ID: 908535116

View in Genome Browser
Species Human (GRCh38)
Location 1:65069081-65069103
Sequence TCCCACTAGGGTAAGCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908535113_908535116 14 Left 908535113 1:65069044-65069066 CCTTTCACAGATCAGCGTACGGC No data
Right 908535116 1:65069081-65069103 TCCCACTAGGGTAAGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908535116 Original CRISPR TCCCACTAGGGTAAGCTTTG AGG Intergenic
No off target data available for this crispr