ID: 908515350

View in Genome Browser
Species Human (GRCh38)
Location 1:64886733-64886755
Sequence GTGTAGACAAGGTTGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908515350 Original CRISPR GTGTAGACAAGGTTGGGGCG GGG (reversed) Intronic
900154119 1:1197320-1197342 GTGTGGGGAAGGTTGGGGCAGGG - Intronic
901072783 1:6530906-6530928 GTGTAGTCAAAGTTGAGGCTAGG - Intronic
902865253 1:19273731-19273753 GTGTGGACAGGGATGGGGTGGGG + Intergenic
905404329 1:37722960-37722982 GTGTGGACAGAGTAGGGGCGGGG + Intronic
905443981 1:38012916-38012938 GTGGCGACAGGGTTGGGGCAAGG - Intronic
906515840 1:46438392-46438414 GTGGAAACAAGGTAGGGGAGTGG + Intergenic
907574548 1:55514335-55514357 GAGAAGACAAGGTTGGGGAAAGG - Intergenic
908515350 1:64886733-64886755 GTGTAGACAAGGTTGGGGCGGGG - Intronic
913065158 1:115245048-115245070 ATGTAAACATGGTTGGGGGGTGG + Intergenic
915289503 1:154873675-154873697 GTGAAGACATGGTTGTGGCTGGG - Intergenic
915549192 1:156622822-156622844 GTGTTGACAAGGCTGGTGCTGGG - Intronic
915907200 1:159887722-159887744 GTGTGGGCAGGGGTGGGGCGGGG - Intronic
915984184 1:160447039-160447061 GTGTTTACGAGGGTGGGGCGGGG + Intergenic
916183772 1:162111393-162111415 ATGTAGGCGTGGTTGGGGCGAGG + Intronic
917852362 1:179076254-179076276 GTGGTGACAAGGTAGGGGCTAGG + Exonic
918627292 1:186670876-186670898 ATGAAGCCAAGGTTGGGGCAGGG + Intergenic
920032506 1:203045778-203045800 GTGTAGACAGGATGGGGGCAAGG + Intronic
920502743 1:206495802-206495824 GTGTAGCCAAGGTTTAGGAGGGG - Intronic
921019020 1:211219685-211219707 GTGTAAACAAGGTGAGGGCAGGG - Intergenic
921714159 1:218401374-218401396 GTGTGGCCAAGGTTGAGGTGAGG + Intronic
1066436784 10:35403113-35403135 GTGTAGGGAAGGGTGGGGTGGGG + Intronic
1068483973 10:57632520-57632542 GTGTGAAAAAGGTTGGGGAGGGG - Intergenic
1069846863 10:71378082-71378104 GCTTAGACAATGTTGGGGGGGGG + Intergenic
1070650151 10:78229463-78229485 GTGTGGACTAGGATGGGGCTGGG - Intergenic
1075078480 10:119367508-119367530 GGGCAGACAGGGTTGGGGTGTGG + Intronic
1075263052 10:120979555-120979577 GTGTAGAAAGGGTGTGGGCGTGG - Intergenic
1078898730 11:15621814-15621836 GTGGAGACAAGGCTGGGATGAGG - Intergenic
1079398972 11:20090297-20090319 GTGTACACATGGTGGGGGAGGGG + Intronic
1085051420 11:73382120-73382142 GAGGAGACAAGGTTGGGCCCTGG - Intronic
1085390456 11:76179472-76179494 GTGTGGCCAAGGTCGGGGTGAGG - Intergenic
1090349441 11:126098194-126098216 GTGAAGACATGGTAGGGGTGGGG + Intergenic
1090778071 11:129982776-129982798 TTGTAGAGATGGTTGGGGGGAGG - Intronic
1091174913 11:133549055-133549077 GAGCAGACATGGATGGGGCGGGG + Intergenic
1092213341 12:6662856-6662878 GTGTAGACGAGGGAGGGGTGCGG - Intronic
1094709380 12:32946223-32946245 TTGGAGAAAAGGGTGGGGCGTGG + Intergenic
1097263940 12:57735520-57735542 GTGCAGGCAGGGTTGGGGGGGGG - Intronic
1097778448 12:63675211-63675233 GGGGAGACCAGGTTGGGGCTGGG - Intergenic
1101435375 12:104659796-104659818 TTGTAGAGATGGTGGGGGCGGGG - Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1104311520 12:127657808-127657830 GGGGAGACGAGGTGGGGGCGGGG - Intergenic
1104994224 12:132643940-132643962 TTGTAGACCATGTTGGAGCGAGG + Exonic
1105640064 13:22252844-22252866 GCGTAGGCAAGGGTGGGGAGTGG + Intergenic
1110608873 13:77466424-77466446 GTGTGGAGATGGTGGGGGCGGGG + Intergenic
1111479099 13:88798800-88798822 GTGTGGGCAAGGTTGGGGGCCGG - Intergenic
1113504976 13:110810102-110810124 TTGTAAAGATGGTTGGGGCGGGG + Intergenic
1113513683 13:110874680-110874702 CCGCAGCCAAGGTTGGGGCGAGG - Intergenic
1113793003 13:113040689-113040711 GCGTGGACATGGTGGGGGCGAGG - Intronic
1113912377 13:113849097-113849119 GTGTTGGCAAGGCTGGGGCGGGG - Intronic
1115197015 14:30812315-30812337 GTGTAAAAAAGGTGGGGGAGGGG + Intergenic
1117116484 14:52518463-52518485 GTGGAGACAAGGTTGGTTCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121828546 14:97030324-97030346 GTGTAGACAGGATTGGGAGGAGG + Intergenic
1121840340 14:97129013-97129035 GGGTAGACAGTGTTGGGGAGTGG - Intergenic
1122772573 14:104103871-104103893 GAGTGGGCAGGGTTGGGGCGCGG + Intronic
1126800972 15:52295905-52295927 GGGTGGAGAAGGTTGGGGCCCGG + Intergenic
1127992837 15:64133437-64133459 ATGCAGGGAAGGTTGGGGCGTGG + Intronic
1133027374 16:2994717-2994739 CTATAGACCAGGTAGGGGCGGGG + Intergenic
1133256101 16:4517343-4517365 GCCTAGAAAAGGATGGGGCGGGG + Intronic
1133416329 16:5609862-5609884 GTGCAGAGACGGTGGGGGCGGGG + Intergenic
1133711581 16:8406693-8406715 GAGTAGGCATGGTTGGGGAGGGG - Intergenic
1135615363 16:23906981-23907003 GTGGGGACAGGGTTGGGGTGGGG + Intronic
1136288574 16:29258374-29258396 GTGCTGAAAAGGTTTGGGCGGGG + Intergenic
1137024669 16:35460687-35460709 TTGTAGAAAAGGTTGGGGGGCGG - Intergenic
1140279728 16:73543711-73543733 GAGAAGAGAAGGTGGGGGCGGGG - Intergenic
1141089095 16:81117659-81117681 CTGTGCACAAGGTTGGGGAGAGG - Intergenic
1141254067 16:82384559-82384581 ATGTAGATAAGGTTGGGAGGTGG - Intergenic
1142094289 16:88231280-88231302 GTGCTGAAAAGGTTTGGGCGGGG + Intergenic
1143795178 17:9330424-9330446 GTGTAGACCGGGTTGGGGGGTGG - Intronic
1144444470 17:15314422-15314444 GTGTAGACAAGGTGGGAGTTAGG - Intronic
1146475379 17:33158369-33158391 TGGGAGACAAGGTTGGGGAGAGG + Intronic
1147345188 17:39787490-39787512 GGGTAGAGGAGGTTGGGGAGTGG - Intronic
1151442122 17:74136176-74136198 GTGTGGACAGGGTTGGAGCTGGG + Intergenic
1157626459 18:49055133-49055155 GTGGAGACAGGGCTGGGGTGGGG + Intronic
1158850757 18:61493903-61493925 GTGTAGACAAAGTTGGTGAGTGG - Intronic
1160003867 18:75053758-75053780 GTGTAGAAAAGGCTGAGGCTGGG + Intronic
1160021181 18:75183126-75183148 GTGAAGCCAAGCTTGGGGCTAGG - Intergenic
1166229996 19:41421144-41421166 GTTTCCACAAGGCTGGGGCGTGG + Intronic
1166661722 19:44651571-44651593 GTGTAGACAATATTGGGCAGAGG - Intronic
1167824646 19:51961088-51961110 GTGAGCACAAGGTTGGGGCTAGG + Intergenic
926741733 2:16116759-16116781 GTGTAGACAGGGTAGGGGCAGGG + Intergenic
929596717 2:43180639-43180661 GTGGAGACAAGGGTGGGGGTGGG - Intergenic
941760208 2:169233960-169233982 GTGGAGTGAAGGCTGGGGCGTGG - Intronic
946366016 2:219249560-219249582 GGGTAGACATGGTTCGGGGGAGG - Exonic
946966476 2:225042428-225042450 GGATAGAGAAGGTTGGCGCGGGG - Exonic
948176399 2:235946861-235946883 GTGGACACAAGGGTGGGGAGGGG - Intronic
948689503 2:239692969-239692991 GTGTTGTCTAGGTTGGGGTGGGG - Intergenic
1168751101 20:282059-282081 GTGGAGACAAGGTAGTGGAGTGG - Intronic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1170738009 20:19027386-19027408 GTATAGACCGGGTTGGGGAGGGG + Intergenic
1172033413 20:31996480-31996502 GTGGAGACAGGGCAGGGGCGGGG - Intronic
1172078584 20:32319259-32319281 GTGTCGACAAGGATGTGGAGAGG - Intronic
1174429165 20:50455701-50455723 GTGAAGATGAGGTTGGGGAGGGG - Intergenic
1175803258 20:61813175-61813197 GTGTAAACAAGATTGTGGTGGGG + Intronic
1177121753 21:17145648-17145670 ATGTAGGCAAGGTTTGGGTGGGG - Intergenic
1179793568 21:43769421-43769443 GTGTAGACAGGGTCTGGGTGGGG - Intergenic
1181412299 22:22732737-22732759 CTGTTGACAAGGGTGGGGTGTGG - Intergenic
1181419937 22:22790660-22790682 CTGTTGACAAGGGTGGGGTGTGG - Intronic
1182268381 22:29137095-29137117 GTGTGGCCTAGGTTGGGGCAGGG - Intronic
952422639 3:33145475-33145497 GTGGAGTAAAGGTTGGGGTGAGG - Exonic
953134648 3:40172092-40172114 TTCAAGACAAGGTTGGGGTGGGG + Intronic
953411871 3:42695154-42695176 GTGGTGACAAAGTTGGGGCATGG - Intronic
954390323 3:50265096-50265118 GTGGAGACCAGGCTGGGGTGAGG + Intergenic
954679086 3:52331913-52331935 ACTTAGACAAGGCTGGGGCGTGG - Intronic
956341949 3:68235006-68235028 GTGCATACAAGGTGGGGGCAGGG - Intronic
961055340 3:123783467-123783489 GTGTAGACAAAGTCCGGGCATGG - Intronic
961531049 3:127540661-127540683 GTGTGGACAGGGTTTGGGTGGGG + Intergenic
962356495 3:134698693-134698715 CTGGAGACAAGGTGTGGGCGAGG - Intronic
962382498 3:134909097-134909119 GTACACACAAGGTGGGGGCGGGG + Intronic
964307161 3:155354245-155354267 GTGTAGACAGGTTTGGAGCCTGG + Intergenic
967930382 3:194686573-194686595 GTGCAAAAAAGGTTGGTGCGGGG - Exonic
968650296 4:1757731-1757753 GTGGAGACAGGGTGGGGGTGGGG - Intergenic
970682719 4:18529228-18529250 GTATATACAAGGTTGGAGCAAGG - Intergenic
972811677 4:42595368-42595390 GGTTAGAAAAGGTTGGGGCAGGG + Intronic
979127828 4:116998608-116998630 GTGAAGACAAGGTGGGTGAGTGG - Intergenic
980164317 4:129206655-129206677 GTGAGTACAAGGTTGGGGCAGGG - Intergenic
982121605 4:152148559-152148581 GTTTAGACAGGGTTGGGACATGG + Intergenic
985375637 4:189334592-189334614 GTGAAGAGAAGGATGGGGAGAGG - Intergenic
997965207 5:138351490-138351512 GTGTAGACAAGGTTATGGACAGG + Intergenic
1001463451 5:171939658-171939680 GTGTAGCCCAGGTTGGAGTGCGG - Intronic
1002193291 5:177489789-177489811 GTGTAGATGAGGCTGGGGCTGGG + Exonic
1002703647 5:181145716-181145738 GTGTAGACAAGGTATGAGGGCGG - Intergenic
1003623533 6:7723398-7723420 GAGTAGACAAGGTGGGGGTTAGG + Intergenic
1004267668 6:14163227-14163249 GTGGAGACATGGTGGGAGCGGGG + Intergenic
1006447652 6:34088860-34088882 GTGTAGACAAGGGTGGGAGTGGG + Intronic
1008067642 6:47066959-47066981 CTACAGACAAGGTTGGGGAGTGG - Intergenic
1008587789 6:52964917-52964939 GTGGAGACCGGGTTGGGGAGTGG - Intergenic
1010751667 6:79622284-79622306 TTGTAGTCAAGGTTGTGGAGGGG - Intergenic
1019327276 7:444675-444697 GTGTGGGCAAGCTTGGGGCAGGG - Intergenic
1019604204 7:1900415-1900437 GAGGAGGCCAGGTTGGGGCGAGG - Intronic
1019705767 7:2496544-2496566 GTGGAGCCAAGGTGGGGGCGGGG - Intergenic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1019838443 7:3414216-3414238 GAAGAGACAAGGTTGGGGTGCGG + Intronic
1021285551 7:18777072-18777094 GTATAGAGAAGGTTGGGGGTGGG + Intronic
1021368682 7:19813731-19813753 ATGTAGACGTGGTTGGGGGGAGG + Intergenic
1023394500 7:39740139-39740161 GTGAAGACAAGGAGGGGGCTGGG - Intergenic
1024363948 7:48500119-48500141 GTGTAGCCAAGGTTGGTGAGTGG - Intronic
1025245502 7:57313491-57313513 GTGAAGATGAGGTTGGGGAGGGG + Intergenic
1026386048 7:69848870-69848892 GTGTCGAAAAGGTGGTGGCGGGG - Intronic
1029618969 7:101678113-101678135 TTGTAGAGATGGTTGGAGCGGGG - Intergenic
1030080492 7:105773847-105773869 GTGTAGACAAGTGAGGGTCGGGG + Intronic
1035085046 7:156251102-156251124 GTGCAGACAAGGCAGGGGCCCGG + Intergenic
1035340154 7:158155298-158155320 GTGAAAACAATGTTGTGGCGAGG - Intronic
1035895423 8:3394617-3394639 GTGTAGAAAAAGTTGGGGGGAGG + Intronic
1037127324 8:15366851-15366873 GTGTAGACAAGGGTGGGGGGTGG + Intergenic
1037628423 8:20629289-20629311 GTGTAGACAGGGTTCAGGGGAGG + Intergenic
1039889495 8:41674490-41674512 TTGTAGGAAAGGGTGGGGCGAGG - Intronic
1041806368 8:61854230-61854252 TTGCTGACAAGGGTGGGGCGGGG - Intergenic
1042677069 8:71332971-71332993 GTGGAGACCAGGTTGGGGTGGGG - Intronic
1044735138 8:95271196-95271218 GGGGAGACAATGTTGGGGCAAGG + Intergenic
1046748768 8:117904781-117904803 GTGGGGAGAAGGTTGGGGAGAGG + Intronic
1049673245 8:143878834-143878856 GAGCAGACAAGGTGGGGTCGGGG - Intergenic
1055492031 9:76815135-76815157 AGGTAGAGAAGATTGGGGCGGGG - Intronic
1056881817 9:90401548-90401570 GTCTGGACAAGGTTGGGGGCAGG + Intergenic
1057199028 9:93130617-93130639 GGGTAGACAAGGATGTGGAGGGG + Intronic
1061794938 9:133081016-133081038 GGGGAGACTGGGTTGGGGCGAGG + Intronic
1186056385 X:5654065-5654087 GTGTAGACCAGGTTGGCTCCGGG - Intergenic
1189426943 X:40910223-40910245 GTGTACACAAGGATGGGGAATGG + Intergenic
1190299841 X:49050674-49050696 TTTAAGACAAGGTTGGGGCTGGG + Intergenic
1194986117 X:100491388-100491410 GTGTAGAAAAGGGTGGGGAATGG + Intergenic
1196463660 X:115952490-115952512 GTCTCAACAAGGTGGGGGCGTGG + Intergenic
1199017692 X:142837776-142837798 GTGTGGAGAAGGTTATGGCGGGG + Intergenic
1199482260 X:148310720-148310742 GTGTGGAGCAGGTTGGGGTGAGG - Intergenic
1200362027 X:155617113-155617135 GTGAGGACAAGGTTGAGGAGAGG - Intronic
1200813348 Y:7506635-7506657 GTGGTGAAAATGTTGGGGCGCGG - Intergenic