ID: 908541026

View in Genome Browser
Species Human (GRCh38)
Location 1:65122115-65122137
Sequence CCGCGTGAGCCACTGTTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908541019_908541026 5 Left 908541019 1:65122087-65122109 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data
908541022_908541026 -4 Left 908541022 1:65122096-65122118 CCCAAAGTGCTGGGATTACCCGC 0: 16
1: 1828
2: 231176
3: 279651
4: 185283
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data
908541023_908541026 -5 Left 908541023 1:65122097-65122119 CCAAAGTGCTGGGATTACCCGCG 0: 8
1: 924
2: 130443
3: 281940
4: 225587
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data
908541014_908541026 22 Left 908541014 1:65122070-65122092 CCTTGTGATCCGCCATACCTCGG No data
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data
908541021_908541026 -1 Left 908541021 1:65122093-65122115 CCTCCCAAAGTGCTGGGATTACC 0: 1636
1: 294518
2: 269030
3: 154985
4: 133869
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data
908541017_908541026 10 Left 908541017 1:65122082-65122104 CCATACCTCGGCCTCCCAAAGTG 0: 45
1: 1293
2: 4389
3: 5538
4: 4641
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data
908541016_908541026 13 Left 908541016 1:65122079-65122101 CCGCCATACCTCGGCCTCCCAAA No data
Right 908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908541026 Original CRISPR CCGCGTGAGCCACTGTTCCC CGG Intergenic
No off target data available for this crispr