ID: 908513472

View in Genome Browser
Species Human (GRCh38)
Location 1:64869311-64869333
Sequence CTGATGTCCTTGGGCAGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908513463_908513472 21 Left 908513463 1:64869267-64869289 CCACCATCCTCACAATCAATTCT 0: 1
1: 0
2: 5
3: 27
4: 332
Right 908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 161
908513464_908513472 18 Left 908513464 1:64869270-64869292 CCATCCTCACAATCAATTCTTCA 0: 1
1: 0
2: 1
3: 34
4: 344
Right 908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 161
908513468_908513472 -6 Left 908513468 1:64869294-64869316 CCAGTGGGAAGCTTTACCTGATG 0: 1
1: 0
2: 1
3: 14
4: 151
Right 908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 161
908513465_908513472 14 Left 908513465 1:64869274-64869296 CCTCACAATCAATTCTTCAGCCA 0: 1
1: 0
2: 1
3: 29
4: 254
Right 908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908513472 Original CRISPR CTGATGTCCTTGGGCAGTTC TGG Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901895233 1:12306275-12306297 CTCATAACCTTGGGCAGGTCAGG - Intronic
902690876 1:18109550-18109572 CCGAAGTCCTTGGGGAGTGCTGG + Intronic
903800321 1:25962466-25962488 CTAATGACCTTGGGCAACTCAGG - Intronic
904100635 1:28023728-28023750 ATGATGTCCTTGTTCTGTTCCGG - Intronic
905086349 1:35381779-35381801 TTGATGTCTTTGTTCAGTTCAGG + Intronic
905654060 1:39674759-39674781 CTCATGTAATTGGGAAGTTCAGG - Intergenic
906208250 1:43998259-43998281 CTACTGTGCTTGGCCAGTTCAGG - Intronic
907788316 1:57635803-57635825 CTGGTGTCCTTGGCCAGGTGCGG + Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
910055892 1:83032564-83032586 CCCATGACCTTGGGCAGCTCTGG - Intergenic
923013379 1:230106750-230106772 CTGGTGAGCTTGGGCAGTGCTGG + Intronic
924113715 1:240725495-240725517 CAGCTGTCCTTGGTCATTTCTGG + Intergenic
1063374955 10:5548722-5548744 CTGATGTCGTTAGTCAGTCCTGG + Intergenic
1065171201 10:23031621-23031643 CTGATGTCCTTGAGAAGTGATGG + Intronic
1065474501 10:26119332-26119354 CTGGTTTCCTTGGGGTGTTCAGG - Intronic
1071969510 10:90888719-90888741 CTGATTCCATTGGGAAGTTCAGG + Intronic
1075398378 10:122143681-122143703 CTGAGGTCCTTGGCCGGATCTGG - Exonic
1077780907 11:5328672-5328694 CTGATGTCCTCGGGATTTTCAGG + Intronic
1079399947 11:20098802-20098824 CTCATGGCCTTGGGCAATCCAGG + Intronic
1084608801 11:70187780-70187802 CTGATGTCCTTGGGGATGTCCGG - Exonic
1092062574 12:5563504-5563526 CTGATGTCCGTGGGGATGTCTGG + Exonic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1098102669 12:67035072-67035094 CTGATTTCCTTGGAAAGTTTAGG + Intergenic
1102442604 12:112975094-112975116 CGGAAGTCCTTTGGGAGTTCAGG + Intergenic
1104399339 12:128462864-128462886 CTGCTGTTATTGGGGAGTTCTGG - Intronic
1110664920 13:78105888-78105910 CTGATGTCTTGTGACAGTTCTGG - Intergenic
1113846075 13:113392530-113392552 TGGAGGTCCCTGGGCAGTTCAGG - Intergenic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1120575380 14:86174912-86174934 CTCATGTTCTTGGGCAGCTCTGG - Intergenic
1122051763 14:99065660-99065682 CTGATCTCCTGGGGGAGCTCTGG - Intergenic
1123568968 15:21582565-21582587 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1123605077 15:22017886-22017908 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1124805489 15:32877689-32877711 CTGATGGCCTTGAGCAGTAGTGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126855168 15:52831812-52831834 CTGATGTCTTTTCCCAGTTCTGG + Intergenic
1129174495 15:73830266-73830288 AGGAGGTCCTTGGGGAGTTCAGG + Intergenic
1131074692 15:89487534-89487556 CTGATGTGCTTGGCCTGTCCAGG - Intronic
1132219914 15:100097573-100097595 CTGATGTCTTTGGGGAGTTGTGG - Intronic
1202977322 15_KI270727v1_random:309655-309677 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1133298432 16:4767025-4767047 CTGCCGGCCGTGGGCAGTTCGGG + Exonic
1134040088 16:11061778-11061800 CTGATGTCACTGGGAAGTCCAGG + Intronic
1138245869 16:55466983-55467005 GTGGGGTCCTTGGGCAGTTAGGG - Intronic
1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG + Intergenic
1143203757 17:5129458-5129480 CTTCTGCCCTTGGGCAGTTGTGG + Intronic
1144874939 17:18392569-18392591 CTTCTGCCCTTGGGCAGTTGTGG + Intergenic
1145157285 17:20551852-20551874 CTTCTGCCCTTGGGCAGTTGTGG - Intergenic
1145213527 17:21034312-21034334 GTGATGTCCTTGGACAGGTCAGG + Intronic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1148211595 17:45812013-45812035 TTGATATCCATGGGGAGTTCTGG - Intronic
1148713227 17:49697053-49697075 TTGATGTACTTGGTCAGTTTGGG - Intergenic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1150547234 17:66172349-66172371 CTGATATCCCAGGGCAGTTTAGG - Intronic
1151388318 17:73769040-73769062 TTGATGTCCTGGGGGTGTTCTGG + Intergenic
1152556925 17:81058003-81058025 CTGATGCCCTCAGGCAGCTCTGG + Intronic
1153140889 18:1971368-1971390 ATGATGTTCTCGGGCAGTTGAGG + Intergenic
1160143441 18:76346629-76346651 CTGGGGACCTTGGGCAGTGCAGG - Intergenic
1161485720 19:4534770-4534792 CTAGGGTGCTTGGGCAGTTCTGG - Intronic
1163860440 19:19740023-19740045 CCTCTGTCCTTGGGCAGTTGTGG + Intergenic
1164669278 19:30063571-30063593 CTGATGGCCTTGGGCAGGTTGGG - Intergenic
1165234525 19:34409921-34409943 CTGAGGTCCTGGGCCAGTTCTGG - Intronic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1165828263 19:38717912-38717934 TTGATGTCCTGGGGCAGGGCAGG - Exonic
925990717 2:9252003-9252025 CAGATGTACTTGGGAAGTACTGG + Intronic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
928357728 2:30635387-30635409 CTCATTTCCTTGAGCAGTGCTGG - Intronic
930743302 2:54855958-54855980 CTGATGACCATGAGCAGTTGTGG + Intronic
932131228 2:69189240-69189262 CTGCTGTCATTGGGCTCTTCTGG - Intronic
932174283 2:69585402-69585424 CAGAGGTCCTTGGGGAGTTGGGG - Intronic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932458214 2:71863482-71863504 CTGAGGGCCTTCGGCAGCTCAGG - Intergenic
932504480 2:72215478-72215500 CTGATTTCCTTGGTCATTTGAGG - Intronic
932809810 2:74815453-74815475 TTGGTGTCCCTGGGGAGTTCTGG + Intergenic
933509082 2:83216727-83216749 CTGATGTCCTGATTCAGTTCCGG + Intergenic
934712414 2:96524799-96524821 CTGCTGCCCTCGGGCAGTTAGGG - Intergenic
936386260 2:112032319-112032341 CAGATGTCCTTGGGCAATCGTGG + Intergenic
936574005 2:113638424-113638446 CTGTTGTACTAGGGCAGTTTGGG + Intronic
940649985 2:156432953-156432975 CTGCTGTCCTTTGGTTGTTCTGG + Intergenic
947475449 2:230443776-230443798 CTGGTTTCCTTGGGCCCTTCAGG + Intronic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
948980562 2:241492287-241492309 CTGATGACCCTGGGTAGGTCAGG + Intronic
1170228428 20:14018987-14019009 ATGATCTCATTGGGCTGTTCAGG + Intronic
1171311198 20:24146166-24146188 CTCATTTCCTTGGGAACTTCAGG + Intergenic
1173470381 20:43319074-43319096 CTGATGTCCTTGGCCTCTTCTGG - Intergenic
1173689440 20:44948692-44948714 CTGCTGGCCTGGGGCATTTCAGG - Intronic
1174160975 20:48550251-48550273 CTGATGTTCCAGGGGAGTTCAGG - Intergenic
1175808022 20:61841509-61841531 CTGGTGGCCTTGGGCAGTAGAGG + Intronic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1178252987 21:31022390-31022412 CTCATGCCCTTGAGCATTTCAGG - Intergenic
1179635108 21:42703717-42703739 CTGCTGGCCTTGGGCTGTGCGGG + Intronic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1182003256 22:26938582-26938604 TTGATGTCCTAGGGCTGTGCTGG + Intergenic
1185426168 22:50772469-50772491 CTGTTGTACTAGGGCAGTTTGGG - Intronic
949721768 3:6998335-6998357 GTCATGACCTTGGGCAGCTCTGG + Intronic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
950936919 3:16848390-16848412 ATCATCTCATTGGGCAGTTCTGG - Intronic
952839402 3:37631430-37631452 ATGATGTTCTTGGTCACTTCTGG + Intronic
954584978 3:51725676-51725698 TTGGTATCCTTGGGCAGTCCTGG + Intergenic
956594559 3:70951471-70951493 CTGATGTCTTTCGGGAGGTCAGG + Intergenic
957677819 3:83393215-83393237 CTTATGGCCTGGGGCAGTTTTGG + Intergenic
958171712 3:89947407-89947429 CTTATGGCCTGGGGCAGTTTTGG + Intergenic
960138190 3:114126453-114126475 CTGAGGTCCTCTGGCAGTCCAGG + Intergenic
960288229 3:115853709-115853731 TTGAAGTCCTTGGGCCTTTCTGG - Intronic
961790267 3:129371065-129371087 CTGGTGTCCCTGGGCAGCTTCGG + Intergenic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
964968179 3:162525129-162525151 CAGATGGCCTTGGCCACTTCTGG + Intergenic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
968490971 4:890314-890336 CTGGTGTCTTGGTGCAGTTCAGG - Intronic
971171688 4:24240253-24240275 CAGAAGTCCTTAGGAAGTTCTGG + Intergenic
974596059 4:64015744-64015766 CTGATGACATTGGGAAGTTTGGG - Intergenic
976247698 4:83020194-83020216 CTGATGTACTTGGGCTGCTAGGG + Intergenic
976271612 4:83236119-83236141 CTGATGACCTTTTGCATTTCTGG - Intergenic
976838561 4:89404424-89404446 CTTATATCCTTGGAGAGTTCAGG - Intergenic
982417845 4:155157707-155157729 CACATGGCCTTGGGCAGCTCTGG - Intergenic
990005340 5:50938712-50938734 CTTATGGCCTGGGGCAGGTCTGG + Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
990466847 5:56078875-56078897 CTGATTTCCTGGGGCACCTCAGG - Intergenic
992825981 5:80550665-80550687 CTGTTGCCCTTTGTCAGTTCAGG + Intergenic
993555635 5:89333073-89333095 CTGATTTCCTTGCCCATTTCAGG - Intergenic
994464744 5:100112165-100112187 CTCATGACCTTTGGCAGCTCTGG + Intergenic
994558551 5:101336036-101336058 ATGATGTCCTTTGGAAGTTCTGG + Intergenic
997371158 5:133361470-133361492 CTGAGATCCTTGGGCAGATAAGG - Intronic
998723050 5:144975856-144975878 CTCATGGTCTTGGGCAGCTCTGG - Intergenic
999101340 5:149028362-149028384 CTTAGGTCCATGAGCAGTTCCGG + Exonic
999267865 5:150278646-150278668 CGGATGGCCATGGGCAGTCCTGG + Intronic
1001014240 5:168126242-168126264 CTCTTGTGCTTGGTCAGTTCAGG + Intronic
1004880357 6:20001547-20001569 CAGATGTGCTTGGGCATGTCTGG - Intergenic
1005281977 6:24284087-24284109 ATGATGTCCTGGGACTGTTCTGG - Intronic
1006660452 6:35638122-35638144 CTAATGTATTTGGTCAGTTCTGG + Intronic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1022638998 7:32163739-32163761 CTGACCTCCTTGGGCAGTGGTGG - Intronic
1023737170 7:43245482-43245504 CTAGTGTCCTTGGGAAGTTAGGG + Intronic
1028623283 7:92847744-92847766 GTGATGTGCTTGGTGAGTTCAGG - Intergenic
1030156663 7:106462141-106462163 CTGATGTCCTTTGCAATTTCTGG - Intergenic
1032541267 7:132705047-132705069 CTGATGGCTTTGGGCAGTGTTGG + Intronic
1034967254 7:155399030-155399052 CTGGTGTCTTTGGACGGTTCAGG - Intergenic
1036216650 8:6885065-6885087 CTGATGGCTTGGGTCAGTTCTGG - Intergenic
1039388920 8:37161439-37161461 TTGGTGGCCTTGGACAGTTCAGG - Intergenic
1039562052 8:38520412-38520434 CTGATGTCCCTGAGGAGCTCAGG - Intronic
1040553132 8:48454182-48454204 CTAATGTTCTTGGGCTGGTCAGG + Intergenic
1041284454 8:56245838-56245860 TTGGTATCTTTGGGCAGTTCTGG + Intergenic
1045285407 8:100786530-100786552 CTGATGTCTTTGATCAGTTCTGG - Intergenic
1045488365 8:102651809-102651831 CTGCTTTCATTGGGCAGGTCTGG + Exonic
1048480705 8:134789794-134789816 CTGATGTCTTTGGTCAACTCTGG + Intergenic
1048505057 8:135013493-135013515 CCCATGGTCTTGGGCAGTTCTGG - Intergenic
1049028405 8:140013617-140013639 GTGATGTCCTTCGGGAGTGCTGG + Intronic
1049449991 8:142655419-142655441 CTGCTTTCCCTGGGCAGTCCTGG - Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1051500808 9:17775829-17775851 CTGATGCACTTGGGCAGAACAGG - Intronic
1052385004 9:27812203-27812225 CTGATTTCCTTGAGCAGTAGTGG - Intergenic
1054955217 9:70902021-70902043 CTGATGTTCTTTGGTAGTTGGGG + Intronic
1055174054 9:73296199-73296221 CTCAAGTCCTTGAGAAGTTCTGG - Intergenic
1055266178 9:74498164-74498186 TTGATGTCTTTCGGGAGTTCTGG + Intronic
1057457415 9:95227171-95227193 ATGATCTACTTGGTCAGTTCGGG + Intronic
1057872202 9:98726748-98726770 CTGATTTCCATGGTCAGATCTGG - Intergenic
1061933828 9:133846636-133846658 CTGATGGCCATGGGGAGGTCTGG - Intronic
1061965142 9:134009435-134009457 CTGATATCCTTGAGCAAGTCAGG + Intergenic
1186518539 X:10185740-10185762 CTGATGTATCTGGGCAATTCAGG + Intronic
1187686185 X:21817932-21817954 CTCATGTCCTGGTGCTGTTCTGG + Intergenic
1187714072 X:22084461-22084483 CTTGTGTCCTTGTGCAGTTTTGG + Intronic
1196310687 X:114162017-114162039 ATGATGTGCTTGGGCACTGCAGG + Intergenic
1199496921 X:148462567-148462589 CTGATGTCATTGGGCCATTAGGG - Intergenic