ID: 908534637

View in Genome Browser
Species Human (GRCh38)
Location 1:65066703-65066725
Sequence CGCCGCCGCCGCGGGGACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 293}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908534626_908534637 12 Left 908534626 1:65066668-65066690 CCCGGCGCCGCGCGGGGCTCGCC 0: 1
1: 0
2: 3
3: 35
4: 272
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534631_908534637 -10 Left 908534631 1:65066690-65066712 CCTCTCTCCGGACCGCCGCCGCC 0: 1
1: 0
2: 4
3: 36
4: 325
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534625_908534637 13 Left 908534625 1:65066667-65066689 CCCCGGCGCCGCGCGGGGCTCGC 0: 1
1: 0
2: 5
3: 28
4: 262
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534623_908534637 18 Left 908534623 1:65066662-65066684 CCGGTCCCCGGCGCCGCGCGGGG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534621_908534637 19 Left 908534621 1:65066661-65066683 CCCGGTCCCCGGCGCCGCGCGGG 0: 1
1: 0
2: 5
3: 48
4: 349
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534628_908534637 5 Left 908534628 1:65066675-65066697 CCGCGCGGGGCTCGCCCTCTCTC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534627_908534637 11 Left 908534627 1:65066669-65066691 CCGGCGCCGCGCGGGGCTCGCCC 0: 1
1: 1
2: 4
3: 46
4: 296
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293
908534630_908534637 -9 Left 908534630 1:65066689-65066711 CCCTCTCTCCGGACCGCCGCCGC 0: 1
1: 0
2: 1
3: 38
4: 256
Right 908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG 0: 1
1: 1
2: 4
3: 41
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908534637 Original CRISPR CGCCGCCGCCGCGGGGACTC CGG Intergenic
900157027 1:1207226-1207248 AGCCGCCCCCGCGGGCACCCAGG + Intergenic
900164113 1:1237857-1237879 CGTCGCCCCGGCGGGGACTTGGG - Intergenic
900366928 1:2315213-2315235 CGCCGCCTCCGCGGGGCCTGGGG - Intergenic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
901540116 1:9910178-9910200 CGCCGCCGCAGCGGCTGCTCGGG - Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
903398415 1:23020016-23020038 CCCCGCCGCCGCCGGGTCTTGGG + Intronic
903468483 1:23568489-23568511 CGCCGGGGCCGCAGGGACGCTGG - Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
904641984 1:31938050-31938072 CGCCGCCGCCGAGGTGACTGAGG - Exonic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905037980 1:34929781-34929803 CCCCGCCCCCGCGCGGACCCAGG + Intergenic
905179103 1:36155841-36155863 CTCACCCGCCGCGGGGACTGGGG - Intronic
905221468 1:36450711-36450733 GGCCGCTGGCGCGGGGCCTCAGG + Intergenic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
912381300 1:109249607-109249629 AGCAGCCGCGGCGGGGACGCGGG + Intergenic
912514841 1:110211022-110211044 TGCCGCCGCTGCGGGGAAGCCGG + Intergenic
913014267 1:114716804-114716826 CGTGGCCGGGGCGGGGACTCAGG - Exonic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
917846668 1:179025957-179025979 CGCCGCCGCCACAGCGGCTCCGG - Exonic
920878470 1:209858905-209858927 CGCCGCCGCCCCGGGCAGTGAGG - Intergenic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922471953 1:225882295-225882317 CGCCGCCGCCGCAGGTACAGGGG - Exonic
922705636 1:227788717-227788739 CGCCCCCGCCGCGGAGTCCCGGG + Intergenic
923141332 1:231163149-231163171 CGCCGCCGCCGCTGCCTCTCTGG + Exonic
923372329 1:233327319-233327341 CGCCCCCGCCGCAGGTGCTCCGG - Intergenic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1065093072 10:22253321-22253343 ACCCGACGGCGCGGGGACTCCGG - Intergenic
1065342708 10:24722784-24722806 AGCCGCCTCCTCGGGGACGCCGG - Intronic
1068669498 10:59709478-59709500 CCCCGCCGAGGCCGGGACTCAGG - Exonic
1068989145 10:63133372-63133394 CGACGCAGCCGCGGAGACTGCGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1073025212 10:100482622-100482644 CGCCGGCTCTGCGGGGACTGCGG + Exonic
1073122646 10:101131871-101131893 CGCCGCCGCCGCCAGGACCGGGG - Exonic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1076869663 10:133187169-133187191 CGCTGCCTCCGCGGGGACGCTGG + Intronic
1077204979 11:1337660-1337682 CAGCGGCCCCGCGGGGACTCGGG - Intergenic
1077247431 11:1546530-1546552 CACCGCGGCCCCAGGGACTCAGG - Intergenic
1077544902 11:3165057-3165079 CGCCGCAGCCCCGCGGACCCTGG - Intronic
1081699946 11:45146700-45146722 CGCCGCCGCCGCGCCGAGGCTGG + Intronic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083695326 11:64438729-64438751 CCCCGCTGCCCCAGGGACTCTGG + Intergenic
1083920870 11:65780933-65780955 CTCAGCCGCCGCGGGCACTCAGG + Intergenic
1084178692 11:67436169-67436191 CGCCGCCTCAGCCGTGACTCAGG - Exonic
1084265624 11:68003881-68003903 CGCCCCCGCCGGGGGGACCCTGG + Intronic
1084295677 11:68212638-68212660 CGCAGCGGCCGCGGGGTCGCCGG + Intronic
1085530616 11:77189991-77190013 GGCCGCCTCAGCGGGTACTCTGG + Intronic
1087138112 11:94740505-94740527 CGCCGCCGCCGCGCGCCCTCGGG + Intronic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1096495423 12:52037071-52037093 GGCCGCCGCCGCCGGGATTCCGG + Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097264101 12:57736147-57736169 CGCAGCTGCGGCGGGAACTCTGG + Intronic
1101253462 12:102956552-102956574 CGGCGCCGCCGCGGGCACCTCGG - Intronic
1102136866 12:110582941-110582963 CGCCGCCGCCGCCGGCCCTGGGG + Exonic
1102854053 12:116277794-116277816 CGCCGCCGCCGCCGCCACTCCGG - Intergenic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103595355 12:122021818-122021840 CGCCGCCGCCGCCGGCAGTGCGG - Exonic
1104127490 12:125861670-125861692 TGCAGCCGCTGCGGGGACGCCGG - Intergenic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1105943642 13:25171586-25171608 CCCCGCCGCCGCCGCGGCTCCGG + Exonic
1105956442 13:25287445-25287467 CGCGGCCTCCCGGGGGACTCGGG + Exonic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1106717925 13:32410167-32410189 CGCAGCTGCCGCAGGGACCCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113655069 13:112062920-112062942 CGCCGCCCTCGCGGAGACACCGG - Intergenic
1113889972 13:113730578-113730600 GGGCGCAGCCACGGGGACTCAGG - Intronic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1116895606 14:50312337-50312359 TGCCGCAGACGCGGGGACGCTGG + Exonic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1116945397 14:50831028-50831050 CGGCGCCGCCGCGGGAACCATGG + Exonic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1118186539 14:63543127-63543149 CGCCGCCGCCGCCGGGTCCGGGG - Exonic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1120881341 14:89417152-89417174 CGCCTCCGCCGCGGCGCGTCGGG + Intronic
1121828906 14:97033327-97033349 CGCGGCGGCCGCGAGGACCCCGG - Intergenic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122786083 14:104163846-104163868 ACCCGCCGCCTCGGGGACTTGGG - Intronic
1123474659 15:20581495-20581517 CTCAGCGCCCGCGGGGACTCCGG + Intergenic
1123643352 15:22418862-22418884 CTCAGCGCCCGCGGGGACTCCGG - Intergenic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126823708 15:52529063-52529085 CGCCGCCGCCGCAGCCACTTCGG + Intergenic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1127922599 15:63504907-63504929 GGCGGCCGGCGCGCGGACTCGGG + Intronic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1130390183 15:83447841-83447863 GGTGGCGGCCGCGGGGACTCGGG + Intronic
1130613430 15:85381159-85381181 CGGCGCCGACCCGGGGACCCGGG - Intronic
1131735471 15:95326950-95326972 CGCAGCCGCCGCGGCCAATCCGG - Intergenic
1132512823 16:352692-352714 CGCCGCCGGCGGGGGCGCTCGGG - Intergenic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136261764 16:29082206-29082228 CGCGGCGGCTGCGGAGACTCCGG - Intergenic
1136297059 16:29309628-29309650 GGCAGCTGCCGCAGGGACTCAGG + Intergenic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1137261058 16:46830763-46830785 CGCCGCCGGCGAGGAGAGTCTGG + Intronic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139570254 16:67807045-67807067 CCCCGCCGCGGGGGGGCCTCTGG + Intronic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1140223187 16:73058440-73058462 CGCCGCCACCGCCCGGACGCGGG - Intronic
1141079236 16:81036043-81036065 CGCCGGCGGCGCGGGGACAGCGG - Exonic
1142058609 16:88015732-88015754 GGCAGCTGCCGCAGGGACTCAGG + Intronic
1142605486 17:1078865-1078887 CGCTCCCGCCGCGGGGACAGAGG - Intronic
1142627859 17:1203617-1203639 CGCCGCCGCTGCGAGGAGCCCGG + Intronic
1143063359 17:4222216-4222238 CCCCGCCGCCCCGCGGACCCCGG + Intronic
1143148262 17:4790178-4790200 CGCCTCCGCCTCGGTGGCTCCGG - Exonic
1143527265 17:7479699-7479721 CGCCGCCGCCGAGAGGAGGCCGG + Intronic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1146701172 17:34961575-34961597 CTCCGCCTCCGCCCGGACTCCGG + Exonic
1146716246 17:35089200-35089222 CTCCGCCGCGGCGGCGTCTCTGG + Exonic
1147150395 17:38510676-38510698 CTCCGGCGCCGCCGGGTCTCGGG - Exonic
1147393447 17:40123167-40123189 CACCGCCACCGCCGGGACCCTGG + Intronic
1147719830 17:42532216-42532238 CGCCGCCGCCCAGGTGACTGAGG + Intergenic
1148110962 17:45144466-45144488 CGCCGCCCCGTCGGGGACGCGGG + Intergenic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148782705 17:50130473-50130495 CGCCGCGGCCGCCTGGACCCAGG - Intergenic
1150060688 17:62065724-62065746 CTCCGCCGCTGAGGAGACTCTGG - Intergenic
1151963440 17:77419360-77419382 AGCAGCCGCCGCAGGGACCCCGG + Intronic
1152237896 17:79147998-79148020 CGCCGCTGCCGTGGGGCCCCGGG + Intronic
1152646012 17:81468900-81468922 CTCAGCCGCCGCGGGGTCACCGG + Intergenic
1153201901 18:2655724-2655746 CAGCGCCGCCGCCGGGACTGTGG - Exonic
1154303908 18:13217498-13217520 GGCCGCCGTGGCGGGGGCTCAGG - Intronic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1164595821 19:29530159-29530181 TGCCGCGGCCTCGGGGACTGCGG - Exonic
1165879468 19:39032174-39032196 CGGCTCCGGCGCGGGGACCCGGG + Exonic
1167071768 19:47226270-47226292 GCCCGCGGCCGCGGGGACTGAGG - Intronic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167077045 19:47256582-47256604 CGCGGACGCCGCGGGGTCTCCGG + Exonic
1168343804 19:55641044-55641066 CGCCGGGGACGCGGGGACTGGGG - Intronic
925169690 2:1743522-1743544 CGCCGCGGCTGCGGGAACTGAGG + Intronic
925376182 2:3387944-3387966 CGGCCTCGCCGCTGGGACTCGGG - Exonic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
927215824 2:20667350-20667372 CGCCGCCGCCCCCTGGGCTCCGG - Exonic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
928998640 2:37324526-37324548 CGCCGCCGCCGCGTGCAGTTGGG + Intronic
930872757 2:56184638-56184660 CGCAGCCGCCGCCGCGCCTCCGG - Exonic
931052412 2:58428837-58428859 CGCCACCGCCTCCGGGACCCAGG + Intergenic
931348716 2:61470479-61470501 CGCGGCCGCCGCGGCGCCTCGGG - Intronic
932345883 2:70994884-70994906 CGCCGCCGCCGAGAGGAGCCCGG + Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935196643 2:100820239-100820261 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
935595171 2:104872554-104872576 CCTGGCCGCCGCGGGAACTCGGG - Intergenic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
937045130 2:118847095-118847117 CGCGGCGGCGGCGGCGACTCCGG - Exonic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
942045333 2:172096455-172096477 CGCCGCCGGCCCCGAGACTCCGG - Intergenic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
944114227 2:196170895-196170917 CCACGCCGCAGCTGGGACTCGGG + Intronic
946322083 2:218960144-218960166 CGCCGCCGTCGGGGGGATCCCGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947353632 2:229271304-229271326 CGCCGCCGCCGCGCGCTCGCCGG - Intergenic
947729634 2:232420795-232420817 GGCCGCGGCTGCAGGGACTCAGG + Intergenic
948907353 2:240986253-240986275 CACAGCTTCCGCGGGGACTCTGG - Intronic
1168757241 20:325965-325987 GGCCGCCGCCCCCGGGACCCGGG + Exonic
1169483440 20:6006217-6006239 CGGCCGCGCCGCGGGGTCTCGGG - Exonic
1171499834 20:25585180-25585202 CGCCGCCGCCGTCGGGAAACCGG + Intronic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172587269 20:36093477-36093499 CGCCGCCGCCGCTGGGAGCTGGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1172654369 20:36528006-36528028 CGCCGCCGCCGCTGGCTCTCGGG + Exonic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1175866690 20:62182609-62182631 CCTTGCCGCCGCGGGGAATCCGG - Intergenic
1176414521 21:6467206-6467228 CTCCGCCGGCGCGGGGGCTGGGG + Intergenic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176705832 21:10119602-10119624 CGCCGCGGCTGCGGGGACTGGGG + Intergenic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179690019 21:43075528-43075550 CTCCGCCGGCGCGGGGGCTGGGG + Intronic
1180064337 21:45405132-45405154 AGCCGCCGCCGCTGGGAGGCCGG - Intronic
1180066119 21:45413368-45413390 CGCCCCTGTCGCGGGGACCCAGG + Intronic
1181160530 22:20957346-20957368 CCCCGCTGCAGCGTGGACTCCGG + Intergenic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181669659 22:24420267-24420289 CCCCGCCGCCGCCGGGCCTGAGG + Intronic
1183328504 22:37207055-37207077 CGCCGCCGCCGCTGGCACGAGGG + Exonic
1184153153 22:42649817-42649839 CGCCGCCGGCGAGGAGGCTCCGG - Intergenic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG + Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951907893 3:27721907-27721929 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
952924779 3:38313006-38313028 ATCAGCCACCGCGGGGACTCCGG - Exonic
953099323 3:39809694-39809716 CGCAGCCGCAGCGGGAACCCGGG - Exonic
953947578 3:47163360-47163382 CGCCGCCGTCGCGGGGAGGTCGG + Intronic
954152038 3:48662599-48662621 GGCCGCCGTGGCGGGGCCTCGGG - Exonic
954458262 3:50611653-50611675 CCCCGCGGCAGCGGCGACTCCGG + Exonic
955916248 3:63911828-63911850 AGCCGCCGCAGAGCGGACTCCGG - Intronic
956978931 3:74614467-74614489 CGCCGCCGCCGCAGTTAGTCCGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
961674271 3:128555380-128555402 CGCGGCCGCCGCGCGCACCCTGG - Intergenic
963904469 3:150762691-150762713 CGCCGCCGCGGCGGGCACCGCGG + Exonic
966362784 3:179148402-179148424 TGCCGCGGCCGCTGGGACTGGGG + Intronic
967493775 3:190120985-190121007 CGCCGCTGCAGCGGGGAGCCTGG - Intronic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968161635 3:196432020-196432042 CCCCGCCGGCCCGGGGACCCGGG - Intronic
968235688 3:197029149-197029171 CGTCGGCGCCCCGGGGAGTCAGG - Intronic
968701305 4:2059409-2059431 CGCCGCCGCCGCGGGTCCGAGGG + Intergenic
968965176 4:3766026-3766048 CGGCGCCGCCGCGAGTCCTCCGG - Intergenic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
975633030 4:76421082-76421104 CGCAGCCTCCGCGGGGCCTAGGG - Intronic
975778959 4:77819604-77819626 CGCCGCCGCCGCCCGGACCCCGG - Intronic
978384700 4:108167954-108167976 CGCGGCGGCCGCCGGGATTCGGG - Exonic
978503499 4:109433668-109433690 CGCCGCGGGCGCGGGGATCCTGG - Intergenic
978795757 4:112706030-112706052 CGCGGCGGCTGCGGAGACTCCGG + Intergenic
979674809 4:123398784-123398806 CGCCGCCGCTCCGGGTAATCGGG - Intronic
980354551 4:131724942-131724964 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980355082 4:131727448-131727470 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980356705 4:131734914-131734936 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980357244 4:131737402-131737424 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980357787 4:131739897-131739919 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980358322 4:131742380-131742402 CGCGGCGGCTGCGGGGACTGAGG - Intergenic
980358857 4:131744877-131744899 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980359397 4:131747350-131747372 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980359940 4:131749818-131749840 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980360479 4:131752313-131752335 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980361021 4:131754785-131754807 CGCGGCGGCTGCGGGGACTAGGG - Intergenic
980361562 4:131757268-131757290 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
980362104 4:131759740-131759762 CGCGGCGGCTGCGGGGACTAGGG - Intergenic
980362646 4:131762223-131762245 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983061511 4:163166490-163166512 CGCCGTCGCGGCCGGGACCCCGG - Exonic
984811094 4:183797356-183797378 CTCCGCCCCCGCGGGGCCGCTGG + Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991702925 5:69332798-69332820 CGCTGCCGCCGCGCGTCCTCCGG + Intronic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
994043615 5:95284655-95284677 CGCCAGCGCCGCGGGGACCCGGG - Intergenic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
998583711 5:143404534-143404556 CGCCGCCGCCTCGCAGACTCGGG - Intronic
1000302957 5:159972319-159972341 CGCCGCGGCCGCCACGACTCGGG + Exonic
1001381714 5:171310135-171310157 GGCCGCCGCTGCGGAGACACAGG - Exonic
1002927302 6:1611774-1611796 CGCCGCCGCCGCCGTGACTCAGG - Exonic
1004864278 6:19837867-19837889 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005522771 6:26614554-26614576 GGGCGCCGCCGCAGGGACTCAGG - Intergenic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1007752022 6:44076598-44076620 CGGCGGCGTGGCGGGGACTCTGG + Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1010703400 6:79078103-79078125 CCCCGCCGCCGAGGGGAAGCGGG + Exonic
1015251832 6:131135534-131135556 TGCCGCTGCCGCGGGGGCTGCGG + Intergenic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1017446351 6:154510342-154510364 CCCCGCCGCCGCCGGGATCCCGG + Exonic
1017672491 6:156779559-156779581 CGCCGCCCCCGCGGGAAGACGGG - Intronic
1022088158 7:27088467-27088489 AGCGGCGGCCGCGGGAACTCCGG - Intergenic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1023067279 7:36390178-36390200 GGCCGCAGCCGCGGCGACCCCGG - Intronic
1024963802 7:55004602-55004624 CGCCGCGGCCGCGGGGAGCAGGG + Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025296188 7:57776713-57776735 AGCGGCGGCTGCGGGGACTCGGG - Intergenic
1026909470 7:74083900-74083922 CGCCGCCGGCCCGGGGAGGCGGG - Intronic
1028987741 7:97021358-97021380 CGCCGCCGCCGAGGACACTCGGG - Intronic
1029535277 7:101154337-101154359 CGCCGACGCCGCGGGGAGCGCGG - Intergenic
1029640334 7:101816184-101816206 CCCCGCCGCCGCGGGCCCCCCGG - Intronic
1030138704 7:106284573-106284595 CGCCGCCGCCGCGCGCCCCCAGG + Intronic
1030727198 7:112939762-112939784 CGCCGCCGCCGCCGCCCCTCAGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032130756 7:129225361-129225383 CGCCGCCGTCGCGGTGCCGCTGG - Exonic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1034264130 7:149773126-149773148 CGCCCGCGCCGCGGGGACCCAGG + Exonic
1034278954 7:149838525-149838547 CGCGACCGCCCCGGGGACCCAGG - Exonic
1034494012 7:151409645-151409667 CGGAGCCGCCGCGCGGACCCCGG - Intronic
1034618022 7:152435854-152435876 CGCCGCCGCCGCTGCTGCTCGGG + Exonic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1037803973 8:22049300-22049322 CCCCGGCCCCGCGGGGACCCGGG - Intronic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1041686819 8:60652204-60652226 CGCCTCCGCCTCGCAGACTCCGG + Intergenic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1042785098 8:72537388-72537410 CGCCGCCGCCGCTGCGCCTCGGG + Exonic
1044599707 8:93991551-93991573 TGCCCCCGCCGCGGGGAGCCGGG - Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045674067 8:104588986-104589008 CGCCGCCGCCGCCGAGCCACCGG + Exonic
1049169946 8:141153588-141153610 CTCCCCCGCAGCGGGGACCCTGG - Intronic
1049396585 8:142403669-142403691 GGCAGGCCCCGCGGGGACTCCGG + Intergenic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049761368 8:144333215-144333237 CGCAGGAGCCGCGGGGCCTCCGG + Exonic
1049788394 8:144462216-144462238 AGCCCCCGCCGCGGGGCCCCAGG - Intronic
1049936314 9:504597-504619 CGCCGCCGGGGCGGGGAAGCCGG - Intronic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1053643113 9:40106721-40106743 CGCGGCGGCTGCGGGGACTGGGG + Intergenic
1054323965 9:63703949-63703971 CGCGGCGGCTGCGGGGACTGGGG + Intergenic
1054541642 9:66269882-66269904 CGCGGCGGCTGCGGGGACTGGGG - Intergenic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1056746761 9:89310438-89310460 CGCCGCCACCGCGCCGGCTCCGG + Intergenic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057997148 9:99828723-99828745 CGCAGCCGCCGCGGGCAGCCAGG + Exonic
1059414796 9:114155976-114155998 CGCCGCCGCCGCTGTGCCTCGGG - Exonic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1061006495 9:127931006-127931028 CGCCCTCGGCGTGGGGACTCGGG + Intergenic
1061186995 9:129060638-129060660 CTCCGCCACCGAGGTGACTCGGG + Exonic
1061196662 9:129110569-129110591 CGCCGCCGCCGCCGCGGCTGGGG + Exonic
1061208511 9:129177630-129177652 CGCCGCCGCCGCGCAGCCCCTGG + Exonic
1061541069 9:131278014-131278036 CGCCGGCCCCGCGGGGATGCAGG + Intergenic
1061975830 9:134067724-134067746 CGCCACCGCCGCCGCGACCCCGG + Intronic
1062537793 9:137028426-137028448 CGCCGCCGCCGGGAAGCCTCCGG + Intronic
1202790866 9_KI270719v1_random:89691-89713 CGCCGCGGCTGCGGGGACTGGGG + Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1185610570 X:1391863-1391885 CGCGGCCGCTCCGGGGACTAGGG - Intronic
1185893322 X:3838556-3838578 TGCCCCAGCCGCGGGGACTCCGG + Intronic
1185898436 X:3876980-3877002 TGCCCCAGCCGCGGGGACTCCGG + Intergenic
1185903551 X:3915409-3915431 TGCCCCAGCCGCGGGGACTCCGG + Intergenic
1187915768 X:24150560-24150582 CACCGCCGCCGCCCGGACGCCGG + Intronic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1189323186 X:40098188-40098210 CGCCTCCGCGGCGGGGTTTCGGG + Intronic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1196425076 X:115561604-115561626 CGCAGCCGCGGAGGGGAATCAGG - Intronic
1200178643 X:154136796-154136818 GGCGGCCGCCGCGGGTCCTCGGG - Intergenic