ID: 908520389

View in Genome Browser
Species Human (GRCh38)
Location 1:64935742-64935764
Sequence GAACTGCTTGCAACGCTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908520386_908520389 11 Left 908520386 1:64935708-64935730 CCTGCTGTGACAGAATACTTGAT No data
Right 908520389 1:64935742-64935764 GAACTGCTTGCAACGCTGACGGG 0: 1
1: 0
2: 0
3: 7
4: 54
908520384_908520389 20 Left 908520384 1:64935699-64935721 CCAGCCTTTCCTGCTGTGACAGA 0: 1
1: 0
2: 1
3: 27
4: 272
Right 908520389 1:64935742-64935764 GAACTGCTTGCAACGCTGACGGG 0: 1
1: 0
2: 0
3: 7
4: 54
908520385_908520389 16 Left 908520385 1:64935703-64935725 CCTTTCCTGCTGTGACAGAATAC No data
Right 908520389 1:64935742-64935764 GAACTGCTTGCAACGCTGACGGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908520389 Original CRISPR GAACTGCTTGCAACGCTGAC GGG Intronic
902947958 1:19856783-19856805 GATCTTCATGCAATGCTGACGGG + Intergenic
903025953 1:20430174-20430196 GAACTGATCGCAACGCTCAAGGG - Intergenic
904051191 1:27639980-27640002 AAACTGCTTGCTATGCAGACAGG + Intergenic
905260324 1:36712876-36712898 GAAGTGCTTGCAACTGTGCCTGG - Intergenic
908520389 1:64935742-64935764 GAACTGCTTGCAACGCTGACGGG + Intronic
911869603 1:103078660-103078682 GAACTGTTAACATCGCTGACGGG - Exonic
912722634 1:112032932-112032954 GAACTGCTTTCAAAGCTCTCAGG - Intergenic
918820747 1:189250842-189250864 GAACAGCCTGCAAGGCTGAGTGG + Intergenic
919970469 1:202573764-202573786 GTTCCGCTTGCAACACTGACAGG + Intronic
1063512612 10:6660784-6660806 AAACTGCTTGCAACACTGCCTGG + Intergenic
1064227127 10:13496811-13496833 GAATGGCCTGCAACGTTGACTGG + Exonic
1067720179 10:48722233-48722255 GAACTGCCTGCATCACTGTCAGG + Intronic
1074492067 10:113947279-113947301 GAACTGAATGCATCGCTGACTGG - Intergenic
1075817722 10:125278506-125278528 AAACTGCTTGGACTGCTGACAGG + Intergenic
1077517373 11:3010121-3010143 GAACTACTTCCAATGCTGGCTGG + Intronic
1084368119 11:68716965-68716987 CTACAGCTTGCAAAGCTGACTGG - Intronic
1090106492 11:123858113-123858135 GAACTGATTGCAACTTTTACTGG - Intergenic
1098245685 12:68514999-68515021 GATCTGATTGCAAGGCTGCCTGG - Intergenic
1104336993 12:127908073-127908095 GAACTGCTTAAAACACTGGCAGG + Intergenic
1104723093 12:131057196-131057218 GAACTGCACGGAACGCTGCCTGG + Intronic
1105430957 13:20337058-20337080 GAACTGCCTGCAACGTGGAGAGG - Intergenic
1110714541 13:78686096-78686118 GAACTTTTTGCAAAGATGACTGG + Intergenic
1118578809 14:67272464-67272486 GAACTGCTTGCAGTGTTGGCTGG + Intronic
1118768693 14:68927523-68927545 GAACTGGATGCAAAGCTGAGAGG + Intronic
1120176751 14:81302489-81302511 AAAGTGTTTGCAAGGCTGACTGG + Intronic
1120756211 14:88246763-88246785 GAACAGCTTGCAAGGCTGAATGG - Intronic
1121414853 14:93772410-93772432 GACCTGCTTCCAAGGCTGACGGG - Intronic
1124244214 15:28056111-28056133 CAAGTGCCTGCAACGCTGACTGG + Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1133090092 16:3397429-3397451 AAACTGCCTGAAGCGCTGACGGG + Exonic
1134055497 16:11167333-11167355 CAACTGCCTGCACCTCTGACTGG + Intronic
1137442902 16:48511242-48511264 GAGCTGCTGGGAACGCTGTCTGG + Intergenic
1137842255 16:51651327-51651349 GAGCTGCTGGCAAGGCTGCCAGG - Intergenic
1148163770 17:45468189-45468211 GAACGGCTTGCACCACTCACCGG + Exonic
1150395000 17:64814843-64814865 GAACGGCTTGCACCACTCACCGG + Intergenic
1159890932 18:73952535-73952557 GAACTGCAAGGAACGGTGACAGG + Intergenic
925378206 2:3404078-3404100 GGACTGCCTGCTACGCTGACCGG + Intronic
926081495 2:9990236-9990258 GAACTGCTTGAACCCCTGAGAGG - Intronic
927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG + Intronic
934734729 2:96684193-96684215 GACCTGCTAACAATGCTGACTGG - Intergenic
938749355 2:134314120-134314142 GAACTGCTCCCAAACCTGACCGG - Intronic
1169698750 20:8422770-8422792 GGATTGCTGGTAACGCTGACTGG - Intronic
1179156288 21:38853828-38853850 GAAATGCCTGCAACACTGCCTGG - Intergenic
949920449 3:8996186-8996208 GAAGTGCTTGCAACAGTGTCTGG + Intronic
950638029 3:14329927-14329949 CAGCTGCTTGGAAGGCTGACGGG - Intergenic
961143747 3:124577059-124577081 GAACTGCTGGCAACAAGGACAGG - Intronic
962591107 3:136890338-136890360 GGGCTGCGTGCAACGCTGGCGGG - Intronic
971871392 4:32244572-32244594 GAACTGCTTAAAACGCTGAAAGG - Intergenic
972022816 4:34335979-34336001 GGACTGCTTGCAGCGCTTGCGGG - Intergenic
972701298 4:41496580-41496602 GAGCTGCATGCAATGGTGACTGG + Intronic
982151278 4:152460491-152460513 GAAATGCTTGCAATGGTGGCTGG + Intronic
996436455 5:123438470-123438492 CAACTTCTTGCAACAATGACTGG - Intergenic
999865654 5:155697810-155697832 GAACAGCTTGCAATGCAGCCTGG - Intergenic
1006728732 6:36219109-36219131 GAAGTGCTTCCAAGGCAGACTGG + Intronic
1020144302 7:5630946-5630968 GAACTTCTGGCAAACCTGACTGG + Intronic
1038917777 8:32045062-32045084 GAACCTCTTGCAAGACTGACAGG + Intronic
1049307105 8:141909978-141910000 GAACTGCCCGCATGGCTGACAGG + Intergenic
1052444928 9:28548138-28548160 GAACTTCTTGAAACTCTGGCAGG - Intronic
1058874446 9:109231269-109231291 GAATTGCTTGCAAAGTTGATTGG - Intronic
1186359201 X:8821813-8821835 GAACTGCTTGCAGGACTGAGTGG + Intergenic
1198420445 X:136466202-136466224 AAAGTGCTTGCAACGGTGCCTGG - Intergenic
1201542724 Y:15125563-15125585 GATTTGCTTCCAACGCTGAAAGG + Intergenic