ID: 908512331

View in Genome Browser
Species Human (GRCh38)
Location 1:64859425-64859447
Sequence CTGGTGATGGGCAATGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908512331_908512335 -6 Left 908512331 1:64859425-64859447 CCTCACACATTGCCCATCACCAG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 908512335 1:64859442-64859464 CACCAGAGGTACTTCAGCACAGG No data
908512331_908512339 19 Left 908512331 1:64859425-64859447 CCTCACACATTGCCCATCACCAG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 908512339 1:64859467-64859489 GCCAGTTCTGAGATGCAGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 188
908512331_908512337 15 Left 908512331 1:64859425-64859447 CCTCACACATTGCCCATCACCAG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 908512337 1:64859463-64859485 GGCTGCCAGTTCTGAGATGCAGG 0: 1
1: 0
2: 1
3: 24
4: 210
908512331_908512338 18 Left 908512331 1:64859425-64859447 CCTCACACATTGCCCATCACCAG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 908512338 1:64859466-64859488 TGCCAGTTCTGAGATGCAGGTGG 0: 1
1: 0
2: 3
3: 22
4: 254
908512331_908512341 25 Left 908512331 1:64859425-64859447 CCTCACACATTGCCCATCACCAG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 908512341 1:64859473-64859495 TCTGAGATGCAGGTGGGACAAGG 0: 1
1: 0
2: 3
3: 47
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908512331 Original CRISPR CTGGTGATGGGCAATGTGTG AGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
901200278 1:7463040-7463062 CTGGTGAATGGCACTGTGTGCGG + Intronic
903370339 1:22831209-22831231 ATGGTGATGGGCATTGAGTGAGG + Intronic
904009532 1:27381963-27381985 CTGGTGGAGGGAACTGTGTGGGG - Intronic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
909695638 1:78465412-78465434 CTGGTGAAGAGCAGTGGGTGAGG + Intronic
911933886 1:103941578-103941600 TTTGTGATGGGCAATGAGGGAGG - Intergenic
912156605 1:106928743-106928765 CTGGGGATGGGGAGTGAGTGGGG + Intergenic
912184404 1:107257655-107257677 CTATGGATGGGCACTGTGTGGGG + Intronic
913600355 1:120415729-120415751 CTGGTGATGGGCAACACATGAGG + Intergenic
915597925 1:156905914-156905936 CTCGTGATGGGCAGTGGCTGAGG - Intronic
916548218 1:165827038-165827060 CTAGTGAAGGGCAATTTGAGGGG - Intronic
918752727 1:188292762-188292784 GTGGTGATGGCCACTGGGTGAGG + Intergenic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
921264125 1:213408292-213408314 CTGCTGATGGGCAAGGTTGGTGG + Intergenic
922237764 1:223734608-223734630 CTGGTGAGGGGCAAGGAGAGAGG - Intronic
923074713 1:230600105-230600127 CTGCTGATTGGCTATTTGTGTGG - Intergenic
923292637 1:232561535-232561557 CTAGGGGTGGGCATTGTGTGTGG - Exonic
923946011 1:238888390-238888412 CTTCTGATGGCCAATGTATGAGG - Intergenic
924005734 1:239609149-239609171 CTGGTGATGGGAAATGATGGTGG - Intronic
924683906 1:246267961-246267983 CTGGGAATGGTGAATGTGTGAGG - Intronic
924946608 1:248850843-248850865 CTGGTGAGGGACAGTGGGTGGGG - Intronic
1063419439 10:5899651-5899673 CTGCTGTTGAGCATTGTGTGGGG + Intronic
1065951064 10:30651739-30651761 CTGGTTTTGAGCAATGTCTGTGG + Intergenic
1066393299 10:34996119-34996141 CTGGTGGTGGGGAATGTGGAGGG + Intergenic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1068098714 10:52524610-52524632 CAGGTGTTGGTAAATGTGTGAGG + Intergenic
1071521681 10:86335259-86335281 CAGGTGCTGGGCACTCTGTGGGG + Intronic
1072302382 10:94073762-94073784 TTGGTGATTGGCATTCTGTGTGG - Intronic
1072569789 10:96648521-96648543 CTGGCCATGGGCAGTATGTGTGG - Intronic
1072933977 10:99694160-99694182 CTGCTAATGGGAAATGAGTGGGG - Intronic
1073176787 10:101561696-101561718 GTGGTGATGTGGCATGTGTGTGG - Intergenic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074124056 10:110514269-110514291 CTGGAGAAGGGGATTGTGTGGGG - Intergenic
1074410671 10:113225769-113225791 CTGGAGATGGGAGATGTGTTAGG + Intergenic
1075081110 10:119384492-119384514 CTGATGATGGGCGAGGTGTTAGG + Intronic
1076904037 10:133353460-133353482 CTGGAGCTGGCAAATGTGTGTGG - Intergenic
1077466111 11:2734477-2734499 TTGGTGATGGGCAGAATGTGGGG + Intronic
1078459116 11:11499833-11499855 CAGGTGATGGGTAATGTGGATGG + Intronic
1079076407 11:17387865-17387887 GTGAAGATGAGCAATGTGTGTGG + Exonic
1079487186 11:20947446-20947468 TTGGTGGTGGGCCATGCGTGGGG + Intronic
1079774669 11:24509938-24509960 CAGGTAGTGGGCAATGTGTGAGG + Intronic
1081799650 11:45849028-45849050 CTGGTGCAGGGCAAAGTCTGAGG - Intronic
1081808293 11:45901687-45901709 GTGGTGATGGCCAATGTGTGTGG - Intronic
1082726001 11:56737438-56737460 CTGGTGCTGGGAAATGAATGTGG + Intergenic
1082870813 11:57942828-57942850 TTGGAGATGGGGTATGTGTGGGG + Intergenic
1083281396 11:61629225-61629247 CTGGTGCTGGGCATTGAGCGGGG + Intergenic
1087077816 11:94141990-94142012 CTGGGGTTGGGGAATGTGTCTGG + Intronic
1087701750 11:101443086-101443108 CTGGTGCTGTGCATTGGGTGTGG + Intergenic
1094003011 12:25716501-25716523 GTGGTGATGGGAAAAGTCTGAGG + Intergenic
1094524989 12:31225555-31225577 CCTGGGATGGGCAATGTCTGTGG + Intergenic
1094534152 12:31306109-31306131 CTGCTGATGGGCAATGGTAGTGG - Intronic
1095838975 12:46670930-46670952 TTGGTGATGGGCCAAGTGGGAGG - Intergenic
1096878820 12:54650770-54650792 CAGGTGATGGGGAAGATGTGGGG - Intergenic
1098567537 12:71952844-71952866 CATGTGTTGGGCGATGTGTGAGG - Intronic
1100060088 12:90564980-90565002 CTTGTGATGGGTTCTGTGTGGGG + Intergenic
1102654120 12:114466002-114466024 CTGATGAAGAGCAAGGTGTGTGG - Intergenic
1103489979 12:121309896-121309918 CTGGTGAAGGGCAGTGGGTTTGG - Intronic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104731159 12:131106085-131106107 CTGGTGCTAGGCAGTGTGAGTGG - Intronic
1105206568 13:18230747-18230769 ATGATGATGGGCAGTGTCTGGGG - Intergenic
1105927945 13:25024533-25024555 CTGATAATGGGAAAAGTGTGTGG - Intergenic
1112480082 13:99767154-99767176 CTGGTGATCGGCATAATGTGGGG + Intronic
1112619299 13:101038346-101038368 CTAGTGTTGGCCAATGAGTGTGG - Intergenic
1113361994 13:109640287-109640309 CTGGGGATGGGCTGGGTGTGAGG - Intergenic
1117105763 14:52395666-52395688 CTGATTCTGGGCTATGTGTGGGG + Intergenic
1119232637 14:72993038-72993060 CTGGTGATTGGAAATCTGGGTGG - Intronic
1119563968 14:75613068-75613090 GTGGGCATGGGCAATGAGTGTGG + Intronic
1120906803 14:89627902-89627924 CAGGTGATTGGCAATCTGTGAGG + Intergenic
1121270130 14:92632309-92632331 CTGCTGATGGGGCATCTGTGTGG + Intronic
1122876841 14:104671237-104671259 CACGTGATGAGCAATGTGTGAGG - Intergenic
1123020814 14:105397133-105397155 CTGGTGCTGGGCATGGTGTGGGG - Exonic
1123433279 15:20236236-20236258 CTGGGGCTGGGCAATGGGAGTGG - Intergenic
1127676894 15:61248089-61248111 CTGATTATGGACAATCTGTGAGG - Intergenic
1128547875 15:68579646-68579668 CTGGTGCTGAGCAGTGGGTGTGG + Intronic
1128730436 15:70017104-70017126 CTGGTCATGCACAAGGTGTGGGG - Intergenic
1128778828 15:70344655-70344677 CTGGGGATGGGCAATGGGGAAGG - Intergenic
1129524162 15:76203641-76203663 CGGGCGGTGGGCAATGAGTGTGG - Intronic
1130079367 15:80718653-80718675 ATATTGATGGGCAAAGTGTGGGG - Intronic
1130894889 15:88162332-88162354 CATGTGGTGGGCACTGTGTGGGG - Intronic
1132932466 16:2465925-2465947 CTGGTGCTGGGGCAGGTGTGGGG + Intergenic
1133078942 16:3303245-3303267 CTGGTGATTTTCATTGTGTGAGG - Intronic
1133642583 16:7731987-7732009 TTCGAGATGGGCAATGTCTGTGG - Intergenic
1134255788 16:12610248-12610270 TTGGAGATGGGGAATGTGCGTGG - Intergenic
1135528087 16:23229332-23229354 ATGGTGATGAGCAAAGGGTGGGG - Intergenic
1136267256 16:29129036-29129058 CTGGGGAGGGGCCATCTGTGTGG - Intergenic
1136272384 16:29156068-29156090 CTGCTGATGGGCGCTGTGTGCGG - Intergenic
1136851346 16:33614886-33614908 CTGGGGCTGGGCAATGGGAGTGG + Intergenic
1137772226 16:51025519-51025541 CTGGTGAGGGGTAAGGGGTGGGG + Intergenic
1138510582 16:57506456-57506478 CTGGTGCTGGACCCTGTGTGAGG + Intergenic
1139554335 16:67697057-67697079 GTGGTGATGGGAAATGTATGTGG - Intronic
1139613610 16:68075882-68075904 CTGGTGAGGGGCACTGGGTGTGG - Intronic
1142070549 16:88089359-88089381 CTGGGGAGGGGCCATCTGTGTGG - Intronic
1144298682 17:13902954-13902976 CAGGTGATGGCTAAAGTGTGGGG - Intergenic
1144647234 17:16983460-16983482 TTGGTGATGGGTAAGATGTGGGG - Intergenic
1144788298 17:17843930-17843952 CTGGTGACGGGCACTGGGGGAGG + Intronic
1146052718 17:29566464-29566486 CTGGTGATCCCCAATGCGTGGGG - Exonic
1147579881 17:41622279-41622301 CTGGGGCTGGGCAATGGCTGAGG - Intronic
1148353536 17:46958394-46958416 CTGGGGGTGGGAAACGTGTGTGG + Intronic
1150507245 17:65711895-65711917 TTGGTAATGGGCAAAGTGTCGGG - Intronic
1151344691 17:73494424-73494446 CTGGAGATGGACGATGGGTGTGG - Intronic
1151805200 17:76400712-76400734 CTGGTCCTGGGCATTGGGTGGGG - Intronic
1153779099 18:8478616-8478638 CTTGTGATAGGCAGAGTGTGTGG + Intergenic
1154012444 18:10587486-10587508 CTGTTGATGGGCAAGGCTTGTGG + Intergenic
1155221629 18:23690230-23690252 CTGGTGGAGGGGAAAGTGTGAGG + Intronic
1155339245 18:24797478-24797500 CTGGCCATGGCCACTGTGTGTGG - Intergenic
1157864349 18:51168006-51168028 CTGGTAATAGGCACTGTCTGAGG + Intergenic
1160600790 18:80010986-80011008 CTGGAAAGGGGCATTGTGTGGGG + Intronic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1162566616 19:11448356-11448378 CTGGTGATGGGGAATCACTGAGG + Intronic
1162725858 19:12689438-12689460 CTAGTGAGGGGCAATGGGCGAGG + Intronic
1164254771 19:23517928-23517950 CTGGTGAGGGGCATTGGGTCAGG + Intergenic
1164691855 19:30217246-30217268 CTGGTGATGAACCATGTTTGGGG + Intergenic
1166007603 19:39917954-39917976 CTGGTGCTGGGCAATGCCAGGGG - Intronic
1166911668 19:46163466-46163488 CTGGTGATGAGCAGTGGGAGAGG + Intergenic
1168243557 19:55098909-55098931 CTGGTGAGGGGCAGGGCGTGGGG - Intronic
925139870 2:1542852-1542874 CTGGTGATGGGCAGGGGGTGTGG - Intronic
925142411 2:1559252-1559274 CTGGTGAGGGGCCCTGTGTGGGG - Intergenic
925710696 2:6736756-6736778 CTGGAGATGGACAAAGTGTCGGG + Intergenic
929215177 2:39404463-39404485 GTGGTGGTGGCCAATGCGTGAGG + Intronic
933525634 2:83434979-83435001 CTGGTGATCGTGTATGTGTGTGG - Intergenic
933703091 2:85269998-85270020 CGGGAGATGGGAAATGTCTGAGG - Intronic
936349410 2:111701587-111701609 CTGGTGAGGCGCAAAGTGTCAGG - Intergenic
939096249 2:137836794-137836816 CTGGGGGTGGTGAATGTGTGAGG - Intergenic
940565601 2:155356579-155356601 CTGGTGATGGGCAGAGTCTAGGG + Intergenic
940949064 2:159651694-159651716 GTAGTGATGGGTAATGGGTGTGG - Intergenic
941857753 2:170247911-170247933 ATGGTGAGGAGCACTGTGTGGGG + Intronic
942076426 2:172360578-172360600 TTGGTGATGGGCTATGCATGAGG - Intergenic
942417135 2:175771258-175771280 CAGGTGATGGGCAGGGAGTGGGG - Intergenic
943102517 2:183505452-183505474 CTGGTGCTGGGCAGATTGTGGGG + Intergenic
943667831 2:190628655-190628677 CTGGGGATGGGCAGTGTTTGGGG + Intergenic
944110249 2:196124230-196124252 CTGGAGAGGGGAATTGTGTGGGG + Intergenic
946097760 2:217290458-217290480 CAAGTGATTGGCATTGTGTGAGG + Intronic
946355657 2:219182711-219182733 CTGGGGTGGGGCAGTGTGTGGGG + Exonic
947698750 2:232215312-232215334 GTGGGGATGGGAAATGTGAGCGG - Intronic
948251525 2:236533889-236533911 TTGCTGATGGGCTTTGTGTGGGG + Intergenic
948658444 2:239491590-239491612 CTGGTGATGGGCAGAGAGTTTGG + Intergenic
1169050407 20:2572255-2572277 ATGCTGATGGCCAAGGTGTGTGG + Exonic
1170113769 20:12834677-12834699 CTGGAGATGGGAAATCTGTATGG + Intergenic
1171400639 20:24871258-24871280 CTGGTGAGGGAGAATCTGTGGGG - Intergenic
1171767862 20:29300229-29300251 CGGGTGACGGGTAATGTGGGAGG + Intergenic
1173922843 20:46758966-46758988 CTGGAGGTGGGCACTGTGGGAGG - Intergenic
1175036462 20:56005149-56005171 CTGGTGATTGGCAAGGTTCGAGG + Exonic
1176514450 21:7773785-7773807 CTGGTGATGGGGGCTGGGTGTGG + Intergenic
1177728221 21:24995000-24995022 CTGGAGAGGGGTATTGTGTGGGG - Intergenic
1178648563 21:34404309-34404331 CTGGTGATGGGGGCTGGGTGTGG + Intronic
1179111437 21:38449234-38449256 TTGGTGTTTGCCAATGTGTGGGG + Intronic
1179417169 21:41208251-41208273 CTGGTGGAGGCCAAGGTGTGGGG - Intronic
1180759380 22:18187961-18187983 ATGATGATGGGCAGTGTCTGGGG + Intergenic
1180769688 22:18372261-18372283 ATGATGATGGGCAGTGTCTGGGG + Intergenic
1180827628 22:18875217-18875239 ATGATGATGGGCAGTGTCTGGGG + Intergenic
1181072289 22:20352756-20352778 ATGATGATGGGCAGTGTCTGGGG - Intronic
1181195360 22:21181696-21181718 ATGATGATGGGCAGTGTCTGGGG - Intergenic
1181214088 22:21311078-21311100 ATGATGATGGGCAGTGTCTGGGG + Intergenic
1181267112 22:21636820-21636842 CTGGTCCTGGGCAGTGTGGGTGG - Exonic
1181305602 22:21915772-21915794 CTGGGGCTGGGCAGTGAGTGAGG + Intergenic
1181524533 22:23472716-23472738 ATGATGATGGGCAGTGTCTGGGG + Intergenic
1183066398 22:35366433-35366455 CTGACCATGGGCAATGTGGGTGG + Intergenic
1183690615 22:39386106-39386128 ATGGTGATGGGGCATGTATGTGG - Intergenic
1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG + Intronic
1184178264 22:42802022-42802044 CTGGAGGTGGGCATTGGGTGGGG + Intronic
950693575 3:14680518-14680540 CTGATGATGGGTTTTGTGTGGGG + Intronic
954405869 3:50344810-50344832 CTGGTGGTGGGGAAGGGGTGGGG - Intronic
954432642 3:50479362-50479384 GTGCTGATGGGCAATGTGCTAGG - Intronic
957149147 3:76463000-76463022 GCGGTGATGGGCAAAGTGAGTGG - Intronic
960404015 3:117238002-117238024 CTGCTGATGGGGAATGTGGGAGG - Intergenic
961471083 3:127113308-127113330 TTGCTGATGGGCTCTGTGTGTGG + Intergenic
961650976 3:128416482-128416504 CGGGAGATGGGCATGGTGTGGGG - Intergenic
964392591 3:156213095-156213117 CTGGTGATGGGCTGAGTATGGGG + Intronic
964508074 3:157421353-157421375 CTAGGGAGGGGCAATGTGCGGGG - Intronic
966067435 3:175834215-175834237 TTGCTGATGGGAAATGTCTGGGG - Intergenic
966403051 3:179566092-179566114 CTGGTGGTCAGCAATGTGTTAGG + Intronic
966687979 3:182716488-182716510 CTGGAGAGGGGCATTGTGTGGGG + Intergenic
969612406 4:8234760-8234782 CAGGTGCTGGGCACTGTGAGGGG - Intronic
970501258 4:16679652-16679674 CTGGTGATGGGCACTGAGAGTGG + Intronic
971268483 4:25115150-25115172 TTGGTCATGGGCAATCAGTGGGG - Intergenic
971823853 4:31595775-31595797 CTGGAGTTGGGAAATGTTTGTGG + Intergenic
973786859 4:54340527-54340549 CTGGTGATGGGCAAGGGGCATGG + Intergenic
974877897 4:67720268-67720290 CTGGAGATAGGCATTGGGTGTGG + Intergenic
975086848 4:70352061-70352083 CAGATGATGGACAATGTGGGTGG - Intergenic
980794472 4:137663175-137663197 GTGGGGATGGGCAGTGGGTGGGG - Intergenic
980890978 4:138815300-138815322 ATGGTGGGGGGCAGTGTGTGTGG + Intergenic
983915027 4:173282586-173282608 CTGGAGAGGAGCATTGTGTGAGG + Intronic
984016828 4:174436649-174436671 CTGGTGAGGGGTAAAGAGTGAGG + Intergenic
984156570 4:176202272-176202294 GAAGTGATGGGCAATATGTGAGG + Intergenic
986038102 5:3960174-3960196 CAGGTGCTGGGAAATGTGTTTGG + Intergenic
990629412 5:57651481-57651503 CTGGTGCTGGGGAATGTCTGTGG + Intergenic
992615837 5:78545251-78545273 CTCCTGATGGGGAATGTGTTGGG - Intronic
998415329 5:141941836-141941858 TTGGTGCTGGGCATTGGGTGGGG - Exonic
998994379 5:147854512-147854534 CTGGTGAAGGTGAGTGTGTGGGG - Intergenic
999134541 5:149309815-149309837 CTAGCCATGGGCACTGTGTGAGG - Intronic
1000464725 5:161561815-161561837 CTGGTGATGGGCATCTTGAGAGG - Intronic
1003030193 6:2594746-2594768 CTGGGGATGGGCAGTTTCTGAGG - Intergenic
1003079569 6:3010451-3010473 CTGGTGCTGGGTAGTTTGTGGGG - Intronic
1004403581 6:15311197-15311219 CTGGTGATGGGCACTGCTAGGGG - Intronic
1005835584 6:29706324-29706346 CTGGTGTTGGGCTATGGTTGAGG + Intergenic
1007208513 6:40172194-40172216 ATGGTGAATGGCAATGTATGGGG + Intergenic
1007472955 6:42102734-42102756 CTGCTGTTGGGGAATGTGTTTGG - Exonic
1008646363 6:53518965-53518987 CTGGTGATAGGAAAAGTGGGTGG - Intronic
1008973867 6:57401792-57401814 CTGGTGATGAGCACTGGGGGTGG + Intronic
1009162757 6:60303297-60303319 CTGGTGATGAGCACTGGGGGTGG + Intergenic
1012005960 6:93713604-93713626 CTGGTCCTGGGCATTTTGTGGGG + Intergenic
1012437533 6:99230096-99230118 CTTGTGATGGGGCATCTGTGTGG - Intergenic
1012713392 6:102637379-102637401 CTGGTGAAGGGCACTGCGTTAGG + Intergenic
1014074045 6:117216218-117216240 CTGCTGCTGGGCGATGTGGGAGG + Intergenic
1015101794 6:129490367-129490389 GTGGTGATGGAGAATGAGTGTGG - Intronic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1016851590 6:148624757-148624779 GTGGTGATGGGGAATATTTGGGG + Intergenic
1017925345 6:158907299-158907321 CTGATGATAGGCAGTGTTTGTGG - Intronic
1018286027 6:162238774-162238796 GTGGCTCTGGGCAATGTGTGGGG - Intronic
1018328351 6:162699194-162699216 ATGGTGATGAGCAAAGTGTGGGG + Intronic
1018783442 6:167089954-167089976 TTGGCGTTGGGCCATGTGTGTGG + Intergenic
1019102004 6:169639133-169639155 GTGGTGCTGGGTACTGTGTGGGG + Intronic
1023822637 7:43988473-43988495 CTGGGGGTGGGCACTGTGGGAGG + Intergenic
1024525980 7:50349678-50349700 GGGGTGATGGGGAATGGGTGGGG + Intronic
1026658903 7:72281453-72281475 CTGGTGAGGCTCACTGTGTGTGG - Intronic
1028483129 7:91329737-91329759 CTGCTGCTGGGCAAGGGGTGGGG - Intergenic
1028721072 7:94032266-94032288 CAGGATATGGGAAATGTGTGTGG + Intergenic
1028832363 7:95341931-95341953 CTGGTGGTGGGCAGTGGGAGGGG - Intergenic
1029096844 7:98091993-98092015 ATTCTGATGGGCAATGAGTGAGG + Intergenic
1029750900 7:102541888-102541910 CTGGGGGTGGGCACTGTGGGAGG + Intronic
1029768854 7:102640999-102641021 CTGGGGGTGGGCACTGTGGGAGG + Intronic
1032883629 7:136115623-136115645 TTGGCGATGGGCAGGGTGTGGGG + Intergenic
1033005525 7:137557816-137557838 CTGTTGATGGGCATGGTGGGAGG - Intronic
1035480599 7:159179538-159179560 ATGAGGATGGGCAATGTGTCGGG - Intergenic
1037539806 8:19860039-19860061 CTGGTGATTGCCAAGGTATGGGG - Intergenic
1037838925 8:22230532-22230554 CTGGGGAAGGGCAGGGTGTGAGG + Intronic
1039033950 8:33338684-33338706 CTACTGATGGGCAGTGTCTGTGG - Intergenic
1042185845 8:66135449-66135471 CTGATGATGAGCAATGTTAGGGG + Intronic
1042333163 8:67604061-67604083 CTGGTGATGGAGGTTGTGTGGGG + Intronic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1047207758 8:122817334-122817356 CTGGTGCTGGGCACAGTGAGTGG - Intronic
1047260440 8:123253885-123253907 CTGGTGATGGCCACTGTGTCCGG + Exonic
1049301166 8:141871623-141871645 GTGGTGGTGGGCACAGTGTGTGG + Intergenic
1049301218 8:141871823-141871845 GTGGTGGTGGGCACCGTGTGTGG + Intergenic
1049301281 8:141872059-141872081 GTGGTGGTGGGCACAGTGTGTGG + Intergenic
1049301348 8:141872321-141872343 GTGGTGGTGGGCACAGTGTGTGG + Intergenic
1049308242 8:141919518-141919540 CTGGAGATGGTCAGTGTGGGGGG + Intergenic
1057017260 9:91663508-91663530 CTGGAGATGGGAAACGTCTGTGG - Intronic
1058779362 9:108317877-108317899 CTGGGGATCAGCAGTGTGTGTGG + Intergenic
1059401715 9:114074742-114074764 CTGGGCATGGGCACTGGGTGGGG + Intronic
1060074531 9:120579800-120579822 CTGGCCAGGGGCAGTGTGTGGGG - Intronic
1060179179 9:121520662-121520684 CTGGAGAGGGGGATTGTGTGGGG + Intergenic
1060877259 9:127092324-127092346 CTGGAGATGAGCTGTGTGTGAGG + Intronic
1188508860 X:30912220-30912242 CAGGAAATGGGCAATGTGTCAGG - Intronic
1193347794 X:80424108-80424130 CTGGAGATGGGTGTTGTGTGGGG + Intronic
1196050634 X:111299894-111299916 CTGCTGATGTGCACTGTGTAGGG - Exonic
1196267904 X:113674442-113674464 GTGCTGAAGGACAATGTGTGGGG + Intergenic
1197304929 X:124830145-124830167 TTTGTGGTGGGAAATGTGTGGGG + Intronic
1197384101 X:125782363-125782385 CTGGAGAGGGGCATTGTGTGGGG + Intergenic
1198265559 X:135005599-135005621 ATGGAGAGGGGCAATGTCTGGGG - Intergenic
1199789374 X:151137729-151137751 CTGGTGATTGGCTGTCTGTGTGG - Intergenic
1201324792 Y:12744573-12744595 CTGGAGACAGGCATTGTGTGGGG + Intronic
1201337735 Y:12898345-12898367 CTGGAGAGGGGCATTGTGTGGGG - Intergenic