ID: 908525952

View in Genome Browser
Species Human (GRCh38)
Location 1:64987516-64987538
Sequence GAAGAATTGTTTGCCTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908525952 Original CRISPR GAAGAATTGTTTGCCTGGTG TGG Intergenic
900722194 1:4184239-4184261 TAAGAACTATTTGCCTTGTGTGG + Intergenic
902481527 1:16714597-16714619 GAAAAATAGTTAGCCGGGTGTGG - Intergenic
906540096 1:46578740-46578762 AAAAAAATGTTAGCCTGGTGTGG - Intronic
906684129 1:47752116-47752138 GAAGAGGTGTTTGCCTGCAGTGG - Intergenic
907176592 1:52529001-52529023 GAAGAATTATTGGCCAAGTGTGG - Intronic
908525952 1:64987516-64987538 GAAGAATTGTTTGCCTGGTGTGG + Intergenic
908541653 1:65128135-65128157 GAATAACTGTTGGCCGGGTGTGG - Intergenic
911147636 1:94568012-94568034 TAAGAACTATTTGCCTTGTGTGG + Intergenic
913288797 1:117252898-117252920 GAACAATTGTTGGCCTGGCACGG - Intergenic
914922189 1:151854680-151854702 GAAGAGGTGTTGGCCGGGTGCGG - Intergenic
915450123 1:155999060-155999082 GAATAATGCTTGGCCTGGTGTGG + Intronic
915707945 1:157864232-157864254 TAAGAACTGTGGGCCTGGTGAGG - Intronic
915962182 1:160276014-160276036 GCAGAATTGCTTGCTTGTTGAGG + Intergenic
916395938 1:164387257-164387279 CAGGAATTGTGGGCCTGGTGTGG - Intergenic
916803260 1:168233991-168234013 GAAGACTTATTGGCCGGGTGTGG + Intronic
917868280 1:179218686-179218708 GAAGAGTACTTGGCCTGGTGTGG - Intronic
919089845 1:192964952-192964974 AAAGAATTTTAGGCCTGGTGTGG + Intergenic
921145668 1:212353687-212353709 TAAGAATTGTTTTTTTGGTGGGG - Intronic
921224306 1:213002625-213002647 TAAAAATTGTTGGCCAGGTGCGG + Intronic
922235929 1:223722578-223722600 TAAAAATTATTTGCCAGGTGTGG - Intronic
922521815 1:226259248-226259270 TAAGTATTGTTGGCCGGGTGTGG - Intronic
923293301 1:232568371-232568393 GATTAATTGCTTGCTTGGTGTGG + Intergenic
923441652 1:234026590-234026612 GAAGGCTTGTTAGCCAGGTGTGG + Intronic
924118743 1:240774467-240774489 GAAGTATTTTGTGCCAGGTGCGG - Intergenic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924636332 1:245791119-245791141 GAGGAATTGCTTGTCTGGTAGGG - Intronic
1064725648 10:18276959-18276981 AAAAAATTATTAGCCTGGTGTGG + Intronic
1065016385 10:21466561-21466583 TAAGAATTGTTGGCCAGGCGCGG + Intergenic
1065437980 10:25721162-25721184 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1066533440 10:36365131-36365153 GAATAATTATTGGCCGGGTGCGG - Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067421462 10:46154268-46154290 GAAGAATTGTTTGGAGTGTGGGG + Intergenic
1067506799 10:46860727-46860749 GAAGAATTGTTTGGAGTGTGGGG + Intergenic
1067533860 10:47093914-47093936 GGAGAATTCTTTGCCTGGTGGGG + Intergenic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069989274 10:72304600-72304622 GAAAAAATATTTGCCGGGTGCGG - Intergenic
1070281581 10:75052740-75052762 GAAGAATAGTTGGCCAGGCGTGG - Intronic
1073357302 10:102867289-102867311 TAAGGATTGTTGGCCAGGTGTGG + Intronic
1074348029 10:112707322-112707344 AAAAAATAGTTAGCCTGGTGTGG - Intronic
1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG + Intronic
1075897737 10:126012239-126012261 GAAGAATGGTTGGCAGGGTGGGG - Intergenic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1078675408 11:13408022-13408044 GAAGAATTGATGGGCTGGGGTGG - Intronic
1079346814 11:19660032-19660054 CAAGAGTTGTTTGCCTGGAAAGG - Intronic
1079478818 11:20859423-20859445 TAAGATTTGTATGCCTTGTGTGG + Intronic
1079835669 11:25329432-25329454 TAAGAATGATTTGCCTTGTGTGG + Intergenic
1081367373 11:42252115-42252137 GCAGGTTTGGTTGCCTGGTGAGG - Intergenic
1082162692 11:48901501-48901523 GAAGAACAGGTTTCCTGGTGAGG - Intergenic
1082238729 11:49851233-49851255 GAAGAACAGGTTTCCTGGTGAGG + Intergenic
1082243414 11:49893094-49893116 GAAGAACAGGTTTCCTGGTGAGG - Intergenic
1082657910 11:55873920-55873942 GAAGAACAGGTTTCCTGGTGAGG - Intergenic
1084161364 11:67352217-67352239 TAAGAATTATTGGCCGGGTGTGG + Intronic
1084354574 11:68629077-68629099 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1085988361 11:81810914-81810936 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1086690682 11:89786588-89786610 GAAGAACAGGTTTCCTGGTGAGG + Intergenic
1086697840 11:89864918-89864940 GAAGAACAGGTTTCCTGGTGAGG - Intergenic
1086708322 11:89979570-89979592 GAAGAACAGGTTTCCTGGTGAGG + Intergenic
1086715119 11:90053072-90053094 GAAGAACAGGTTTCCTGGTGAGG - Intergenic
1087391115 11:97536675-97536697 AAAGAATTTTTGGCCAGGTGTGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087934735 11:104019040-104019062 AAAGAAGAGTTTTCCTGGTGAGG - Intronic
1088439145 11:109849083-109849105 GAAGAAGGTTTTGCATGGTGGGG + Intergenic
1088693083 11:112344355-112344377 GAGAAATTGATTGGCTGGTGAGG - Intergenic
1093134797 12:15437593-15437615 GAATACCTGCTTGCCTGGTGTGG + Intronic
1095637961 12:44454284-44454306 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1097064242 12:56309113-56309135 TAAGAATTTTCTGCCAGGTGCGG + Intronic
1097745097 12:63292855-63292877 GAAGCATGGTTTGCCCAGTGTGG - Intergenic
1099654674 12:85474521-85474543 TTAGAATTGTTTGACTGGTTTGG + Intergenic
1101141880 12:101803884-101803906 AAAGATTTGTTTGCCAGTTGGGG + Intronic
1103347877 12:120263468-120263490 GAAGACTTTTTTTCCTGGGGAGG - Intronic
1106222716 13:27760043-27760065 GAAGAATGGCTGGCCGGGTGCGG - Intergenic
1106387520 13:29302307-29302329 GAAGCATGGTTTTCCAGGTGGGG - Intronic
1107702402 13:43061210-43061232 CAAGAACTATTTGCCTTGTGTGG + Intronic
1108054534 13:46472692-46472714 GAAGAAATGTTTACAAGGTGTGG - Intergenic
1108518572 13:51224176-51224198 AAAGAATTCTTGGCCAGGTGCGG + Intronic
1108638757 13:52362075-52362097 TAAGAATTGTTGGCCAGGCGCGG - Intergenic
1108792630 13:53990146-53990168 GAAGAATTGTTTTGCTAGTGTGG + Intergenic
1109504702 13:63285169-63285191 GAAAAATTATTGGCCGGGTGCGG - Intergenic
1113285704 13:108845997-108846019 TAAGAATATTTTGCCAGGTGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1114860127 14:26506868-26506890 GAACAGTTGTTGGCCTGGCGCGG - Intronic
1115679470 14:35720040-35720062 TAAGAATTGTTGGCCGGGCGCGG - Intronic
1118015481 14:61656062-61656084 GAGGAATTGTGTGCTGGGTGCGG - Intronic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118914231 14:70088454-70088476 GAAGCATTGATAGCCTGATGGGG - Intronic
1119247705 14:73127132-73127154 AAAGGATTATTTGCCGGGTGCGG - Intergenic
1119559948 14:75581970-75581992 CAAGAACCGTTTGCCTTGTGTGG + Intronic
1120816181 14:88861092-88861114 AAAGAATTTTTAGCCGGGTGTGG - Intronic
1122341071 14:101028848-101028870 CAATAATTGTTTTCATGGTGGGG - Intergenic
1122508005 14:102244327-102244349 CAAGAACTATTTGCCTTGTGTGG - Intronic
1123882218 15:24687093-24687115 TAAGAACCGTTTGCCTTGTGTGG + Intergenic
1124839120 15:33225495-33225517 TAAGAATTGTTTTCCTGGCCAGG - Intergenic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1128475041 15:67990282-67990304 TAAGATTTTTTTGCCTGGTATGG + Intergenic
1129066592 15:72909873-72909895 AGAGAATAGTTTGCGTGGTGTGG - Intergenic
1129422417 15:75439633-75439655 GAAGCATTGATGGCCGGGTGCGG - Intronic
1133869217 16:9672301-9672323 TAAGAACTATTTGCCTTGTGTGG + Intronic
1137363793 16:47843268-47843290 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1138326742 16:56178498-56178520 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
1139022801 16:62772775-62772797 GAAGGTTTGTCTGTCTGGTGAGG + Intergenic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140425912 16:74861143-74861165 GAAGAATTACTGGCCGGGTGTGG - Intergenic
1141689209 16:85587034-85587056 GCAGAATTGTGTGTGTGGTGGGG + Intergenic
1141790352 16:86230187-86230209 GAAAAACTGTTTGCCTGACGGGG - Intergenic
1142221639 16:88857695-88857717 GCAGAATTGTTTGGTTGGAGCGG - Intronic
1142340222 16:89517149-89517171 GAAGAATTGTGTGGCCTGTGCGG + Intronic
1143333493 17:6155535-6155557 CCAGAATTGGTTGCCTGTTGTGG + Intergenic
1143665399 17:8355684-8355706 TAAGAATTCTTTGCCTGCTGAGG - Intergenic
1144369951 17:14580701-14580723 GATGACTTGGTTCCCTGGTGTGG + Intergenic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145111134 17:20162440-20162462 GAAAAATTATTTGCCTGGGCCGG - Intronic
1146034336 17:29391924-29391946 GAAGAATTATTGGCCTGGCGCGG + Intronic
1147047262 17:37762503-37762525 GAAGAGTTATTGGCCAGGTGAGG + Intergenic
1149108919 17:53002632-53002654 GTAGATTTGTTTGGGTGGTGTGG - Intergenic
1152003969 17:77665611-77665633 TACGAGCTGTTTGCCTGGTGAGG + Intergenic
1153407394 18:4756500-4756522 GATTAGTTGTTTGCCTGGGGTGG - Intergenic
1153568007 18:6439547-6439569 AAAGAATATTTGGCCTGGTGTGG + Intergenic
1155143893 18:23067929-23067951 GAAAAATTTTTAGCCAGGTGTGG - Intergenic
1155145667 18:23081467-23081489 TAAGAAATGATTGCCGGGTGCGG + Intergenic
1156555310 18:38061193-38061215 GAAGAATTGATTTCCTGGGATGG + Intergenic
1156930065 18:42630778-42630800 GAAGAATTGCTCCCATGGTGTGG + Intergenic
1158503625 18:58026560-58026582 GAAGAGTTATTTGCCTTGAGGGG + Intergenic
1158685742 18:59612726-59612748 TAAGAATTGTCTGCATGGGGCGG - Intronic
1160996332 19:1883773-1883795 GAAAGATTGTTTGGCTGCTGGGG - Intronic
1162556387 19:11388777-11388799 GAAGAAAAATTAGCCTGGTGTGG + Intronic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163776409 19:19220746-19220768 AAGGAATTGGTTGCCAGGTGCGG - Intronic
1163930283 19:20383652-20383674 GAAAAATTTTTGGCCAGGTGCGG - Intergenic
1163944127 19:20520266-20520288 CAAGAATCATTTGCCTTGTGTGG + Intergenic
1164081173 19:21862663-21862685 CAAGAATCATTTGCCTTGTGTGG - Intergenic
1164489322 19:28692253-28692275 GAAGAATTGTTTGGGTGGCCAGG + Intergenic
1165722202 19:38087590-38087612 GAAGAACTATTTGCCTGGAAGGG + Intronic
1167016851 19:46846600-46846622 GGAGACTTGTTTTGCTGGTGAGG - Intronic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
1202715566 1_KI270714v1_random:40508-40530 GAAAAATAGTTAGCCGGGTGTGG - Intergenic
924972813 2:145029-145051 GAATAGATGTTTGCCAGGTGGGG + Intergenic
925292372 2:2756303-2756325 GAAGAACTGTGTGGCTGGTGGGG - Intergenic
925559861 2:5179591-5179613 GCTGATTTGTTTTCCTGGTGAGG + Intergenic
926791664 2:16578010-16578032 GAACAACTGTCTGCCTGGTGAGG + Intronic
927091854 2:19718532-19718554 GAAGAATTGTTTTCATGAAGTGG - Intergenic
929700670 2:44160185-44160207 GAATAATTCTTGGCCAGGTGCGG - Intergenic
932557119 2:72834245-72834267 GAAAAGTTGTTTGTCTGGAGTGG - Intergenic
933913440 2:86964445-86964467 GAAGGATTTTTTGCTTGGGGAGG + Intronic
934009554 2:87805453-87805475 GAAGGATTTTTTGCTTGGGGAGG - Intronic
934025905 2:88001354-88001376 TAAGAATTCTTGGCCTGGCGCGG - Intergenic
934140223 2:89039792-89039814 AAAGAAATATTTGCCAGGTGGGG - Intergenic
934229011 2:90160745-90160767 AAAGAAATATTTGCCAGGTGGGG + Intergenic
934588389 2:95525973-95525995 GAAGAACAGGTTTCCTGGTGAGG + Intergenic
934741917 2:96730374-96730396 GAAGGATTGTGTTCCTGTTGAGG - Intronic
935993326 2:108741926-108741948 GAAGGATTTTTTGCTTGGGGAGG + Intronic
936128725 2:109814907-109814929 GAAGGATTTTTTGCTTGGGGAGG + Intronic
936215972 2:110556578-110556600 GAAGGATTTTTTGCTTGGGGAGG - Intronic
936329423 2:111534974-111534996 GAAGAGTGGTTTTCATGGTGAGG - Intergenic
936425111 2:112411151-112411173 GAAGGATTTTTTGCTTGGGGAGG - Intronic
936793980 2:116185499-116185521 TAAGAACTATTTGCCTTGTGTGG + Intergenic
936841155 2:116771121-116771143 GAAGAATAGTTAGCATGGAGTGG + Intergenic
937881587 2:126870777-126870799 GGAGACTTGTTTGCTTTGTGTGG - Intergenic
938629373 2:133149452-133149474 GAAGAGCTGTTTGTGTGGTGGGG - Intronic
939824277 2:146996040-146996062 AAAGAGTTGTTGGCCAGGTGCGG + Intergenic
940043132 2:149381063-149381085 GGAGAATTGTTTGGGTGGTGTGG + Intronic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
941117941 2:161493405-161493427 GAATAATTATAGGCCTGGTGTGG + Intronic
942582175 2:177430539-177430561 GAAGTGTGGTTTCCCTGGTGGGG + Intronic
943061880 2:183048271-183048293 CAAGAACTATTTGCCTTGTGTGG - Intergenic
944091780 2:195919633-195919655 GTAGACTTTTTGGCCTGGTGTGG - Intronic
945336327 2:208597184-208597206 GAAAAATTGTTTCTCTGCTGAGG + Intronic
945361955 2:208903723-208903745 TAAGAACTATTTGCCTTGTGTGG - Intergenic
946696552 2:222365735-222365757 GAAGAATTGTTAGACTATTGAGG + Intergenic
948804938 2:240449521-240449543 GAAGAGTTGTTTGCTTTTTGTGG + Exonic
1169089502 20:2850029-2850051 AAAGAATTATTGGCCTGGTGTGG + Intronic
1169291360 20:4355817-4355839 GAAGAATAGATTGGCTGGAGTGG - Intergenic
1169782376 20:9323441-9323463 GATGAATTAATTCCCTGGTGGGG - Intronic
1169948269 20:11012926-11012948 GAAAAATTGTTTTCCTGTAGAGG + Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1170257932 20:14366653-14366675 CAAAAATTGTTGGCCGGGTGTGG - Intronic
1171317738 20:24210226-24210248 GCAGATTTGGTTGTCTGGTGAGG + Intergenic
1172812382 20:37657914-37657936 GAATAATTGTTTCCCTTGGGAGG - Intergenic
1173039044 20:39443002-39443024 GCAGATTTGGTTGTCTGGTGAGG + Intergenic
1173303479 20:41825948-41825970 TAACAATTGTTTCCTTGGTGTGG - Intergenic
1173675334 20:44829675-44829697 GAAGAATTGTCTGCCTGAAAAGG + Intergenic
1173984270 20:47248867-47248889 GAAGCAGGGTTTGCCCGGTGGGG + Intronic
1174359820 20:50021505-50021527 GAAGAATTCTTTGACTTGTGTGG + Intergenic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1176006088 20:62863249-62863271 GAAGTAATGATTGCCAGGTGAGG + Intergenic
1177786936 21:25681685-25681707 AAAGAATTGCTTGCCTGGCCGGG + Intronic
1178681022 21:34671824-34671846 TAAGAATTGTTTGGGTGGCGAGG + Intronic
1179216793 21:39374412-39374434 GAAAGATTGTTGGCCAGGTGCGG + Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1182091354 22:27597067-27597089 GAAGACTGGATTGTCTGGTGTGG - Intergenic
1182407428 22:30148355-30148377 AAATAAGTGTTTGCCTGGTGTGG + Intronic
1183973524 22:41496486-41496508 GAAGAAATGATTGCTTGGAGAGG + Intronic
1184464813 22:44662606-44662628 GGAGCAGTGTTTGCCTGGGGAGG + Intergenic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
952168627 3:30779903-30779925 GAAGGAATGCTTTCCTGGTGTGG + Intronic
952343261 3:32462687-32462709 TAAGAACTATTTGCCTTGTGTGG + Intronic
952894834 3:38071501-38071523 TAAGAACTATTTGCCTTGTGTGG + Intronic
954068173 3:48123558-48123580 CAAGAAATGTATGCCAGGTGCGG - Intergenic
955972245 3:64447060-64447082 GAAAAGGTGTTTGCCTGGAGTGG + Intergenic
956460124 3:69463175-69463197 GAAGAGTGGATTGACTGGTGAGG - Intronic
957232954 3:77544598-77544620 GAAGAATTGGTTGCGTGTTTGGG + Intronic
957548410 3:81670639-81670661 TTAGAATTGTTTGGCTGGTAAGG - Intronic
960039359 3:113133916-113133938 GAAGACTGGTTTACCTGGAGAGG + Intergenic
960622924 3:119653765-119653787 AAAGAATTGCTTGCCGGGCGCGG - Intronic
963617054 3:147554017-147554039 TAGAAATTATTTGCCTGGTGGGG - Intergenic
964125132 3:153227893-153227915 TAAGAACTATTTGCCTTGTGTGG + Intergenic
964459082 3:156901972-156901994 AAAGAATCATTGGCCTGGTGTGG - Intronic
964704421 3:159602866-159602888 GAAGTGTTGCTTGCTTGGTGTGG - Intronic
966160578 3:176963212-176963234 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
966773726 3:183526015-183526037 AAATAATTTTTTGCCGGGTGCGG + Intronic
967300891 3:188010917-188010939 AAAGAATTGTGTTCCTGATGGGG - Intergenic
967909751 3:194532271-194532293 AAAGAATTATTTGGCGGGTGTGG - Intergenic
968314216 3:197709273-197709295 GAACAAATGTTTGCATGTTGAGG + Intronic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
969481684 4:7449801-7449823 GAAGAAATGTCTGGCTAGTGGGG - Intronic
969597369 4:8157058-8157080 GTAGCATTGGTTGCCTGGAGGGG - Intronic
971553226 4:27979810-27979832 TAAGAATCATTTGCCTTGTGTGG - Intergenic
972675232 4:41254098-41254120 GCAGAATTCTTAGCCAGGTGTGG - Intergenic
975297461 4:72750998-72751020 GAAGCATGGTTTCCCCGGTGGGG - Intergenic
975489792 4:74976047-74976069 AAAGCATGGTTTCCCTGGTGAGG - Intronic
976158657 4:82175316-82175338 CAATAATTGTTTGCATGGGGTGG - Intergenic
976229323 4:82824493-82824515 GAAGAATCCTTGGCCAGGTGTGG - Intronic
979351558 4:119649722-119649744 AAAGAATTATTTGAGTGGTGTGG + Intergenic
980172605 4:129307644-129307666 GAAGAATTTTTTCCCTTGTAAGG - Intergenic
982112130 4:152066388-152066410 GAGTAAATGTTTGTCTGGTGAGG - Intergenic
982225278 4:153159591-153159613 TAAGAATTTTTAGGCTGGTGTGG - Intronic
982246605 4:153358960-153358982 GGAAAATTGTGTGCGTGGTGAGG - Intronic
982396406 4:154920067-154920089 TAAGAACTATTTGCCTTGTGTGG + Intergenic
982519046 4:156390116-156390138 TAGCCATTGTTTGCCTGGTGGGG + Intergenic
982896819 4:160941068-160941090 AAAGAATTGTTGGCCAGTTGCGG + Intergenic
983056295 4:163102084-163102106 TAAGAATCATTTGCCTTGTGTGG + Intergenic
983719263 4:170826707-170826729 GAAGAGTTGTATGCCTGGTTTGG + Intergenic
984656628 4:182325858-182325880 AAAGAAATGCTTGCCTGGTGTGG - Intronic
984753930 4:183306820-183306842 TAAGAATTGTTATCCTGGTCGGG - Intronic
985007854 4:185552133-185552155 GAAGAATTCGTTGCCTGGAATGG + Intergenic
985078670 4:186243367-186243389 CAAGAATTATTTGCCTTGTGTGG + Intronic
986667011 5:10113152-10113174 GATGGATTCTTTACCTGGTGAGG - Intergenic
986673819 5:10166746-10166768 GAAGTAGTGTTCTCCTGGTGGGG - Intergenic
987196630 5:15533404-15533426 TAAGCATTGTTTACTTGGTGGGG + Intronic
987239615 5:15981694-15981716 GGAGAAGTCTTTGTCTGGTGTGG - Intergenic
987721718 5:21643215-21643237 GTAGATTTGGTTGTCTGGTGAGG + Intergenic
990400367 5:55431414-55431436 TGAGAATAGTTTGGCTGGTGGGG - Intronic
992470870 5:77052060-77052082 TAAGAATTTTTGGCCAGGTGTGG + Intronic
992753780 5:79885645-79885667 GGAGAATTGTGTGACTGGTGTGG - Intergenic
992760764 5:79949356-79949378 TAAGAATTATTGGCCGGGTGCGG + Intergenic
992809293 5:80370699-80370721 GAGGAATTGTTTGCATGGCCTGG + Intergenic
994778624 5:104065411-104065433 TAAGAACTATTTGCCTTGTGTGG + Intergenic
994866469 5:105278958-105278980 GAAAAATTGGTTTCCAGGTGTGG + Intergenic
995526713 5:113055889-113055911 GAAGAATTTTTTCCCTTTTGGGG - Intronic
995882326 5:116857055-116857077 GAAGAATTGTTTTCTTGATAGGG + Intergenic
995985282 5:118163660-118163682 GGAGAATTGTATGACTGGTCTGG + Intergenic
996435054 5:123424846-123424868 GAAGACTTTTTGGCCAGGTGTGG + Intergenic
996725453 5:126669993-126670015 CAAGAACTGTTTGCCTTGTGTGG + Intergenic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
996921003 5:128767785-128767807 GAAGAATTGTTGGGCTGTTAAGG - Intronic
999041152 5:148414161-148414183 GAAGTATGGTTTGGCTGATGTGG + Exonic
1000388371 5:160697583-160697605 GAAGAAATGTATGCAGGGTGGGG + Intronic
1000438876 5:161244453-161244475 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1000440067 5:161253246-161253268 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1001715953 5:173816176-173816198 GATGATTTATTTGGCTGGTGAGG - Intergenic
1001759495 5:174195463-174195485 GAAATATTGCTTGCCTGGTGTGG - Intronic
1002007196 5:176245009-176245031 TAAGAAATGTTGGCCGGGTGCGG - Intronic
1002219184 5:177665613-177665635 TAAGAAATGTTGGCCGGGTGCGG + Intergenic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1004084230 6:12428842-12428864 GAAGAAATTATGGCCTGGTGCGG - Intergenic
1006241180 6:32680177-32680199 AAAGCATGGTTTCCCTGGTGGGG + Intergenic
1006730947 6:36235812-36235834 GAAGAATGGGGTCCCTGGTGAGG + Intergenic
1009749932 6:67869876-67869898 CAAGAACTATTTGCCTTGTGTGG + Intergenic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1011562202 6:88631714-88631736 GAAGATCTGTTTGCCTGCAGTGG + Intronic
1013163747 6:107571046-107571068 GGGGAATTCCTTGCCTGGTGAGG + Intronic
1013591543 6:111623104-111623126 AAAGATTTGTTAGCCAGGTGTGG - Intergenic
1013743674 6:113319462-113319484 GAAGTATTATTGGCCAGGTGTGG + Intergenic
1016594465 6:145783831-145783853 GCAGATTTGGTTGTCTGGTGAGG + Intergenic
1017112655 6:150947439-150947461 GAAGATTTCTTGGCTTGGTGTGG + Intronic
1017926911 6:158918445-158918467 AAAGAACTGTTGGCCGGGTGCGG - Intergenic
1021173044 7:17418580-17418602 CAAGAACTATTTGCCTTGTGTGG - Intergenic
1021995136 7:26171803-26171825 GAAGAATTGTTTGACTAGCCTGG + Intronic
1023478500 7:40607028-40607050 GTAAAATTGTTTTCCAGGTGAGG + Intronic
1024273969 7:47662616-47662638 GAAGAATTGGTCTCCTGGTCAGG - Intergenic
1026016657 7:66676752-66676774 AAAAAATTGTTTGCATGGAGGGG + Intronic
1026049231 7:66931010-66931032 GATGAATGGTGGGCCTGGTGTGG + Intronic
1026276646 7:68884352-68884374 GAAGAATTTTGGGCTTGGTGTGG - Intergenic
1027168442 7:75852830-75852852 GAAGAATTATCTGCCTGGCATGG - Intronic
1028414951 7:90569771-90569793 GAAGAATTATTTTCTTTGTGAGG + Intronic
1028903459 7:96126574-96126596 GAAGAATAGAATGCCTGGGGTGG - Intronic
1029453194 7:100654260-100654282 TAAAAATTTTTTGCCGGGTGTGG - Intronic
1030062972 7:105637765-105637787 GAAGAGTAGCTTTCCTGGTGTGG + Intronic
1030818515 7:114067050-114067072 AAAGAATTGTGTGTGTGGTGTGG - Intronic
1030958526 7:115886268-115886290 GAAGAACTCTTGGCCGGGTGCGG + Intergenic
1031745793 7:125495912-125495934 GAAGATTTTTTCGCCGGGTGTGG - Intergenic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1035145460 7:156811314-156811336 TAAGAATTGTTTTCCTGGCCAGG + Intronic
1035160654 7:156948222-156948244 AAAGAATTCCTTGCCGGGTGTGG + Intergenic
1037703300 8:21295164-21295186 GAAGAAGTGTGTTCCAGGTGGGG + Intergenic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1037915098 8:22768397-22768419 GAAGCATTTATTGCCTGGGGTGG + Intronic
1040498439 8:47987148-47987170 GAATAATTTGCTGCCTGGTGCGG + Intergenic
1040864035 8:52030225-52030247 GAAGAATTGGTAGCTTGATGGGG - Intergenic
1041667634 8:60461365-60461387 GAAGAGGTAGTTGCCTGGTGAGG + Intergenic
1043011021 8:74881892-74881914 GAAGAATTGTGTCACTGGTTAGG - Intergenic
1043838040 8:85067411-85067433 TAAGAACTATTTGCCTTGTGTGG - Intergenic
1044262498 8:90143059-90143081 GAAGGTTTGTCTGCCTGCTGAGG + Intergenic
1044619595 8:94176042-94176064 AAATAATAGTTTGCCAGGTGTGG - Intronic
1045236744 8:100358833-100358855 GAAAAATTTTTGGCCTGGCGTGG + Intronic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1046281326 8:112035950-112035972 TAAAAATTATTTGCCAGGTGTGG - Intergenic
1046417043 8:113931161-113931183 GAAGAATAGTTTAACTGTTGAGG + Intergenic
1048026162 8:130588814-130588836 GGAGAATTGTTTCCCTGTGGAGG - Intergenic
1050225977 9:3455996-3456018 GCAGATTTGGTTGTCTGGTGAGG + Intronic
1051021678 9:12552523-12552545 GAAAAATCTTATGCCTGGTGAGG + Intergenic
1052515405 9:29473006-29473028 GAAGCATGGTTTCCCAGGTGGGG + Intergenic
1052560014 9:30073400-30073422 AAATAATTATTTGCCTGGCGAGG - Intergenic
1052914534 9:33914542-33914564 AAAGAATTGGCTGCCTGGTGTGG + Intronic
1055067734 9:72135637-72135659 TAAGAATAGTTGGCCTGGCGCGG + Intronic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1056176432 9:84041186-84041208 GAAAAAATGTTGGCCAGGTGTGG - Intergenic
1059412449 9:114141096-114141118 GGAGGATTGTTTGCCTGGGATGG - Intergenic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060361523 9:122963116-122963138 GAATAATTGTTAGCCGGGCGTGG + Intronic
1187162066 X:16774112-16774134 CAAGAATTGTCAGCCTGGCGTGG + Intergenic
1187519956 X:20004351-20004373 TAAGAATTGAATGCATGGTGGGG - Intergenic
1188318870 X:28710520-28710542 GAAAAATGGTATGGCTGGTGTGG + Intronic
1188526226 X:31090816-31090838 TAAGAATGTTTGGCCTGGTGAGG + Intergenic
1189521049 X:41768675-41768697 AAAGAATTCTTCGCCAGGTGTGG + Intronic
1189863491 X:45298025-45298047 GAAGAATGGTGTGATTGGTGAGG - Intergenic
1190271729 X:48869525-48869547 AAAGAATTTTCTGCCGGGTGCGG + Intergenic
1190327922 X:49218194-49218216 GAATAAGTGTTTGCCGGGTGGGG + Intronic
1190689596 X:52902348-52902370 GAAGAAATGTGAGCCGGGTGTGG - Intronic
1190696387 X:52953444-52953466 GAAGAAATGTGAGCCGGGTGTGG + Intronic
1190805079 X:53827371-53827393 GAAGAATGATTAGCCAGGTGCGG - Intergenic
1191617343 X:63183311-63183333 GAATTTTTGTTTGCCTAGTGTGG + Intergenic
1191618955 X:63195612-63195634 GAATTTTTGTTTGCCTAGTGTGG - Intergenic
1192464551 X:71344947-71344969 AAATAATTGTTGGCCGGGTGCGG - Intergenic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1192919885 X:75695617-75695639 GGACAACTGTTAGCCTGGTGGGG - Intergenic
1193179926 X:78442552-78442574 GAAGGAATGTTTTCCTGGTTTGG - Intergenic
1195225260 X:102785638-102785660 GAAGAATAGTTGGCTGGGTGTGG - Intergenic
1195379623 X:104257896-104257918 GAAAAATTGTTCGCCGGGTATGG - Intergenic
1195931696 X:110084211-110084233 CAAGAATAGTTGGCCAGGTGTGG + Intronic
1198344225 X:135743546-135743568 AATGAATTGTTTGCCGGGCGCGG - Intergenic
1199174979 X:144776866-144776888 GGAGAATTGTTTGCTTAGTGTGG - Intergenic
1201233927 Y:11892131-11892153 TAAGAATCATTTGCCTTGTGTGG + Intergenic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic
1201327457 Y:12778734-12778756 GGAAAGTTGTTTGCCTGGGGTGG + Exonic
1201937496 Y:19423905-19423927 TAAGAACTATTTGCCTTGTGTGG - Intergenic