ID: 908534636

View in Genome Browser
Species Human (GRCh38)
Location 1:65066702-65066724
Sequence CGGAGTCCCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908534636_908534645 16 Left 908534636 1:65066702-65066724 CCGCCGCCGCCGCGGGGACTCCG 0: 1
1: 0
2: 2
3: 44
4: 354
Right 908534645 1:65066741-65066763 CCTCCCTCCTCCTCCTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908534636 Original CRISPR CGGAGTCCCCGCGGCGGCGG CGG (reversed) Intergenic
900237611 1:1600158-1600180 CGGACCCGGCGCGGCGGCGGAGG + Intergenic
900511305 1:3062331-3062353 CGGTGTACTGGCGGCGGCGGGGG + Intergenic
901086093 1:6613392-6613414 GGGAGTCGCTGCGGCGGTGGGGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901526015 1:9823867-9823889 CAGCGTCACGGCGGCGGCGGCGG - Exonic
902480364 1:16708211-16708233 CGGAGCCCCCCGGGCGGCAGCGG - Intergenic
902586065 1:17439115-17439137 CGGACTGCCCCCGGCGACGGGGG + Intronic
903069053 1:20717742-20717764 GGGAGTCCCCGGCGGGGCGGGGG - Exonic
903153287 1:21428210-21428232 CGGAGCGCGGGCGGCGGCGGAGG + Intergenic
903398412 1:23020015-23020037 CCAAGACCCGGCGGCGGCGGGGG - Intronic
904500202 1:30908789-30908811 GGGCGGCCCGGCGGCGGCGGCGG - Intergenic
904641985 1:31938051-31938073 CTCAGTCACCTCGGCGGCGGCGG + Exonic
905067128 1:35193009-35193031 CGGAGTCGTGGCGGTGGCGGTGG - Exonic
905179267 1:36156372-36156394 CGGGGTCTCAGCGGCGGCGGCGG - Exonic
905399695 1:37692346-37692368 AGGAGTACCCGCGACGGCGGCGG + Intergenic
905889527 1:41510704-41510726 CGGCGTCCCTGGGGCGGCCGGGG + Exonic
906960914 1:50419091-50419113 CCCAGGCCCCCCGGCGGCGGCGG + Exonic
908401134 1:63774061-63774083 CGGGGCTCCCTCGGCGGCGGCGG - Exonic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
908796225 1:67833364-67833386 CCGAGTCCCGGCGGCGACGGCGG - Exonic
909001379 1:70221476-70221498 CGGAGAAACGGCGGCGGCGGCGG + Intronic
910251375 1:85201520-85201542 CGGGGTCCCCGCGGCACCGGGGG - Intergenic
912246279 1:107964927-107964949 CGGAGGAACCGCGGCGGCGGCGG - Exonic
917846669 1:179025958-179025980 CGGAGCCGCTGTGGCGGCGGCGG + Exonic
918056136 1:181023197-181023219 CGGAGCCCTCGGGGCGGTGGAGG + Intergenic
919892001 1:201982575-201982597 CGGGGCCCGCGCGGCGGGGGCGG + Intronic
921909068 1:220528222-220528244 CTGAGGCGCGGCGGCGGCGGTGG + Intronic
922621928 1:226995176-226995198 GGGAGTCCCCGTGGCTGGGGTGG - Intronic
922730718 1:227947705-227947727 CGGAGTCCCCGAGGCACCCGGGG - Intronic
923056005 1:230426255-230426277 AGGAGACGCAGCGGCGGCGGTGG - Intergenic
923181925 1:231528304-231528326 CGGAGGTCCCGCTCCGGCGGAGG + Intergenic
923372330 1:233327320-233327342 CGGAGCACCTGCGGCGGGGGCGG + Intergenic
924740662 1:246792776-246792798 CGGAGCCCTCGCGGCGGCCCTGG + Intergenic
1064274202 10:13891779-13891801 CCGAGGGCCCGCGGCGGGGGCGG - Intronic
1065240182 10:23695989-23696011 CGGAGGACCCGCAGCGGCGCGGG - Intronic
1066080712 10:31928541-31928563 GGGAGGCGCGGCGGCGGCGGCGG - Intronic
1066464207 10:35639460-35639482 GGGGGACCCGGCGGCGGCGGGGG - Exonic
1067071897 10:43138518-43138540 GGGTGTCCCCGCGGCGCAGGAGG + Exonic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1069386114 10:67884757-67884779 CGGCTCCCCCTCGGCGGCGGGGG + Exonic
1070800838 10:79243565-79243587 CCGCGCCCCGGCGGCGGCGGCGG - Intronic
1071695382 10:87863915-87863937 CTGAGGCGCGGCGGCGGCGGCGG + Exonic
1071997522 10:91162885-91162907 AGCAGAGCCCGCGGCGGCGGCGG - Intergenic
1072021842 10:91410305-91410327 CGGAGTGGCGGCGGCAGCGGCGG + Exonic
1072059739 10:91798475-91798497 CGGCTGCCCCGCGGCGGCGGAGG - Exonic
1073025211 10:100482621-100482643 CGCAGTCCCCGCAGAGCCGGCGG - Exonic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1075748489 10:124744232-124744254 TGGCGGCTCCGCGGCGGCGGCGG - Intronic
1076869662 10:133187168-133187190 CAGCGTCCCCGCGGAGGCAGCGG - Intronic
1076908235 10:133373637-133373659 GGGAGACCGCGCGGAGGCGGAGG + Exonic
1078190832 11:9091559-9091581 CGGAGTGCGGGCGGTGGCGGCGG + Exonic
1083595547 11:63916960-63916982 CGGGGCACCGGCGGCGGCGGCGG + Intergenic
1083885752 11:65572730-65572752 CTGAGGCCGCGCGGCAGCGGTGG - Exonic
1084265623 11:68003880-68003902 CAGGGTCCCCCCGGCGGGGGCGG - Intronic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1086887835 11:92224973-92224995 CGAACCCCCGGCGGCGGCGGCGG + Intergenic
1087138110 11:94740504-94740526 CCGAGGGCGCGCGGCGGCGGCGG - Intronic
1087188816 11:95231177-95231199 CTGAGGCGCTGCGGCGGCGGTGG - Exonic
1089500738 11:118929877-118929899 GAGAGTCCCTGAGGCGGCGGTGG - Intronic
1089543665 11:119206282-119206304 CGGATAGCCGGCGGCGGCGGCGG + Exonic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1091823168 12:3491300-3491322 CGAAGCCTCCGCGGCGGCGGCGG - Exonic
1091823372 12:3492214-3492236 CGGAGAGCCCCCGGCCGCGGGGG + Intronic
1096459554 12:51814630-51814652 CGGGGTCTCCGAGCCGGCGGCGG - Intergenic
1096782764 12:54000557-54000579 CGCAGTCCGCGCGGCGCCCGGGG - Exonic
1096983735 12:55743391-55743413 CGAGGGCCCCGCGGCGGCGGCGG + Exonic
1097057425 12:56258295-56258317 CGAGCTCCCGGCGGCGGCGGCGG + Exonic
1098320717 12:69240154-69240176 CGGAGCCCGAGCGGCAGCGGCGG - Intronic
1100260579 12:92929081-92929103 GAGAGTCACCGCGGCGGCGCCGG - Exonic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1102853957 12:116277505-116277527 CGGCGGCTCCGAGGCGGCGGCGG - Intergenic
1102854054 12:116277795-116277817 CGGAGTGGCGGCGGCGGCGGCGG + Intergenic
1103080082 12:118016898-118016920 AGGAGGCCGAGCGGCGGCGGTGG + Intronic
1103363937 12:120369117-120369139 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
1103534765 12:121626832-121626854 CCCCGTCCCCGCTGCGGCGGCGG - Exonic
1103595356 12:122021819-122021841 CGCACTGCCGGCGGCGGCGGCGG + Exonic
1104031255 12:125066789-125066811 GGGAGTCCCTGCGCCAGCGGAGG - Intronic
1104049558 12:125186480-125186502 CGCAGGAGCCGCGGCGGCGGCGG + Intergenic
1104049559 12:125186483-125186505 AGGAGCCGCGGCGGCGGCGGCGG + Intergenic
1104957745 12:132474670-132474692 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957755 12:132474693-132474715 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957843 12:132474902-132474924 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957892 12:132475015-132475037 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104958066 12:132475410-132475432 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1106087647 13:26557785-26557807 CGCAGCCCCGGCGCCGGCGGCGG + Exonic
1107605240 13:42049233-42049255 CGGATTCCCGGCGGCTGCGCGGG + Intronic
1107624842 13:42272045-42272067 CGGAGCTGCGGCGGCGGCGGCGG + Intergenic
1111951314 13:94711543-94711565 GGGGCTGCCCGCGGCGGCGGCGG + Exonic
1112088209 13:96053535-96053557 CGGAGCCGCCGGGGCGGCGCCGG + Intergenic
1112091874 13:96091076-96091098 GGGGGCCCCCGGGGCGGCGGGGG - Exonic
1113480411 13:110616012-110616034 CGGAGCCCGCGCGGTGGCCGGGG + Intronic
1113655070 13:112062921-112062943 CGGTGTCTCCGCGAGGGCGGCGG + Intergenic
1113798529 13:113074570-113074592 CGGGGTCCCGGCGGGGGCGGCGG + Intronic
1114612520 14:24052097-24052119 CGGCTCCCCGGCGGCGGCGGCGG + Exonic
1115399356 14:32939522-32939544 CATTGTCCCCGCGGCGGCTGCGG + Intronic
1116820421 14:49621410-49621432 CGGGGTGCCGGCGGCCGCGGTGG + Exonic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1117251863 14:53946870-53946892 CCCAGGCCCGGCGGCGGCGGGGG - Intergenic
1117875882 14:60249592-60249614 GGGGGTCACCGCGGCGGCGACGG - Intronic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118749534 14:68795864-68795886 CGGCGTCCCCGCCGCGGTGAGGG + Intronic
1121050442 14:90816337-90816359 AGGGGGCGCCGCGGCGGCGGCGG - Exonic
1122183502 14:99971998-99972020 GGGCGACCCGGCGGCGGCGGCGG - Intronic
1122221236 14:100240063-100240085 CGGGGGCGCGGCGGCGGCGGCGG + Intronic
1122231200 14:100306976-100306998 CTGCGCGCCCGCGGCGGCGGTGG + Intergenic
1122418584 14:101561715-101561737 CGGGCTGCCCCCGGCGGCGGCGG - Exonic
1124966696 15:34437321-34437343 CCGGGTCCCCGCGGCGCCGCGGG + Intronic
1124983315 15:34583439-34583461 CGGGGTCCCCGCGGCGCCGCGGG + Intronic
1125717452 15:41827422-41827444 TGGAACTCCCGCGGCGGCGGGGG + Exonic
1126109419 15:45166958-45166980 CGGAAGCCGCGCGCCGGCGGAGG - Intergenic
1126823707 15:52529062-52529084 CGAAGTGGCTGCGGCGGCGGCGG - Intergenic
1128067903 15:64775710-64775732 CGGAGACCGCGCGGCGGGCGGGG - Intergenic
1128149850 15:65355899-65355921 CGGCGCACTCGCGGCGGCGGAGG + Intronic
1129333178 15:74838170-74838192 CGGAGCCCCCGGGCCGGAGGCGG - Exonic
1129540859 15:76346302-76346324 CCAATTCCCCGCAGCGGCGGCGG - Intergenic
1131694134 15:94856626-94856648 CGGAGCTGGCGCGGCGGCGGAGG + Intergenic
1131735472 15:95326951-95326973 CGGATTGGCCGCGGCGGCTGCGG + Intergenic
1132365128 15:101251573-101251595 CGGCGGGCCCGCGGCGGCGGCGG - Exonic
1132585786 16:705338-705360 CCGAGGCCCAGCGGCCGCGGGGG + Intronic
1132641874 16:981775-981797 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1132837234 16:1960069-1960091 AGGGGTGCCCGGGGCGGCGGGGG - Intronic
1133784415 16:8963574-8963596 GGCGGGCCCCGCGGCGGCGGCGG - Intronic
1136365296 16:29806677-29806699 CGGGGGCCCCGCTGCGGCCGAGG + Exonic
1137412927 16:48244630-48244652 GGCTGCCCCCGCGGCGGCGGCGG + Intronic
1139402832 16:66696260-66696282 CGGAGGCCCCGCAGCGGGGCGGG + Intronic
1139570252 16:67807044-67807066 CAGAGGCCCCCCCGCGGCGGGGG - Intronic
1139637120 16:68264516-68264538 CTGAGCTGCCGCGGCGGCGGCGG + Intronic
1140927764 16:79599916-79599938 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1141079237 16:81036044-81036066 CGCTGTCCCCGCGCCGCCGGCGG + Exonic
1141839633 16:86566660-86566682 CGGAGTCGCCGCGGAGGCCGGGG + Intergenic
1142136282 16:88453352-88453374 CCGAGCGGCCGCGGCGGCGGCGG + Exonic
1142610966 17:1109102-1109124 CGGGGTCCACGCAGCGGCGGCGG + Intronic
1142627858 17:1203616-1203638 CGGGCTCCTCGCAGCGGCGGCGG - Intronic
1142683107 17:1561967-1561989 GAGAGGCCCCGCGGCGGCCGAGG - Intronic
1143063357 17:4222215-4222237 CGGGGTCCGCGGGGCGGCGGGGG - Intronic
1143527264 17:7479698-7479720 CGGCCTCCTCTCGGCGGCGGCGG - Intronic
1143539757 17:7561990-7562012 AGGAGTGGCGGCGGCGGCGGTGG + Exonic
1143543610 17:7583461-7583483 CGGAGTCTCCGAGGTGGCGTTGG - Intergenic
1143590886 17:7885329-7885351 CGGGGTGGCGGCGGCGGCGGCGG - Intronic
1144109803 17:12020896-12020918 CCGAGCCCGAGCGGCGGCGGCGG + Exonic
1144816621 17:18039647-18039669 CGGCTCCCGCGCGGCGGCGGCGG + Exonic
1145248465 17:21284795-21284817 CGGAGGAGCAGCGGCGGCGGCGG - Exonic
1146183106 17:30709538-30709560 CGGCCCCCTCGCGGCGGCGGAGG - Intergenic
1146701171 17:34961574-34961596 CGGAGTCCGGGCGGAGGCGGAGG - Exonic
1147393446 17:40123166-40123188 CAGGGTCCCGGCGGTGGCGGTGG - Intronic
1147486369 17:40818916-40818938 GGCAGTTCCGGCGGCGGCGGCGG - Exonic
1148493471 17:48037820-48037842 CGGAGGCGGGGCGGCGGCGGCGG - Intronic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1149491023 17:57085344-57085366 CGGAGTCCGCGCGCCGCCGCCGG - Intronic
1149772309 17:59331682-59331704 CGGAGTGGCGGCCGCGGCGGTGG + Exonic
1150060689 17:62065725-62065747 CAGAGTCTCCTCAGCGGCGGAGG + Intergenic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1150108413 17:62478598-62478620 AGGGGACCCCGCGCCGGCGGAGG - Intronic
1150373525 17:64661941-64661963 CGGAGTCACCACAGCGGCCGGGG + Exonic
1150778707 17:68101834-68101856 CGGAGTCACCACAGCGGCCGGGG - Intergenic
1152544006 17:80991854-80991876 CGGTGGCCGCGGGGCGGCGGTGG + Exonic
1152565680 17:81099348-81099370 CGGAGTCCCCTCTGCAGCAGAGG + Intronic
1152642376 17:81454569-81454591 CGGAGTCCCACCAGGGGCGGGGG - Intronic
1152729124 17:81961259-81961281 CCGAGCCCGGGCGGCGGCGGCGG - Exonic
1152924065 17:83079608-83079630 CAGAGGCTCGGCGGCGGCGGCGG + Intergenic
1153201902 18:2655725-2655747 CACAGTCCCGGCGGCGGCGCTGG + Exonic
1155928958 18:31685620-31685642 CGGGGTCCCCGGGCGGGCGGGGG - Intronic
1156213840 18:34976944-34976966 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1157580602 18:48771814-48771836 CAGATTCCCCGCGGCGGCTGGGG - Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1159040283 18:63318412-63318434 CGCAGGCCCCGCGGCGGCGCCGG + Exonic
1160499850 18:79396208-79396230 TGGCATCCGCGCGGCGGCGGCGG - Exonic
1160921797 19:1524140-1524162 TGGAGCCCCGGCCGCGGCGGCGG + Intronic
1160935485 19:1592662-1592684 GGGGGTCCGGGCGGCGGCGGCGG - Exonic
1160991520 19:1862264-1862286 CGCAGTCCCCGGGGCGGCGAGGG - Intronic
1161080597 19:2308165-2308187 CGGAGCCCGGGAGGCGGCGGCGG - Intronic
1161550589 19:4910119-4910141 TGTAGTCCCGGCGGCGGGGGTGG + Intronic
1161973446 19:7596289-7596311 CGGAGGCCCCGGCGCGGCAGGGG - Intronic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1162410687 19:10503266-10503288 CCGAGGCCCCCCGACGGCGGAGG - Exonic
1162683797 19:12365431-12365453 GGGCGTCCCCGCGGCGACTGCGG - Intronic
1162954718 19:14091384-14091406 AGGAGGCCGAGCGGCGGCGGGGG - Intergenic
1162975688 19:14206230-14206252 CGGCCCCCTCGCGGCGGCGGAGG + Intergenic
1163421421 19:17215654-17215676 CGGAGTCCCAGGGACGGGGGCGG - Intronic
1163606974 19:18280975-18280997 CGAGGGCCCCCCGGCGGCGGCGG + Exonic
1165274279 19:34734390-34734412 ATGAGTCCCGGGGGCGGCGGCGG + Intronic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
1166558859 19:43718981-43719003 CGACGGCCCCGCAGCGGCGGGGG - Exonic
1167643706 19:50695093-50695115 CGGGGACGCGGCGGCGGCGGCGG - Intronic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
926217097 2:10912352-10912374 CGGACCCCCAGCGGCAGCGGCGG + Exonic
927054851 2:19358457-19358479 TGGAGTCCCCGCGGCAGGAGAGG - Exonic
927215825 2:20667351-20667373 CGGAGCCCAGGGGGCGGCGGCGG + Exonic
930189208 2:48440806-48440828 AGGAGGCGCGGCGGCGGCGGCGG + Exonic
930762304 2:55050020-55050042 AGGGGTCCCCGGGGCGCCGGCGG + Exonic
930872758 2:56184639-56184661 CGGAGGCGCGGCGGCGGCTGCGG + Exonic
931516208 2:63051874-63051896 CGGGTTCCCGGCAGCGGCGGGGG + Intronic
931690553 2:64831584-64831606 CGGAGGGCCTGAGGCGGCGGTGG + Intergenic
931763598 2:65436190-65436212 CGGGGGCGCCGCGGCAGCGGGGG - Intergenic
932345868 2:70994836-70994858 CGGGGACGCGGCGGCGGCGGCGG - Exonic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
935196644 2:100820240-100820262 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
935731066 2:106065468-106065490 CGGAGAACCGCCGGCGGCGGGGG - Intronic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
938073094 2:128318633-128318655 CGGAGCGCGGGCGGCGGCGGAGG - Intergenic
938392424 2:130916269-130916291 CGGAGCCCGCGTGGCGGCTGGGG - Intronic
942045334 2:172096456-172096478 CGGAGTCTCGGGGCCGGCGGCGG + Intergenic
942116782 2:172735888-172735910 CGGGGTCCGCGCGGCGGACGAGG + Exonic
944114224 2:196170894-196170916 CCGAGTCCCAGCTGCGGCGTGGG - Intronic
944495851 2:200306835-200306857 GGGAGGCGCCGCGGCGGTGGCGG - Intronic
944743670 2:202635353-202635375 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
947353633 2:229271305-229271327 CGGCGAGCGCGCGGCGGCGGCGG + Intergenic
947399085 2:229714459-229714481 CGCAGTGACGGCGGCGGCGGTGG + Exonic
947641707 2:231710690-231710712 CGGCCTCCCCGCGGCGGCTAGGG - Intronic
948046910 2:234952062-234952084 GGGACTCACGGCGGCGGCGGCGG - Intronic
948438125 2:237967391-237967413 GTGAGTGACCGCGGCGGCGGCGG + Intronic
948806121 2:240454002-240454024 CGGAGGTTCTGCGGCGGCGGAGG + Intronic
948824775 2:240568867-240568889 GGGCGTCTCGGCGGCGGCGGCGG - Exonic
1172644521 20:36461529-36461551 CGGACTGGCGGCGGCGGCGGCGG - Intronic
1172951216 20:38724499-38724521 CGGAGCGGCGGCGGCGGCGGTGG - Exonic
1173243430 20:41317597-41317619 CGCAGGCCCCGCAGAGGCGGCGG + Intronic
1175424480 20:58854939-58854961 CGTAGTACACGCGGCGGCCGCGG - Exonic
1175429376 20:58891245-58891267 AGGAGCGGCCGCGGCGGCGGCGG - Intronic
1175940300 20:62534714-62534736 CGGTGTCCCCGCAGAGGCGAAGG - Intergenic
1176016624 20:62937405-62937427 CGGAGTCCCGGCGGCGGCGCGGG - Intronic
1177011059 21:15730374-15730396 CATGGCCCCCGCGGCGGCGGCGG - Exonic
1178992481 21:37367202-37367224 CGGGGCCCGGGCGGCGGCGGCGG - Intronic
1181006532 22:20016353-20016375 CCGAGACCCCGGGCCGGCGGGGG - Intronic
1181026857 22:20131833-20131855 CGCAGGACCCGCGGCGGCGGCGG - Intronic
1181160528 22:20957345-20957367 CGGAGTCCACGCTGCAGCGGGGG - Intergenic
1181586898 22:23857580-23857602 GGGAGTCGCCGCCGCGGGGGGGG - Intronic
1183912887 22:41092236-41092258 AGGAGGCCCCGCTCCGGCGGCGG - Exonic
1185055198 22:48575669-48575691 CCTAGTCCCGGCCGCGGCGGCGG + Intronic
1185278623 22:49960658-49960680 CGGGGCCCGCGAGGCGGCGGCGG - Exonic
1185343057 22:50300073-50300095 CGGAGTCCCCGGGAGGGCGCGGG - Intronic
950903000 3:16513712-16513734 CGGACGCGCGGCGGCGGCGGCGG - Intronic
950903001 3:16513715-16513737 CGGCGGACGCGCGGCGGCGGCGG - Intronic
951080303 3:18444728-18444750 CGCAGCTCCGGCGGCGGCGGCGG - Intronic
951907894 3:27721908-27721930 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
953801083 3:46023123-46023145 CGGGGTCGCGGCGGCGGCGCAGG + Intronic
954176231 3:48847811-48847833 GTCGGTCCCCGCGGCGGCGGCGG - Exonic
954223077 3:49166266-49166288 TTGGGTCCCCGCGGCGGCGCCGG - Exonic
954409794 3:50365465-50365487 CGCAGACCCCGCGGAGGCCGAGG - Exonic
954909028 3:54087776-54087798 CGCAGTCCCCGCCGCCGCGGGGG + Intergenic
954912693 3:54122392-54122414 CGGACTCCCCGGGGCCGCCGAGG + Intergenic
955348477 3:58177927-58177949 CGGAGTCCCTGCGGTGGGGAAGG + Intergenic
955911577 3:63863966-63863988 CGCGGGTCCCGCGGCGGCGGCGG - Intergenic
956678013 3:71753638-71753660 AGGGGGCTCCGCGGCGGCGGCGG + Intronic
956978930 3:74614466-74614488 CGGACTAACTGCGGCGGCGGCGG - Intergenic
959530732 3:107431540-107431562 CCGAGCCCCGGCGGCGGCGGCGG - Intergenic
959591892 3:108090911-108090933 CGGCGACCCCGCGGCGGGCGCGG - Exonic
960602126 3:119468982-119469004 CAGATTCCCCGCTGCGGCGCTGG - Exonic
960848018 3:122022318-122022340 CGCAGTCCCCCGGGAGGCGGGGG - Intergenic
963904468 3:150762690-150762712 CGCGGTGCCCGCCGCGGCGGCGG - Exonic
964201454 3:154122404-154122426 CGCAGAACCGGCGGCGGCGGCGG - Exonic
965590386 3:170356871-170356893 AGGAGGCCCCGCGGGGGCGAGGG + Intergenic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968434126 4:576248-576270 CGGGGTCGCGGCGGCGGCGGCGG - Intergenic
968701302 4:2059405-2059427 CGGACCCGCGGCGGCGGCGGCGG - Intergenic
968965177 4:3766027-3766049 CGGAGGACTCGCGGCGGCGCCGG + Intergenic
969715871 4:8867843-8867865 CGGGGGCCCAGCGGCGGCTGCGG + Exonic
969715936 4:8868169-8868191 CGAGGTCCCTGCGGCGGCTGGGG - Exonic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
971457806 4:26860786-26860808 GGGATGCGCCGCGGCGGCGGCGG + Intronic
973907602 4:55546783-55546805 GGGAGCGCTCGCGGCGGCGGCGG + Intronic
975342573 4:73258566-73258588 GGGCCCCCCCGCGGCGGCGGAGG - Exonic
975342638 4:73258800-73258822 CGGAGCGGCGGCGGCGGCGGCGG - Intergenic
975778960 4:77819605-77819627 CGGGGTCCGGGCGGCGGCGGCGG + Intronic
978617927 4:110614361-110614383 GGGAGTCCCGGCGACGGCGGCGG + Intergenic
978777202 4:112516015-112516037 AAGAGCCCCGGCGGCGGCGGCGG + Exonic
982157454 4:152535989-152536011 CTCAGTCTCAGCGGCGGCGGCGG + Exonic
984778663 4:183505116-183505138 CTGAGGGCCCGCGGCGGCCGCGG + Exonic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985688688 5:1295152-1295174 CGGGGTCCGCGCGGAGGAGGCGG + Intergenic
986152489 5:5140284-5140306 CGGAGTGGCAGCCGCGGCGGCGG - Intergenic
986330467 5:6713478-6713500 CGGCGCTCCTGCGGCGGCGGCGG - Intergenic
986608627 5:9546182-9546204 AGGAGGCGGCGCGGCGGCGGGGG - Intergenic
989571591 5:42951095-42951117 CGCAGTCCGTGCGGCGGCGCTGG + Intergenic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
991702924 5:69332797-69332819 CGGAGGACGCGCGGCGGCAGCGG - Intronic
992269930 5:75053541-75053563 CGGGGTCCGTGCGGCTGCGGAGG + Intergenic
994043617 5:95284656-95284678 CCGGGTCCCCGCGGCGCTGGCGG + Intergenic
995650412 5:114362364-114362386 CGGTGCCCCGGCGGCGGGGGCGG + Exonic
997233054 5:132257649-132257671 CGGCGTCCAGGCGGCGGCGGCGG + Exonic
997975421 5:138439130-138439152 CTGAGGCCGAGCGGCGGCGGCGG - Exonic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
998435917 5:142108790-142108812 CGGAGCCTCGGCGGCGGCGGCGG + Exonic
998583713 5:143404535-143404557 CCGAGTCTGCGAGGCGGCGGCGG + Intronic
999365485 5:151020886-151020908 CGGGGTCCCGGCGGCGGAGGGGG - Intronic
1002029305 5:176416303-176416325 CGGTGCCCCGGAGGCGGCGGAGG - Exonic
1002190136 5:177473603-177473625 CAGAGGCTCCGAGGCGGCGGCGG - Intronic
1002193835 5:177491899-177491921 CGGAGGGTCCGCGGCGGGGGCGG + Exonic
1002532792 5:179858683-179858705 CGCTGTCCCCGCGCCGGAGGAGG + Intronic
1002927303 6:1611775-1611797 CTGAGTCACGGCGGCGGCGGCGG + Exonic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003551836 6:7107691-7107713 CTGAGCGGCCGCGGCGGCGGCGG - Intronic
1003585920 6:7389445-7389467 CGGAGTTCCCCCGGCGCGGGCGG - Exonic
1004044475 6:12011847-12011869 GGGCGTCCCCGCGGGGGCTGGGG - Intronic
1004864279 6:19837868-19837890 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
1004924531 6:20403858-20403880 CGGTGCCCCCGCGGCGTCGGCGG - Intronic
1006472614 6:34237148-34237170 CGGCGAGCACGCGGCGGCGGCGG + Exonic
1006932646 6:37697148-37697170 CGGGGACCTCTCGGCGGCGGAGG + Exonic
1007432876 6:41786624-41786646 AGGACTCTCGGCGGCGGCGGCGG + Intronic
1007665357 6:43510148-43510170 CGCGGTCGCGGCGGCGGCGGCGG + Exonic
1010703244 6:79077577-79077599 CGGGGTCCCCGCCGGGGCGCGGG - Intronic
1017164155 6:151391545-151391567 CGGTGTCTCCGGCGCGGCGGCGG + Exonic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017672244 6:156778738-156778760 GGGGGCCCCGGCGGCGGCGGCGG - Exonic
1017737758 6:157380393-157380415 TGGAGCCCCCTCGGCAGCGGAGG - Intergenic
1018613077 6:165662255-165662277 AGTAGTCACCGCGGCGGCGGTGG - Intronic
1019111928 6:169724012-169724034 GGGGGCCCGCGCGGCGGCGGCGG - Exonic
1019343560 7:519435-519457 CGGTGTGGCGGCGGCGGCGGCGG - Intronic
1019474175 7:1236163-1236185 CGCGGTCCCCGCGGCGCCCGAGG - Exonic
1020281634 7:6653102-6653124 CGCAGCCCCCGCCGCGTCGGTGG - Exonic
1022207635 7:28179852-28179874 CGCAGTGGCGGCGGCGGCGGCGG + Intronic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022528351 7:31052432-31052454 GGGAGTGACGGCGGCGGCGGCGG + Intergenic
1022715265 7:32892289-32892311 CCGAGTAGCCGCGGCGGCCGAGG + Intronic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1025069677 7:55887591-55887613 CGGGTCCACCGCGGCGGCGGCGG + Intronic
1026817138 7:73521925-73521947 CGGCGCCATCGCGGCGGCGGCGG + Exonic
1027232609 7:76281557-76281579 CGGAGGCCGCGCGGCGGGCGGGG + Exonic
1027592754 7:80135477-80135499 AGGACTCCCCGCGGCGGGGCGGG + Intronic
1028922335 7:96322031-96322053 TCTAGTCCCGGCGGCGGCGGCGG + Exonic
1029640766 7:101817449-101817471 CGGAGTCCCCGGCGCCGCGGGGG + Intronic
1029708274 7:102286698-102286720 CGGAGCCCGAGCGGCGCCGGTGG - Intronic
1029715133 7:102321554-102321576 CGGGGGCTCCTCGGCGGCGGTGG - Exonic
1029730207 7:102433697-102433719 CGGGGTCCCTGCGGCTGGGGGGG + Intronic
1029896404 7:103989370-103989392 CGTAGGGCGCGCGGCGGCGGCGG - Exonic
1030049041 7:105522020-105522042 CGGCCTCCCCGCGGCCGCCGGGG - Intronic
1030739062 7:113086560-113086582 CGCAGGGGCCGCGGCGGCGGCGG + Intronic
1032525586 7:132576740-132576762 CGGAGCCCGAGCAGCGGCGGCGG + Exonic
1033099980 7:138461137-138461159 CGGAGCAGCGGCGGCGGCGGCGG - Intronic
1034147259 7:148884217-148884239 TGGAGCCCCGGCGGCGGCGGCGG - Exonic
1034223056 7:149460350-149460372 CGGAGCCCGAGCGGCGGCGTCGG + Intronic
1034256018 7:149725023-149725045 CGAAGGCCCCGAGGCAGCGGGGG - Intronic
1034264129 7:149773125-149773147 CTGGGTCCCCGCGGCGCGGGCGG - Exonic
1035169500 7:157009837-157009859 CGGCTACTCCGCGGCGGCGGCGG - Exonic
1036390280 8:8318835-8318857 GGGAGGCGCGGCGGCGGCGGGGG + Exonic
1036562095 8:9906405-9906427 CAGAGTCCCCTCGGCGGCCGCGG + Intergenic
1037901606 8:22692301-22692323 TGGAGTCCCCGCGGTGGGAGAGG - Intronic
1037977753 8:23225240-23225262 CGGCATCCACGCGGCGGCCGTGG - Intergenic
1038568761 8:28641729-28641751 GGGAGGCCACGCGGCGGAGGGGG - Intronic
1038632925 8:29262896-29262918 CGGACCCCCCACGGCGGCCGAGG + Intronic
1041686818 8:60652203-60652225 CGGAGTCTGCGAGGCGGAGGCGG - Intergenic
1042532868 8:69833007-69833029 CGCGGGCCCAGCGGCGGCGGCGG - Exonic
1042785096 8:72537387-72537409 CCGAGGCGCAGCGGCGGCGGCGG - Exonic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1045336110 8:101205598-101205620 CGGCGGGCGCGCGGCGGCGGCGG - Intronic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1045674066 8:104588985-104589007 CGGTGGCTCGGCGGCGGCGGCGG - Exonic
1049762180 8:144336613-144336635 CTGAGGCTCCGCCGCGGCGGCGG - Intergenic
1049936315 9:504598-504620 CGGCTTCCCCGCCCCGGCGGCGG + Intronic
1050151289 9:2621801-2621823 CGGAGCACCCGCACCGGCGGCGG - Intergenic
1052192794 9:25678185-25678207 GGCAGCCCCAGCGGCGGCGGCGG - Exonic
1052362161 9:27573220-27573242 GGGCTTCCCGGCGGCGGCGGCGG - Intronic
1052494664 9:29212245-29212267 CGGAGCCCGCGCGGCAGGGGCGG - Intergenic
1053001158 9:34577960-34577982 CGGGGGCGTCGCGGCGGCGGGGG + Intronic
1054762320 9:69014113-69014135 CGGGGGTCTCGCGGCGGCGGCGG + Exonic
1054835574 9:69672293-69672315 TGCGGTCCCGGCGGCGGCGGCGG - Exonic
1054835652 9:69672546-69672568 CCGCGAGCCCGCGGCGGCGGCGG + Intergenic
1055090999 9:72364843-72364865 GGAAGACCCCGCGGCGGCGGCGG - Intronic
1056746760 9:89310437-89310459 CGGAGCCGGCGCGGTGGCGGCGG - Intergenic
1056773938 9:89498036-89498058 GGGAGGCCCGGCGGCGGCAGCGG + Intronic
1057361148 9:94374755-94374777 CGGCGACGCCGCGGAGGCGGCGG - Exonic
1057470212 9:95350012-95350034 CGGACTCCCTCCGGAGGCGGAGG + Intergenic
1057489150 9:95508375-95508397 CTCCGTCCCCGCGGCGGCGGCGG - Exonic
1057489273 9:95508879-95508901 CTCGGACCCCGCGGCGGCGGCGG - Intronic
1057662213 9:97013409-97013431 CGGCGACGCCGCGGAGGCGGCGG + Exonic
1057786004 9:98087748-98087770 CCGAGGCCCCGCGGCGCCGAAGG + Exonic
1057995480 9:99819517-99819539 CGGAGGAGCCGAGGCGGCGGTGG - Intergenic
1058885840 9:109320705-109320727 GGGAGAGCGCGCGGCGGCGGCGG - Exonic
1058885946 9:109321028-109321050 TGCAGTCCCGGCGGCAGCGGCGG - Intergenic
1059414798 9:114155977-114155999 CCGAGGCACAGCGGCGGCGGCGG + Exonic
1059483713 9:114611528-114611550 CGGGGTGGCGGCGGCGGCGGCGG + Exonic
1059769783 9:117414624-117414646 CGGGGACGCGGCGGCGGCGGCGG + Exonic
1060209038 9:121699268-121699290 CGGGGTTAGCGCGGCGGCGGCGG - Intronic
1060263166 9:122093181-122093203 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1061261287 9:129482337-129482359 CGGAGACCACCCGGCCGCGGTGG - Intergenic
1061321712 9:129835176-129835198 CCGAGTCGCCCCGGCGGCGACGG + Exonic
1061975829 9:134067723-134067745 CGGGGTCGCGGCGGCGGTGGCGG - Intronic
1062162342 9:135087420-135087442 TGGAGTCCCCGCGCCGCCGCCGG + Intronic
1062363700 9:136199127-136199149 CGACGTCCCCGCGCCGGCCGGGG - Intronic
1062408777 9:136410863-136410885 TGGTGTCCCCGAGGCGACGGGGG + Intronic
1062507670 9:136886464-136886486 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1185457755 X:319232-319254 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1187915767 X:24150559-24150581 CGGCGTCCGGGCGGCGGCGGTGG - Intronic
1189137122 X:38561520-38561542 CAGAGCTCCGGCGGCGGCGGCGG - Exonic
1189473577 X:41333035-41333057 CGGGGTCCCCGCAACGCCGGTGG + Intergenic
1189821473 X:44873339-44873361 CGGAGCCCCCGGGTCGGCAGCGG - Intronic
1190712933 X:53082583-53082605 CGGAGGAGCGGCGGCGGCGGCGG - Exonic
1192657112 X:73003458-73003480 CGCAGCCTCCGCTGCGGCGGCGG - Intergenic
1192665008 X:73079543-73079565 CGCAGCCTCCGCTGCGGCGGCGG + Intergenic
1192818004 X:74614459-74614481 CGGAGCAGCCTCGGCGGCGGCGG - Exonic
1193654992 X:84187994-84188016 GGGGGTCGCGGCGGCGGCGGCGG - Intergenic
1195668347 X:107449909-107449931 CGGCGGCGCAGCGGCGGCGGCGG - Intergenic
1197203041 X:123765250-123765272 CCGAGTGGCGGCGGCGGCGGCGG - Intergenic
1197415267 X:126165975-126165997 CGGCGGCCCGGCGGCGGTGGCGG + Intergenic
1197415297 X:126166120-126166142 CTGAGGCTCGGCGGCGGCGGCGG + Intergenic
1197981035 X:132218045-132218067 TGGAGTCCCTGCGGCCGCCGCGG - Exonic
1198683349 X:139204323-139204345 CGGGATCGCGGCGGCGGCGGCGG - Intronic
1199699117 X:150363501-150363523 CAGAGCTCCGGCGGCGGCGGGGG - Exonic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic