ID: 908513896

View in Genome Browser
Species Human (GRCh38)
Location 1:64873060-64873082
Sequence CCTTATGTGCAGAGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908513896_908513902 9 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513902 1:64873092-64873114 CGGATGAAAAATAAAATGGTAGG No data
908513896_908513907 23 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513907 1:64873106-64873128 AATGGTAGGAGGTGGGGAAAAGG No data
908513896_908513908 28 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513908 1:64873111-64873133 TAGGAGGTGGGGAAAAGGAAAGG 0: 1
1: 0
2: 9
3: 110
4: 951
908513896_908513901 5 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513901 1:64873088-64873110 AATACGGATGAAAAATAAAATGG 0: 1
1: 0
2: 2
3: 59
4: 746
908513896_908513904 15 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513904 1:64873098-64873120 AAAAATAAAATGGTAGGAGGTGG 0: 1
1: 0
2: 5
3: 132
4: 1423
908513896_908513906 17 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513906 1:64873100-64873122 AAATAAAATGGTAGGAGGTGGGG 0: 1
1: 1
2: 5
3: 48
4: 584
908513896_908513903 12 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513903 1:64873095-64873117 ATGAAAAATAAAATGGTAGGAGG No data
908513896_908513905 16 Left 908513896 1:64873060-64873082 CCCTCTGACCTCTGCACATAAGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 908513905 1:64873099-64873121 AAAATAAAATGGTAGGAGGTGGG 0: 1
1: 0
2: 6
3: 73
4: 771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908513896 Original CRISPR CCTTATGTGCAGAGGTCAGA GGG (reversed) Intronic
900765790 1:4504365-4504387 CCATTGGTGCAGAGATCAGATGG + Intergenic
901034975 1:6331047-6331069 CCTAAGGAGCAGGGGTCAGATGG - Intronic
901314547 1:8297270-8297292 CCTTGAGTTCAGAGGTCAGGTGG + Intergenic
904363936 1:29998795-29998817 CATTCTGTGCAGAGGCCACAGGG + Intergenic
905488568 1:38325670-38325692 CCTCAAATGCACAGGTCAGAGGG - Intergenic
907731160 1:57067346-57067368 CTTTATTTACAGAGGTCAGAGGG + Intronic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
912056098 1:105599711-105599733 CCTTTTGGGCAAAGGACAGACGG - Intergenic
914742501 1:150477046-150477068 CATTAAGTGCAGAAGTCAAAGGG - Intergenic
915148124 1:153807609-153807631 GCTTAGGTGCTGAGGTCACAGGG - Exonic
917360879 1:174174701-174174723 CCTGAAGTTCTGAGGTCAGAGGG + Intronic
917494066 1:175524204-175524226 CCTTGTGTTCAGAGTCCAGATGG + Intronic
917966364 1:180181474-180181496 CAGTATGTGCAGTAGTCAGAGGG - Intronic
919312097 1:195924236-195924258 CCTTATGTGATGAGGTAAAAAGG - Intergenic
919694895 1:200564318-200564340 CCTGCTGTGCTGAGCTCAGATGG + Intronic
919858749 1:201724393-201724415 CCTGATGGGAGGAGGTCAGAGGG + Intronic
920584941 1:207149433-207149455 CCTAGTGTTCTGAGGTCAGATGG - Intergenic
921178865 1:212616004-212616026 ACTTTTGAGCAGAGGTCAAAAGG + Intronic
921892053 1:220363595-220363617 GCTTATGTGCCGTGGGCAGACGG + Intergenic
921892500 1:220367249-220367271 CCTTTTAAGAAGAGGTCAGAAGG - Intergenic
922812740 1:228426875-228426897 ATGTATGTGCAGAGGTCACAGGG - Intergenic
922812958 1:228428247-228428269 CCCTGTGTGCAGAGGTCACAGGG + Intergenic
923087831 1:230714504-230714526 CCGGAGGTGCAGAGGGCAGAGGG + Intergenic
923180372 1:231512290-231512312 CTTCATTTGCAGAGGTCACATGG + Intergenic
923923275 1:238593781-238593803 CCTTATTGGCTGTGGTCAGAAGG + Intergenic
924904001 1:248432931-248432953 CCTTCTGCCCAGAGGTCTGACGG - Intergenic
924923871 1:248659067-248659089 CCTTCTGCCCAGAGGTCTGACGG + Intergenic
1063432711 10:6005129-6005151 TGTTGTGTGCAGAGGTCACATGG + Intergenic
1063600920 10:7480571-7480593 CCTGATGGGCAGTGTTCAGACGG + Intergenic
1063773476 10:9231707-9231729 CCTTATTTGCAAAGTACAGAAGG + Intergenic
1064722574 10:18244934-18244956 CAACAGGTGCAGAGGTCAGAAGG + Intronic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1065662490 10:28020212-28020234 TGTTTTGTGCAGAGGCCAGATGG + Intergenic
1068628019 10:59270395-59270417 CATTATTTGCATAAGTCAGAGGG + Intronic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1072016538 10:91352656-91352678 CCCTATTTGCAGAGGCCAGGAGG - Intergenic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1076104038 10:127805921-127805943 CCTTATATGCTGAGCTCATAAGG - Intergenic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1078845231 11:15114276-15114298 TCTTATGTGCCGAAGTTAGAAGG + Intronic
1079999276 11:27328997-27329019 CCTTATGCGCAGAAGTCAGAGGG - Intergenic
1081024164 11:37988074-37988096 CAGCATGTGCAGAGATCAGATGG - Intergenic
1083649675 11:64194604-64194626 ACTTACGTGCCCAGGTCAGAAGG - Exonic
1085703328 11:78764225-78764247 CCTTATTTGTAAAGGTGAGAAGG - Intronic
1085719423 11:78899770-78899792 CAGTATGTGCAGAGATCACATGG - Intronic
1090433638 11:126667827-126667849 CCTTTTGTGCAGCTTTCAGAGGG - Intronic
1092290480 12:7157160-7157182 CCCTATTCGCAGAGGACAGAGGG - Intronic
1092475796 12:8818096-8818118 CCTCATGAGCAGAGACCAGATGG - Intergenic
1097710724 12:62914244-62914266 CAGCATGTGCAGAGGTCACATGG - Intronic
1100914108 12:99398849-99398871 CATTATGTCCAGAGAACAGACGG - Intronic
1101693800 12:107105864-107105886 CCATCTGTGCAGAGGCCAGTAGG - Intergenic
1103181089 12:118912268-118912290 CCATATGTGCAAAGGCCAGGAGG - Intergenic
1103502880 12:121418039-121418061 CTTTAAGTGCAGAGTTCAGCTGG - Intronic
1104063961 12:125291135-125291157 CTTTATGAGAAGAGGTTAGAAGG + Intronic
1104081483 12:125434185-125434207 CCGTGGCTGCAGAGGTCAGAGGG - Intronic
1105433864 13:20360820-20360842 CCTTATGTTCAGGAGGCAGATGG + Intergenic
1106097493 13:26660930-26660952 CTGTGTGTGCAGAGGTCACATGG + Intronic
1106213736 13:27675173-27675195 CCACATGTGCAGAGATCACATGG - Intergenic
1106305163 13:28503315-28503337 CCTTCTGTGAAGAGGCCAGAAGG - Intergenic
1107189289 13:37560273-37560295 CCTTCTGCCCAGAGGTCTGACGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108226270 13:48293023-48293045 CATTTTTTGCAGGGGTCAGACGG + Intergenic
1108521879 13:51253409-51253431 CCTTATCTGCACAGTTCAAAAGG - Intronic
1109433414 13:62267009-62267031 CCTTATCTGCAGAGGCCAAGTGG - Intergenic
1109819949 13:67639527-67639549 TGTTATGTGCAGAGATCACATGG - Intergenic
1110866161 13:80398690-80398712 CCTTCTGCCCAGAGGTCTGACGG - Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1112586634 13:100724119-100724141 CCACATGTGCAGAGATCACAGGG - Intergenic
1114273751 14:21122648-21122670 CCTTATGCTTAGAGGTCATATGG - Intergenic
1115226404 14:31107198-31107220 TATTATGTGCAGAGGTCATGTGG - Exonic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1120733705 14:88030323-88030345 CAGTATGTGCAGAGATCACATGG - Intergenic
1122005653 14:98701473-98701495 CATCAGGTGCAGAGCTCAGAGGG - Intergenic
1122349858 14:101082836-101082858 ACTTATGAGCAGAGGACAGAGGG + Intergenic
1124705710 15:31962206-31962228 CTGTATGTGCAGAGATCACATGG - Intergenic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1126605216 15:50469527-50469549 CCTGATGTACACAGATCAGAAGG - Intronic
1126931777 15:53661338-53661360 CCATGTGTGCAGAGATCACATGG + Intronic
1128564273 15:68689819-68689841 ATAAATGTGCAGAGGTCAGAAGG + Intronic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1129445164 15:75612001-75612023 AGTTATGAGAAGAGGTCAGAGGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135032034 16:19046148-19046170 CCTTTTGTGCTGATGGCAGAAGG - Intronic
1136492940 16:30622348-30622370 CCTTCTGCCCAGAGGTCTGATGG + Intronic
1136991325 16:35152926-35152948 CCTTCTGTGCTGTAGTCAGAGGG - Intergenic
1138938886 16:61765113-61765135 CCTTATTGGCAAAGGTCAGAAGG - Intronic
1140724994 16:77803854-77803876 CCCTCTGTGGAGAGGTGAGATGG + Intronic
1142338433 16:89505620-89505642 CCTGACGTGCAGAGTTCAGAGGG + Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1148954789 17:51344752-51344774 CCTGCTGTGCAGGGATCAGAGGG + Intergenic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1151367499 17:73626868-73626890 CCTGCTGTGCTGAGGACAGAGGG + Intronic
1151508690 17:74545104-74545126 CCCTCTGTGCAGAGGTGGGAAGG + Intronic
1153216432 18:2825132-2825154 CAACATGTGCAGAGGTCACAAGG + Intergenic
1153694772 18:7629235-7629257 CCTTCTGTGGACAGGTTAGATGG - Intronic
1155408121 18:25512643-25512665 CCTTGTGTCCAGGGGTCAGTAGG + Intergenic
1155626616 18:27842582-27842604 CCTTTATTGCAGAGGTAAGATGG - Intergenic
1156982900 18:43312976-43312998 CCTCTTGTGGAGAGCTCAGATGG - Intergenic
1157423439 18:47564921-47564943 CCTGATGGGCAGAGGACAGAGGG + Intergenic
1158033472 18:52995726-52995748 CCTTATGTTCAGATGTTAGCTGG - Intronic
1159131888 18:64288979-64289001 CAGCATGTGCAGAGGTCACATGG + Intergenic
1161727173 19:5936249-5936271 CCTGATGCACAGAGGACAGAGGG + Intronic
1162546453 19:11333599-11333621 CCCTATGTGCAAAATTCAGAAGG - Intronic
1164044448 19:21523912-21523934 CCTTATGTGCAGATCCTAGATGG - Intronic
1164469188 19:28514244-28514266 GCTTATGTGGAGGGGTCACATGG - Intergenic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1168136401 19:54355237-54355259 CCTCAGGTGCAGAGGCCAGGTGG + Exonic
1168679931 19:58307565-58307587 CCTTCTGCCCAGAGGTCTGATGG - Intronic
925043637 2:753592-753614 GCTTTTGTGCAGAGTTCACATGG + Intergenic
925351103 2:3201170-3201192 CCGTATGTGCACAGGGCAGGAGG + Intronic
928736920 2:34301733-34301755 CCAGATGTGCAGAGATCACATGG - Intergenic
928977652 2:37105463-37105485 CCGGATGTGCAGAGATCATATGG - Exonic
929245996 2:39704258-39704280 CCTTCTGTCCAGATGTGAGAGGG - Intronic
931179181 2:59882789-59882811 CCTGAAGTGCAGATTTCAGATGG - Intergenic
933986080 2:87593403-87593425 CAGAATTTGCAGAGGTCAGAGGG + Intergenic
936307757 2:111357400-111357422 CAGAATTTGCAGAGGTCAGAGGG - Intergenic
936694208 2:114927876-114927898 CAGTATGTGCAGAGATCACAAGG + Intronic
936796034 2:116204767-116204789 CAGTCTGTGCAGAGCTCAGAAGG - Intergenic
938105966 2:128530104-128530126 CGTTCTGTGCTGAGGTGAGAAGG + Intergenic
938759419 2:134410801-134410823 CCTGATTTTCAGAGGTCAGGAGG + Intronic
939473108 2:142650526-142650548 CATTATTTCCAGAGGTGAGAAGG + Intergenic
939864918 2:147461890-147461912 TTTAATGTGCAAAGGTCAGATGG - Intergenic
942639086 2:178041558-178041580 CCTTATTTGCAGAAGTCACGTGG - Intronic
943939246 2:193970141-193970163 CATTCTGTGCAGAGATCACAGGG + Intergenic
944426336 2:199587186-199587208 TTTTATGTGTAGAGGTCTGAAGG + Intergenic
1169744861 20:8933392-8933414 AGATATGTGCAGAGGTCACAAGG + Intronic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174235468 20:49086974-49086996 CATGATGTGCAGAGTTCAGGAGG + Intronic
1174582864 20:51584965-51584987 ACTTATCTCCAAAGGTCAGAGGG + Intergenic
1174897678 20:54468221-54468243 CCTCATGTGCTGAGGACACAGGG + Intergenic
1178631605 21:34265816-34265838 CCTGTTGTGCAGAGATCACATGG - Intergenic
1180115779 21:45704076-45704098 GCTGATGTCAAGAGGTCAGAAGG + Intronic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181729451 22:24834009-24834031 CCTTTTGTGGAGAGAACAGATGG + Intronic
1181918668 22:26301777-26301799 GCTAAGGTTCAGAGGTCAGAAGG + Intronic
1183309898 22:37103681-37103703 CCCTATGGTCAGAGGACAGACGG + Intronic
1184334338 22:43844612-43844634 CCAGGTGTGCAGAGCTCAGAGGG - Intronic
949931620 3:9082997-9083019 CCTTCTGTGCAGAGCTCACTGGG + Intronic
950933437 3:16813915-16813937 CCTTATGTGGGAAGGTCACATGG - Intronic
955104328 3:55882234-55882256 CTGTATGTGCAGAGATCACATGG - Intronic
955639185 3:61063900-61063922 GCTTATGTGTGGAGGTCAGAGGG - Intronic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
959228949 3:103621849-103621871 CAGTATGTGCAGAGATCACATGG + Intergenic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
962183391 3:133232380-133232402 CAATATGTGCAGAGATCACATGG - Intronic
962192708 3:133328202-133328224 CCTAATGTCATGAGGTCAGAAGG + Intronic
963141922 3:141953354-141953376 TCTTTTGTGCTGAGGGCAGAAGG - Intronic
963406324 3:144868259-144868281 CATTATGTGCAGAGATTACATGG - Intergenic
964608540 3:158585327-158585349 CAGTATGTGCAGAGATCACATGG - Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
966689973 3:182731988-182732010 CGGTATATGCAGAGGTCACATGG - Intergenic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
969146348 4:5127351-5127373 TCTTGAGTGCAGAGGGCAGAGGG + Intronic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
975181942 4:71355976-71355998 CATTCTGTGCAGAGGACAAAAGG + Intronic
975937743 4:79601691-79601713 CAATATGTGCAGAGATCACATGG - Intergenic
976412750 4:84735381-84735403 CCTTAGCTGCAGAGGGCCGACGG + Intronic
976431692 4:84969078-84969100 CCCTTTGTGCAGAGGCCAGATGG + Intergenic
978624340 4:110667322-110667344 CCTTTTGTTCAAAGGTCAGTTGG + Intergenic
982645871 4:158025254-158025276 CCTAATGTGAAGAGGTCACATGG - Intergenic
983763792 4:171450644-171450666 CATTATGTGCAGAAATCACAAGG - Intergenic
986350038 5:6868716-6868738 CCGTGGGTGCAGGGGTCAGATGG + Intergenic
987251108 5:16102447-16102469 TCTTATGGGCACAGGACAGAGGG - Intronic
988638487 5:33014936-33014958 CCTAATCTGCAGAGTCCAGATGG + Intergenic
990751626 5:59022664-59022686 CCTTCTGTGCACATGTTAGAGGG + Intronic
992848040 5:80774186-80774208 CCTTATTTGCAGAGCACAGTTGG + Intronic
995622542 5:114042285-114042307 CCTTCTGACCATAGGTCAGAAGG - Intergenic
998812927 5:145984651-145984673 CCTTATGTCCAGTGGACAAATGG + Intronic
999280209 5:150360311-150360333 CCTTTGGAGCAGAGGCCAGAGGG - Intronic
999469916 5:151844938-151844960 CATCATGTGCAGAGATCACATGG + Intronic
999497945 5:152118548-152118570 CCTTATGAGAAAAGGGCAGAGGG + Intergenic
1001681838 5:173563627-173563649 CCTTAAGTGCATTGGCCAGATGG - Intergenic
1003186793 6:3839196-3839218 TGGTATGTGCAGAGGTCACATGG + Intergenic
1003304010 6:4910067-4910089 CCGTCTGTGCTGAGGCCAGAAGG - Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1010303357 6:74287257-74287279 CCTTCTGAACAGTGGTCAGAAGG + Intergenic
1010398615 6:75422398-75422420 CCTTTTCTTCAGAGGCCAGATGG - Intronic
1010882309 6:81193172-81193194 CCTTATGAGAATGGGTCAGAGGG - Intergenic
1012305167 6:97647033-97647055 CCGTGTGTGCAGAGATCACATGG + Intergenic
1017468408 6:154716515-154716537 CCTCATGTGCAGAGATCACATGG + Intergenic
1018417654 6:163615042-163615064 CAGTATGTGCAGAGATCACACGG - Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019191803 6:170255714-170255736 CCTTCTCTGCAGTGGTCACAGGG + Intergenic
1019451253 7:1099736-1099758 ACATCTGTGCACAGGTCAGACGG - Intronic
1020664932 7:11028764-11028786 CCTTTTGAGCACAGGTCACATGG - Exonic
1022859625 7:34354224-34354246 TCTCATATGCAGAGGCCAGATGG - Intergenic
1025025429 7:55512778-55512800 CCCTCTGTGCAGAAGTCAGCTGG - Intronic
1026219328 7:68378953-68378975 GCTTATGTGAAGAGTTCACATGG - Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1030718921 7:112846051-112846073 CTTTAAGGGCAGAGGTCAGGAGG + Intronic
1031875482 7:127134843-127134865 ACTTATGTTCAGAGCTCAGGAGG - Intronic
1032594722 7:133228124-133228146 CCGTGTGTGCAGAGATCAGATGG + Intergenic
1033537884 7:142328802-142328824 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1033551401 7:142451464-142451486 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033553666 7:142470029-142470051 CTTTATGTGCAGAGAGGAGATGG - Intergenic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1034726449 7:153340588-153340610 CCCTGTGTGCAGAGGTCACATGG + Intergenic
1034819472 7:154203447-154203469 GCTTCTGAGCAGAGGTCAGGAGG - Intronic
1036062355 8:5337726-5337748 CCTTATTTGCCGAAATCAGATGG + Intergenic
1036406872 8:8462874-8462896 TCTTAAGTCCAGAGGGCAGAAGG + Intergenic
1037038149 8:14194936-14194958 CCTCACGTGCAGAATTCAGAGGG + Intronic
1038499949 8:28035528-28035550 CACTGTGTGCAGAGGTCACATGG - Intronic
1038922149 8:32096644-32096666 CCGTATGTGCAGAGATTACATGG + Intronic
1040737801 8:50531757-50531779 TCTTAGGAGCAGAGGTGAGATGG - Intronic
1041324102 8:56647008-56647030 GCTTCAGAGCAGAGGTCAGATGG - Intergenic
1042649167 8:71021064-71021086 CATTGTGTGCAGAGATCACATGG + Intergenic
1043442103 8:80285288-80285310 CTGTCTGTGCAGATGTCAGAAGG + Intergenic
1043959519 8:86400534-86400556 CCATCTGTGCAGAGTTCTGAGGG + Intronic
1046393089 8:113602486-113602508 CCATATATGCAGAGAGCAGAAGG - Intronic
1048002706 8:130392765-130392787 CAGCATGTGCAGAGATCAGATGG + Intronic
1048379333 8:133850685-133850707 CCTTTTGAGCAGAGATCTGAAGG - Intergenic
1051808019 9:21017879-21017901 CCTTAATTGAAGAGGACAGAGGG + Intronic
1052413849 9:28152333-28152355 CAATGTGTGCAGAGGTCACATGG - Intronic
1055697719 9:78905134-78905156 CCTGAAGTTCAGAAGTCAGAAGG - Intergenic
1056399255 9:86210719-86210741 CAAAATGTGCAGAGGTCAGCAGG - Intergenic
1057304700 9:93905296-93905318 CCTGAGGTCCTGAGGTCAGAGGG + Intergenic
1058979619 9:110157068-110157090 CGTTATGTGCAAAGTTCCGAGGG - Intronic
1061372617 9:130206269-130206291 CCTTCTGTGCAAAGGACAGAGGG - Intronic
1188081855 X:25852862-25852884 CCTTATGTTCAGAAGCCAGCTGG + Intergenic
1189127205 X:38461283-38461305 CATGATGTGCAGAGATCACATGG + Intronic
1189711241 X:43814484-43814506 CTTTATGTGCAGAGCACTGATGG - Intronic
1191887533 X:65904062-65904084 CCTTTGCTGCAGGGGTCAGAGGG + Intergenic
1194465340 X:94228349-94228371 CAGTATGTGCAGAGATCACATGG + Intergenic
1197787962 X:130219184-130219206 CTTTATGTAAAGAAGTCAGAGGG + Intronic
1198873266 X:141197530-141197552 CCTTCTGCCCAGAGGTCTGACGG + Intergenic
1201634953 Y:16112416-16112438 CCTTAGGTGCATAAGGCAGAGGG - Intergenic