAAGTGGAACAGG - Intronic
1048878600 8:138855761-138855783 GGCTCCTCCAGAAAAGGAATTGG - Intronic
1052474971 9:28947550-28947572 TCTTGCTCCTGAAGTGGAGTAGG - Intergenic
1055053993 9:72006897-72006919 GCTTCCTCATGAGGTGGAGTGGG - Intergenic
1055353137 9:75410539-75410561 GCCCTCTCCTGAAGTTGAAGTGG - Intergenic
1056087315 9:83163132-83163154 TCCTTCTCCTTAGGTGGAATAGG - Intergenic
1056459985 9:86800227-86800249 GCCTCATCGTTAAGTGGAGTTGG + Intergenic
1057811534 9:98260830-98260852 GCCTCCTCACGCAGTGGAACGGG + Intergenic
1059339763 9:113591146-113591168 GCCTGGCCATGAAGTGGAATCGG - Intronic
1060062442 9:120473005-120473027 GACTCCTACTGATGTGGAAATGG + Intronic
1061176149 9:128998602-128998624 TCCTCCTCCGGCAGTGGAAGAGG + Exonic
1062274100 9:135722518-135722540 GCGTCCAGCTGAAATGGAATGGG + Intronic
1187966966 X:24621184-24621206 AGCTCCTCCTGAAGTGGTAGTGG - Intronic
1188988631 X:36790448-36790470 GCTTCCTCCTGCAGAGGAAGGGG - Intergenic
1191576681 X:62714089-62714111 GCCCCCTACTGCAGTGGAATTGG + Intergenic
1191686072 X:63892313-63892335 TCCTGCTGCTGAAGTGGGATGGG - Intergenic
1193961461 X:87930323-87930345 GGCTACTCCTGAAGTGTAAGAGG - Intergenic
1199949695 X:152698401-152698423 GAGTCCCCCTGAAGTGGCATTGG - Intergenic
1199959979 X:152770060-152770082 GAGTCCCCCTGAAGTGGCATTGG + Intergenic
1200707638 Y:6456392-6456414 ACCTCCTCCTCTAGTGGAACCGG - Intergenic
1201026474 Y:9708316-9708338 ACCTCCTCCTCTAGTGGAACCGG + Intergenic
1201951597 Y:19571185-19571207 GCCTTGTCTTGAAGTGGTATTGG + Intergenic
1202148299 Y:21822621-21822643 GCCTCCTCCTCCAGTGGGACCGG + Intergenic