ID: 908520764

View in Genome Browser
Species Human (GRCh38)
Location 1:64939384-64939406
Sequence TTGTGTGAATGTATGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908520764_908520766 11 Left 908520764 1:64939384-64939406 CCAACTTCCATACATTCACACAA 0: 1
1: 0
2: 2
3: 24
4: 322
Right 908520766 1:64939418-64939440 TTTCACAGTTTGCAGAAGTTTGG 0: 1
1: 0
2: 2
3: 24
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908520764 Original CRISPR TTGTGTGAATGTATGGAAGT TGG (reversed) Intronic
900535880 1:3177114-3177136 ATGGGTGAATGAATGGAAGATGG - Intronic
900764700 1:4496662-4496684 GTGTGTGAATGCATGCAAGTGGG - Intergenic
902136628 1:14311820-14311842 TAGTGCAAATGTATGGAGGTGGG + Intergenic
903026446 1:20432979-20433001 GTGTGTGCATGTGTGGAAGTAGG - Intergenic
906199612 1:43950998-43951020 TTTTGTGAATGGAGGAAAGTAGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
907498085 1:54858415-54858437 TTGTGTGGTAGTAGGGAAGTGGG - Intronic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
908582540 1:65530955-65530977 TTTTGAGAATGTATTGAAGAGGG - Intronic
908764116 1:67539111-67539133 TAGTCTGAATCTATGAAAGTGGG - Intergenic
912072346 1:105827102-105827124 TTGGGTAAATATGTGGAAGTGGG - Intergenic
912181583 1:107225409-107225431 TTGTGTGAAAATATGTAAATAGG + Intronic
912592583 1:110840341-110840363 TGGTGAGAATGTAGAGAAGTTGG + Intergenic
912948039 1:114100915-114100937 ATGTGGGAGTGTATGGAAATAGG - Intronic
916347127 1:163806060-163806082 TTGTGTGTATGTATGGAGTCTGG + Intergenic
917410106 1:174750530-174750552 TCCTGTGAATGTAAGGAATTTGG + Intronic
917469688 1:175315840-175315862 GTGTGTGAATGATTGGAAGGAGG + Exonic
917811254 1:178660395-178660417 TTGTGTGAAGGCATGGCACTGGG + Intergenic
917825492 1:178815816-178815838 TTCTGGGAATTTATGTAAGTGGG + Intronic
918563274 1:185895028-185895050 TTATGTGAATGCCTGGGAGTTGG + Intronic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919559225 1:199096827-199096849 TTTTGAGAATGTGTGGTAGTAGG - Intergenic
920711590 1:208300560-208300582 TGGTGTGAATGGGTGGAACTTGG + Intergenic
920964906 1:210693562-210693584 TGGTGTGTATGTCTAGAAGTGGG - Intronic
921309310 1:213827101-213827123 ATGTGTGACTGGATGGATGTGGG + Intergenic
921668026 1:217895713-217895735 TTCTGTGAATGAACGGAACTTGG - Intergenic
922887648 1:229032142-229032164 TGGTGTGTATGTAGGGGAGTGGG - Intergenic
923264283 1:232298837-232298859 TTCTGTGACTGAACGGAAGTGGG - Intergenic
924286976 1:242497472-242497494 TTGTGTGTGTGTATGGAGGCAGG + Intronic
1063131202 10:3179019-3179041 TAGTGTGAATTTAAGTAAGTGGG - Intergenic
1063293828 10:4781078-4781100 GTGTGTGAATGTGTGTAATTTGG - Intergenic
1063694773 10:8323493-8323515 TTGGGTGAAAGGAAGGAAGTAGG + Intergenic
1065182467 10:23140345-23140367 TTGTCTGAATGTGTGGAAGGGGG + Intergenic
1067956554 10:50797456-50797478 TTGTGTGAATATCAGGAAGTGGG + Intronic
1068078239 10:52285129-52285151 TGGTGTGTATGCATGGAAGGGGG - Intronic
1068595330 10:58896786-58896808 GTGTGTGCATGTGTGGATGTGGG - Intergenic
1070375194 10:75823747-75823769 GTGTGTGTGTGTATGTAAGTAGG - Intronic
1072044214 10:91638487-91638509 TAATGTGAGTGTATGGAAGATGG + Intergenic
1074300853 10:112232288-112232310 TTGTGTGAAGGGCTGGAGGTAGG + Intergenic
1075911437 10:126128543-126128565 ATGTGGGAATGTGTGCAAGTGGG + Intronic
1075911443 10:126128594-126128616 GTGTGGGAATGTGTGCAAGTGGG + Intronic
1075911451 10:126128645-126128667 ATGTGGGAATGTGTGCAAGTGGG + Intronic
1075911457 10:126128692-126128714 GTGTGGGAATGTGTGCAAGTGGG + Intronic
1075911463 10:126128739-126128761 GTGTGGGAATGTGTGCAAGTGGG + Intronic
1075911475 10:126128839-126128861 GTGTGGGAATGTGTGCAAGTGGG + Intronic
1075911481 10:126128886-126128908 GTGTGGGAATGTGTGCAAGTGGG + Intronic
1075911491 10:126128937-126128959 GTGTGGGAATGTGTGCAAGTGGG + Intronic
1076138314 10:128060121-128060143 CTGTGTGAATGTGTGCATGTGGG - Intronic
1076235518 10:128861175-128861197 TTGTGTGCAGGTGAGGAAGTGGG - Intergenic
1076602009 10:131663372-131663394 AGGTGTGAATGCATGGAAATGGG + Intergenic
1077139593 11:1018215-1018237 GTGTGTGAATGTAGCGAGGTAGG + Exonic
1077353159 11:2102245-2102267 GTGGGTGAATGGATGGAGGTTGG + Intergenic
1080079277 11:28195348-28195370 TAGTGTGAATGTGTGGAAAAGGG - Intronic
1081380139 11:42404766-42404788 TTGAGTGAATGAATGAAAGGTGG - Intergenic
1081418694 11:42846261-42846283 TTTTGTGAAAGTTTGGAAGGAGG - Intergenic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1082788872 11:57333453-57333475 TTGTGTGAAGGGCTGGAACTGGG - Exonic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1084930600 11:72552772-72552794 TTGTGTGACTGCATAGATGTCGG - Intergenic
1086558558 11:88140848-88140870 TTGAGTGTCTGTATGGATGTAGG + Intronic
1086564414 11:88209235-88209257 TTGTACGAATGGATGGAAGTGGG + Intergenic
1087812288 11:102621337-102621359 TTGTGTGACTGTAAGGAACATGG - Intronic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1091455293 12:602596-602618 TTGTGTGAATGTATATACCTAGG + Intronic
1092476301 12:8821869-8821891 TGTTGTGACTGTATGGAAATAGG - Intergenic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1092926203 12:13274733-13274755 CTGTGTGCATGTCTGGGAGTGGG - Intergenic
1094765937 12:33594741-33594763 ATGTATGAATGTTTTGAAGTAGG + Intergenic
1095248470 12:39950099-39950121 GTGTGTGAATGTATAGAAAATGG + Intronic
1095256225 12:40039953-40039975 ATGTGTGAATGTATGGAGCATGG - Intronic
1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG + Intronic
1097671335 12:62542734-62542756 ATGTGTGAATGTCAAGAAGTAGG - Intronic
1097804630 12:63951930-63951952 TTGTGTGTGTGTGTGGAGGTGGG + Intronic
1098889601 12:75995926-75995948 TTGTGTAAATATCTAGAAGTGGG + Intergenic
1099514418 12:83579388-83579410 TTGTGTGAATATTTGGGAGAGGG + Intergenic
1101186091 12:102281203-102281225 TTGAATGTATATATGGAAGTTGG + Intergenic
1101279219 12:103234397-103234419 TTTTGTGAATCTGAGGAAGTGGG + Intergenic
1101785893 12:107883232-107883254 TTTCGTGAATGTATAGATGTGGG - Intergenic
1107022097 13:35762655-35762677 GTGTGTGTATGTATGAATGTAGG - Intergenic
1107341166 13:39407922-39407944 TTCTGAGAATGAATGGAAGGTGG + Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1109629731 13:65031454-65031476 TGGTGCCAATGTATGGAAGCTGG - Intergenic
1109897857 13:68717809-68717831 TTGTGTAATTATATGGGAGTAGG - Intergenic
1110029787 13:70594812-70594834 TTGTATAAATGTAGGGAACTAGG + Intergenic
1110197059 13:72802164-72802186 TTTTTTGACTGTATGGGAGTTGG + Intronic
1111998486 13:95188569-95188591 TTGTGTGACTTTATTGAAATGGG - Intronic
1113041055 13:106104232-106104254 TTGCCTGAATGAATGGAAGATGG - Intergenic
1116184254 14:41576561-41576583 TTCTGAGAATACATGGAAGTTGG - Intergenic
1116476578 14:45347330-45347352 TTATGGGAAGGTATGGGAGTCGG - Intergenic
1116751371 14:48889698-48889720 TTGTGTGGATGGAAGGCAGTAGG - Intergenic
1117663428 14:58032026-58032048 AAGTGTGAAGGTTTGGAAGTGGG - Intronic
1118331960 14:64822136-64822158 GTGTGTGTATGTGTGGAAGGTGG - Intronic
1119093007 14:71801788-71801810 TTCTGTGTATGTATGGGGGTGGG + Intergenic
1124162850 15:27289667-27289689 TTAAGTGAATGAATGGAAGATGG + Intronic
1124186707 15:27536465-27536487 TTTTATGAATGGATGGAAATAGG + Exonic
1125173288 15:36791849-36791871 TTGTGTGAAGTTATTGATGTAGG - Intronic
1127823810 15:62684954-62684976 TTGTGTGAATGTATATATCTAGG + Intronic
1127921918 15:63501322-63501344 TTGTGTATATACATGGAAGTGGG - Intergenic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1130353603 15:83111213-83111235 ATGGGTGAATGTATGGAGGATGG - Intronic
1130858114 15:87859983-87860005 GTGTGTGTATGTATGGACATAGG - Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131484133 15:92806568-92806590 TAGTGTGTATGTATGTAGGTAGG + Intronic
1131484136 15:92806606-92806628 TAGTGTGTATGTATGTAAGTAGG + Intronic
1134082288 16:11333448-11333470 TTGAATGAATGAATGGATGTTGG + Intronic
1134449117 16:14353103-14353125 TGGTGTGAATGAATGTAAGACGG - Intergenic
1135544176 16:23354751-23354773 TTGTGTGAATCTATGTATATGGG + Intronic
1135980108 16:27140696-27140718 TTGGGTAACTGTATGGATGTAGG - Intergenic
1136290453 16:29268384-29268406 TTCTGGGAATGTGTGGGAGTTGG + Intergenic
1137645785 16:50072658-50072680 TTGTGTTAAAGTATTTAAGTAGG + Exonic
1138957874 16:61992954-61992976 TTGTGTGTGTGTATGGAGGTGGG + Intronic
1139074210 16:63423734-63423756 TTGTGTGTGTGTATCTAAGTGGG - Intergenic
1139114026 16:63927118-63927140 TTATGTGCATGTATGTATGTGGG + Intergenic
1140352869 16:74279515-74279537 TTGGGGGAAGGGATGGAAGTGGG + Intergenic
1141380138 16:83568916-83568938 GTGAGAGAATGGATGGAAGTGGG - Intronic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1141875455 16:86820961-86820983 TTGTGTGAACGTCTGGAGATGGG + Intergenic
1142680494 17:1545110-1545132 GTCTGTGAATGAATGAAAGTGGG - Intronic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1143280118 17:5747663-5747685 TGGTGTGAATGTATGTGAGTGGG - Intergenic
1143286853 17:5796542-5796564 AGGTGAGAATGTAAGGAAGTTGG - Intronic
1143397127 17:6609733-6609755 ATGTGTGATTGAATGGAAGATGG - Intronic
1143471006 17:7175424-7175446 TTGTGTGAATGTGTGTATGTGGG - Intronic
1143615863 17:8048705-8048727 TTGTGTGTGTGTATGGTGGTGGG - Exonic
1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG + Intergenic
1144922212 17:18773496-18773518 TTGTGTGTGTGTATGTAGGTGGG + Intronic
1145261027 17:21354972-21354994 ATGAATGAATGAATGGAAGTTGG + Intergenic
1146418913 17:32664230-32664252 TTGTGTGTATGTGTGGCAGGAGG + Intronic
1146453220 17:32991047-32991069 GGGTGTGCATGGATGGAAGTGGG - Intronic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1147608800 17:41789252-41789274 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
1147816867 17:43216625-43216647 GTGTGTGGATGTGTGGTAGTGGG + Intronic
1148512091 17:48179896-48179918 TTATGAGATTGTAGGGAAGTGGG - Intronic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1149013504 17:51882444-51882466 TTGTGTGTGTGTATGGGTGTTGG + Intronic
1150306202 17:64087461-64087483 TTGTGTGACTGGGTGGAAGTGGG - Intronic
1151015761 17:70551006-70551028 GTGTGTGTGTGTATGGAAGCTGG + Intergenic
1151099455 17:71540076-71540098 GTGTGTGTATGTATGTGAGTAGG - Intergenic
1151497148 17:74465288-74465310 TTGTGTGAGTGTATGTGTGTGGG + Intergenic
1154371482 18:13766545-13766567 TAGTGTGGTTGTTTGGAAGTAGG - Intergenic
1154404119 18:14072677-14072699 TTGCGTAAATGTATGAAAGCAGG + Intronic
1155098402 18:22582982-22583004 ATGTGTGATAGGATGGAAGTAGG + Intergenic
1155712582 18:28901300-28901322 TTGTATGAATAGATGAAAGTAGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159034053 18:63260231-63260253 GTGTGTGTATGTATGGAATGAGG - Intronic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1163582468 19:18146749-18146771 TTGTGTGGATGAATGGATGCTGG + Intronic
925515781 2:4679372-4679394 TTGTGTGTGTGTATGGGTGTGGG - Intergenic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
926303416 2:11619563-11619585 TAGTGTGAGGGTATGGAAGAAGG - Intronic
926349202 2:11980276-11980298 CTGTGTGAATGTGTGCAAGCTGG - Intergenic
927805655 2:26144358-26144380 GACTGTGAATGTATGGAAGTGGG - Intergenic
928276330 2:29903520-29903542 TTTTATGTATGTATGTAAGTAGG + Intronic
928897523 2:36282284-36282306 GTGGATGAATGTATGGAAGGAGG - Intergenic
928931398 2:36628792-36628814 TTCTGTGGATGTAAGCAAGTTGG - Intronic
929774123 2:44917561-44917583 TTGTGTGTTTTTATGGAAGAGGG + Intergenic
930188259 2:48431710-48431732 TTGTGTGTGTGTGTGGAAGGGGG - Intergenic
930951217 2:57146188-57146210 TTGTGTTCATGGATGGAGGTGGG + Intergenic
934048741 2:88192457-88192479 GTGTGTGTATGTGTGGCAGTGGG - Intergenic
934870974 2:97865074-97865096 TTATGTGTATGTATGGAACTGGG + Intronic
936147358 2:109989104-109989126 TTGTGAGAATGTGTGGAAACTGG - Intergenic
936197334 2:110382380-110382402 TTGTGAGAATGTGTGGAAACTGG + Intergenic
936545654 2:113390836-113390858 GTGTGTGTTTGTATGGAACTAGG + Intergenic
937648170 2:124288891-124288913 TTGTGTGAATAAATGAAAATTGG + Intronic
938717117 2:134030745-134030767 TTGTATGAGTCTATGGAAATGGG - Intergenic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
939699309 2:145370370-145370392 TTGTGTAAATGAGTGGAACTGGG - Intergenic
939977837 2:148739626-148739648 TTCTGTGTAGGTAAGGAAGTGGG - Intronic
940311394 2:152282687-152282709 TTCTGTGAAAGTCCGGAAGTGGG - Intergenic
940567747 2:155389419-155389441 TTGTGTGAATATGTGGGAGGAGG + Intergenic
940755990 2:157684075-157684097 TTGTGTGAAAATATGAAGGTTGG - Intergenic
941769687 2:169331279-169331301 TTTTGTGAATGTATGCAGTTGGG - Intronic
942561670 2:177226531-177226553 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
944239615 2:197473172-197473194 TTGTGTGGATGTATGTAGGTGGG - Intronic
946395301 2:219441301-219441323 GTGTGTGAATGTACGGGGGTAGG + Intronic
946707937 2:222477431-222477453 ATGTGTGAATGTATGTATATAGG + Intronic
948363807 2:237441621-237441643 TTGTGTGTATGTGTGGGAGGAGG + Intergenic
1169603052 20:7284132-7284154 TTGAGTAGATGTATGGAAGATGG - Intergenic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170360425 20:15540187-15540209 TTGCTTGAATGTGGGGAAGTAGG + Intronic
1170666419 20:18390489-18390511 TTGAGTGAATATTTTGAAGTGGG - Intronic
1174435081 20:50500449-50500471 TTGTGATAATGCATGTAAGTTGG - Intergenic
1175474437 20:59260980-59261002 GTGTGTGTATGTATGTAAGGAGG - Intergenic
1175658350 20:60791560-60791582 ATGGGAGAATGTATGGAAGGAGG - Intergenic
1178505485 21:33159303-33159325 GTGTGTGAAGGTGTGGGAGTGGG - Intergenic
1180016891 21:45093061-45093083 TTGTGTGAATATTTGGGGGTGGG - Intronic
1182169785 22:28215658-28215680 GTTTGTGAATGTAGGTAAGTTGG + Intronic
1182299440 22:29329533-29329555 CACTGTGAATGTGTGGAAGTGGG + Intronic
1182797524 22:33001721-33001743 TAGAGTTAATGTATGTAAGTAGG - Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1184810493 22:46828184-46828206 TTGAGAGAATGGATGGAGGTGGG + Intronic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
949520025 3:4842906-4842928 ACGTGTGAATGTATGTAGGTGGG + Intronic
955969382 3:64422156-64422178 TTGTGTGAAAGTCTTGAAGCTGG - Intronic
956149044 3:66222061-66222083 TTAGGGGAATATATGGAAGTAGG + Intronic
956149923 3:66230433-66230455 GTGTGTGCATGTATGTATGTAGG + Intronic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
956905930 3:73765133-73765155 TTGGATAAATATATGGAAGTGGG - Intergenic
957655162 3:83064537-83064559 TTGTGTGGTTGTTTGGAAGATGG - Intergenic
957832942 3:85547019-85547041 TTTTTTTAATGTCTGGAAGTAGG + Intronic
958896793 3:99838454-99838476 TTGTGTCCATGTAGAGAAGTGGG + Intronic
959592963 3:108099492-108099514 TTGTGTGAAAGGAAGGAACTAGG - Intergenic
960226055 3:115169729-115169751 TTGTGTGTATTTATGAATGTGGG + Intergenic
960244837 3:115388763-115388785 TTGTGTGACTGAATGGATTTTGG + Intergenic
961799276 3:129432502-129432524 TTGTGTCAATGAGTGGAAGCAGG - Exonic
962606521 3:137036671-137036693 GTTTTTAAATGTATGGAAGTGGG - Intergenic
962735123 3:138318781-138318803 TTGGATGAATGTATGGAAATGGG - Intronic
962925884 3:139993090-139993112 TTGTGTGTGTGTATGGGAGGGGG + Intronic
963638963 3:147835885-147835907 TTGTGTGTTTGTTTGGAGGTAGG + Intergenic
964585393 3:158293310-158293332 ATGTATGTATGTATGGGAGTAGG + Intronic
966578079 3:181525940-181525962 TTGTGTGAATAGACAGAAGTGGG - Intergenic
966782567 3:183596365-183596387 TTGAGTGAGTTTCTGGAAGTTGG + Intergenic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
967592615 3:191296248-191296270 GTGTGTGAGTGTGTGTAAGTTGG - Intronic
969368882 4:6718186-6718208 TTGTGTGAGTGAATGGTATTAGG + Intergenic
969896513 4:10310198-10310220 TTGTGTGAATGCATGGCAGTGGG + Intergenic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
972374652 4:38459185-38459207 TTTGGTGAATGTATGGAGGGAGG + Intergenic
972676340 4:41263364-41263386 TTGTGTGACTTTATGGCACTTGG + Intronic
973258748 4:48139576-48139598 TTGAGTGTATGTATGTATGTGGG - Intronic
975428740 4:74262092-74262114 ATGTGTGAATCTATGTAAATAGG + Intronic
975929304 4:79499434-79499456 TCATGTGAATGTATGTATGTAGG + Intergenic
976748381 4:88429102-88429124 TTGTGTACATGTCTGGGAGTTGG + Intronic
976881114 4:89926130-89926152 TTGTGTGTATACGTGGAAGTGGG + Intronic
978354364 4:107855677-107855699 TTGTGTAAATGTCTGTTAGTAGG + Intronic
978468324 4:109032946-109032968 TTGTATAAATGAAAGGAAGTAGG + Intronic
978812469 4:112865590-112865612 TGGTGTGGAGGTATGGAGGTAGG + Intronic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
983415408 4:167446367-167446389 GAATGTGATTGTATGGAAGTTGG - Intergenic
984231054 4:177099553-177099575 ATGTGTGTATGTATATAAGTAGG - Intergenic
986590677 5:9366244-9366266 TTGTGGAAATGTATGCAAATTGG + Intronic
987051612 5:14151402-14151424 GTGTGTGTATGTATGTATGTAGG + Intronic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
989152513 5:38314431-38314453 TTATGTGAATGTGAGGATGTGGG + Intronic
989523173 5:42424208-42424230 GTGTGTGTGTGTCTGGAAGTTGG + Intronic
989563150 5:42873917-42873939 GTGTGTGAGTGTATGTAAGAGGG - Intronic
989765588 5:45078910-45078932 CTGTGTGAATTTATGCAAATTGG + Intergenic
989992105 5:50779168-50779190 GTGTGTGTATGTGTGGTAGTAGG - Intronic
992146864 5:73859341-73859363 TTGTGGGAATATTTGGAAGGTGG + Intronic
994176717 5:96719230-96719252 TTGTGAGACTGGATGGGAGTAGG - Intronic
994755134 5:103786002-103786024 TTGTCTGTATGGATGGATGTAGG + Intergenic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
996384610 5:122898059-122898081 TTGTGTGCATGTATGTGTGTCGG + Intronic
996457617 5:123702628-123702650 TTATATGAAGGTATGGAAATTGG + Intergenic
997210209 5:132072837-132072859 TTCTGTGGAAGTGTGGAAGTAGG - Intergenic
997481204 5:134185903-134185925 TTGTGTGAGTGGATTGTAGTGGG + Intronic
998623518 5:143820481-143820503 TTCTCTGCATGTTTGGAAGTCGG + Exonic
999285128 5:150390070-150390092 ATGTGGGTAAGTATGGAAGTAGG - Intronic
1000250317 5:159488501-159488523 TTGTGTAAATGTCTACAAGTGGG - Intergenic
1000438181 5:161239170-161239192 GTGTGTGTATGTATGTATGTGGG - Intergenic
1000671911 5:164073493-164073515 GTGTGTCTATGTATGGAGGTTGG + Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1002090244 5:176800797-176800819 GTGTGTGCATGTCTGGATGTGGG + Intergenic
1003118501 6:3299739-3299761 GAGTGTGGATGTATGGGAGTGGG + Intronic
1003401497 6:5794761-5794783 TTGTGTGAATGGATTCAAGGGGG + Intergenic
1004113554 6:12745495-12745517 ATGTGTGAATATGTGGATGTAGG - Intronic
1004913480 6:20308982-20309004 TTGTGAGAATGGATTGGAGTGGG + Intergenic
1005680376 6:28201038-28201060 TGGTGAGAATGTAGGGAAATTGG - Intergenic
1008322143 6:50129125-50129147 TTGTGTGTTTGTGTGGAAGCAGG + Intergenic
1008323785 6:50151289-50151311 TTGTTTGTATGTATGAGAGTTGG - Intergenic
1008371093 6:50731439-50731461 GTGTGTGTGTGTATGAAAGTGGG - Intronic
1009358351 6:62781172-62781194 TTTTGTAAATGGAAGGAAGTTGG - Intergenic
1009653785 6:66512709-66512731 TGGTGAGAATGTATAGAAGAGGG + Intergenic
1009751617 6:67884186-67884208 TTATCAGACTGTATGGAAGTAGG + Intergenic
1010623385 6:78104914-78104936 TTATGTGAATCTAGGGAACTGGG + Intergenic
1010624749 6:78123807-78123829 TTGTGTATATGAATGGAAGAAGG - Intergenic
1011137885 6:84118729-84118751 TTGTGAGAAGCTGTGGAAGTGGG + Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1011837751 6:91455009-91455031 TTGTGTGTATGTTTGCATGTGGG + Intergenic
1013669441 6:112383246-112383268 TTGTCAAAATGTCTGGAAGTGGG + Intergenic
1014300033 6:119670281-119670303 GTGTATGTATGTATGGATGTAGG - Intergenic
1014893266 6:126869039-126869061 TTGTCAGAATGTCTAGAAGTAGG + Intergenic
1015376768 6:132518669-132518691 TTGAGTGAATATCTAGAAGTAGG + Intergenic
1015419904 6:132995515-132995537 TTGTGTGCATTTAAGGAAGACGG + Intergenic
1016089629 6:139960719-139960741 TTCTGAGAAAGTATGAAAGTAGG + Intergenic
1017581557 6:155870409-155870431 TTGTGTGAGAGTGTGGAAGTAGG - Intergenic
1019444704 7:1065302-1065324 TTGGGTAAATGTCTGGAATTGGG - Intronic
1020708547 7:11576087-11576109 TTCTGTGAATTTCTTGAAGTAGG - Intronic
1023024750 7:36040463-36040485 TTGTGGGAAGGAATAGAAGTAGG + Intergenic
1023658304 7:42448403-42448425 TTGTGTGACTGTGTGGAATTAGG + Intergenic
1023765081 7:43503234-43503256 GTGTGTGACTGTATTGATGTCGG - Intronic
1024059138 7:45685405-45685427 TGGAGTGAAAGGATGGAAGTGGG + Intronic
1024578564 7:50783465-50783487 TGGTGTGTATGTATGTGAGTGGG - Intronic
1024878784 7:54060435-54060457 ATGTGTGTATGTATGGAAAGGGG - Intergenic
1024883535 7:54115907-54115929 GTGTGTGTATGTCTGGAAATTGG - Intergenic
1024954140 7:54898402-54898424 TTGTGTTTATGTATGAAGGTAGG - Intergenic
1026288057 7:68981023-68981045 TTGGGAGAATGAATGGAAATTGG + Intergenic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1027425196 7:78054983-78055005 TTGTGTGAATGAATGAAATAAGG - Intronic
1028961621 7:96755256-96755278 TTGGATGAATGAATGGTAGTGGG + Intergenic
1029158670 7:98535409-98535431 TTGGGTGGCTGTAGGGAAGTGGG + Intergenic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1032183450 7:129702036-129702058 TTATGTAAATGTATAGAATTTGG + Intronic
1034068678 7:148161540-148161562 TTGTGTGTGTGTATGGGAGGTGG - Intronic
1034186608 7:149182759-149182781 TTGTGAAAATAAATGGAAGTTGG + Intronic
1034749243 7:153553545-153553567 TTGTGTGTGTGTGTGGAGGTAGG - Intergenic
1036064207 8:5359543-5359565 ATGTGTGAGTGTGTGAAAGTGGG + Intergenic
1037579758 8:20237359-20237381 GTGTGTGGATGTGTGGATGTGGG - Intergenic
1037921322 8:22808189-22808211 GTGGGTGGATGGATGGAAGTTGG - Intronic
1041606704 8:59790428-59790450 TTGTCTGAAAGTATGCAGGTAGG - Intergenic
1043611965 8:82076006-82076028 TGGTGAGAATGTATAGAAATTGG - Intergenic
1043721234 8:83548486-83548508 TTGTCAGATTGAATGGAAGTAGG - Intergenic
1046373230 8:113339611-113339633 TTGGGTGAATGTATGCCAATTGG + Intronic
1046809189 8:118514407-118514429 TGCTGTGAATGAATGGAAGTGGG - Intronic
1047878840 8:129170312-129170334 TTATGTGAATGAATTGAAGATGG - Intergenic
1048577929 8:135707458-135707480 TTGGGAGAATGGATGTAAGTTGG + Intergenic
1050659923 9:7873603-7873625 TTGTCTGAATGGATTGGAGTTGG - Intronic
1050669340 9:7978692-7978714 TTATGTGTATATATGGAAGTAGG + Intergenic
1050830882 9:10010654-10010676 TTGTGTGAAAGAGTAGAAGTTGG - Intronic
1052328079 9:27238666-27238688 GTGTGTGTGTGTATGGCAGTGGG - Intergenic
1052384501 9:27807761-27807783 TTGTTTGACTGGATGGAAGAGGG + Intergenic
1054841044 9:69740205-69740227 GTGTGTGTATGTATGTATGTAGG + Intronic
1055937107 9:81613631-81613653 TTGTGTGGATTTATGAAAATTGG - Intronic
1056133751 9:83610182-83610204 GGGTGTGAATGTCAGGAAGTAGG - Intergenic
1057068609 9:92076921-92076943 TTATCAGACTGTATGGAAGTAGG - Intronic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1059174186 9:112154315-112154337 TTGTGTGTGTGTGTGGAGGTGGG - Intronic
1059935128 9:119302726-119302748 TTGTGTGTGTGTTTTGAAGTAGG - Intronic
1060364336 9:122994149-122994171 TCATGTGAATGTATCCAAGTAGG - Intronic
1060386331 9:123232503-123232525 TTTTGTGAATGGAATGAAGTAGG - Intronic
1060533975 9:124368180-124368202 TTGGGTAAATGTGTGGAATTGGG - Intronic
1061244707 9:129395492-129395514 ATGGGTGAATGAATGGAAGATGG + Intergenic
1061541948 9:131282361-131282383 TTGTGTGAGGGGATGAAAGTGGG + Intergenic
1061636438 9:131912877-131912899 TAGTCTGATTGTATGGAAGTGGG - Intronic
1186058009 X:5672139-5672161 TTGTGTTATTGTATGCAATTTGG - Intergenic
1188501377 X:30830841-30830863 TTGTGTGCATGTATGTGTGTTGG + Exonic
1189109714 X:38276169-38276191 ATGTGTGAATGATTGAAAGTTGG - Intronic
1189862818 X:45290835-45290857 ATGTGTGGGTGTATGGAGGTGGG + Intergenic
1190709003 X:53051988-53052010 TTCTGTGAATGTCTGTATGTGGG + Intronic
1190709495 X:53056294-53056316 TTGGGTATATGTATGAAAGTAGG + Intronic
1191800231 X:65071345-65071367 TGGTGTCATTGTATGGAAGATGG + Intergenic
1191971186 X:66817922-66817944 AAGTGTGAAAGTATGAAAGTGGG - Intergenic
1192857081 X:75023685-75023707 GTGTGTCAATGTATGTAAGATGG + Intergenic
1192927938 X:75776308-75776330 TTGTGTGAATGCATGCATGGAGG - Intergenic
1193538924 X:82746999-82747021 TTGTGTGTATGTATGTATATGGG - Intergenic
1197095485 X:122589598-122589620 TTGTGTGACTGACTGGGAGTTGG - Intergenic
1197590855 X:128408256-128408278 GTGTGTGGATGTATGGGTGTAGG + Intergenic
1198238658 X:134761994-134762016 TAGAGTGAATGACTGGAAGTGGG - Intronic
1198460855 X:136861723-136861745 GTGAATGAATGTATGGGAGTGGG + Intronic
1198574862 X:137998827-137998849 TTGTGTGTATGTGTGGCAGGTGG - Intergenic
1199381935 X:147181575-147181597 TTGTGTGAAGGAATGAAAGGAGG + Intergenic
1199877706 X:151947908-151947930 ATGTGAGAATATTTGGAAGTGGG + Intergenic
1200398436 X:156004732-156004754 TTATGTGTGTGTATGGGAGTAGG + Intronic
1201672922 Y:16544518-16544540 TAGTGTAAGTGTATGGAAGTGGG + Intergenic