ID: 908546629

View in Genome Browser
Species Human (GRCh38)
Location 1:65168580-65168602
Sequence TATGGAGAGCAGGCCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908546629_908546632 11 Left 908546629 1:65168580-65168602 CCACATCTGGCCTGCTCTCCATA 0: 1
1: 0
2: 8
3: 41
4: 337
Right 908546632 1:65168614-65168636 TTCTAAATAAACACATTATTTGG 0: 1
1: 0
2: 0
3: 57
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908546629 Original CRISPR TATGGAGAGCAGGCCAGATG TGG (reversed) Intronic
900345987 1:2210472-2210494 TTTGGGGAGGAGGCCAGGTGGGG + Intronic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902099695 1:13976085-13976107 TTTGGAGAGCAGAACAGATGGGG - Intergenic
902921733 1:19670070-19670092 GAAGGAGAGGAGGCCAGATAGGG - Intronic
903492109 1:23737115-23737137 TATGGAGTGCTGGCCAGGCGTGG + Intergenic
903590407 1:24451403-24451425 CATGGAGAACGGGCCACATGTGG + Intronic
904449193 1:30600230-30600252 AATGGAGAGCAAGACAGGTGTGG - Intergenic
904489676 1:30850608-30850630 GATGGCGTGGAGGCCAGATGGGG - Intergenic
906208731 1:44000654-44000676 TATGGAGCTCCGGCCAGGTGCGG + Intronic
907045072 1:51295781-51295803 TGTGGACAGTAGGACAGATGTGG - Intronic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
909809853 1:79919323-79919345 TATTCAAAGCTGGCCAGATGTGG + Intergenic
910653773 1:89599432-89599454 TGTGGAGAGCTGGACAGAAGTGG - Intergenic
912415082 1:109502595-109502617 TAAGGAGAGCAAGTCTGATGAGG - Intronic
912936505 1:114007810-114007832 CACGGCGTGCAGGCCAGATGGGG - Intergenic
915302615 1:154959972-154959994 TATGGACCACAGGCCAGGTGCGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
916457622 1:164987027-164987049 TGTGGACAGAAGACCAGATGTGG + Intergenic
916753890 1:167749867-167749889 CATGCAGATCAGGCCAGCTGTGG - Intronic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
916816432 1:168357938-168357960 TATGGAGAAGAGGTCAGACGTGG - Intergenic
917115247 1:171596571-171596593 AATGGTGAGAAGGCCAGATCAGG - Intergenic
917686329 1:177419767-177419789 TAAGGAGAACAGGGCAGAGGAGG - Intergenic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
918325690 1:183408486-183408508 TATGGCCTGCAGGCCATATGTGG - Intronic
918455800 1:184712214-184712236 TATGTTGAGTAGGCCAGGTGCGG - Intronic
919768853 1:201144405-201144427 TGTGGAGAGCAAGACGGATGGGG + Intronic
921069847 1:211649736-211649758 CTTGGAGAGCAAGCCTGATGAGG + Intergenic
921749756 1:218778636-218778658 TCTGGAGGGCAGGCCAGCTTTGG - Intergenic
922022944 1:221722471-221722493 TCTGAAGAGCAGGCCTGGTGTGG + Intronic
922430240 1:225545073-225545095 TATGGAGGGCTGGCCAGAAGTGG - Intronic
922666452 1:227473730-227473752 CATGGAGAGCAAGCCAAAGGAGG + Intergenic
922713668 1:227853330-227853352 TAGACAGAGCAGGCCAGGTGTGG - Intergenic
922988135 1:229882634-229882656 GGTGGAGAGCATGCCAGAGGAGG - Intergenic
923035359 1:230281420-230281442 TGTGGAGTGCAGGCCAGAGCAGG + Exonic
923338869 1:232991402-232991424 GAGAGAGAGCAGACCAGATGGGG + Intronic
923972259 1:239217713-239217735 TAAGGAAAACATGCCAGATGAGG + Intergenic
1062835613 10:633615-633637 CATGGAGAGCAGTCCATCTGTGG - Intronic
1064819889 10:19316783-19316805 TATGGGGAGCAAGGCAGAGGTGG + Intronic
1066212778 10:33256395-33256417 CATGGAGAGAATGCCCGATGAGG + Exonic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1067300662 10:45005903-45005925 TGTGGAGAGGAGCACAGATGAGG + Intergenic
1068825105 10:61428420-61428442 TATGGAGAATGGGGCAGATGAGG - Intronic
1069505165 10:68990978-68991000 TATGTAGAAAAGGCCGGATGTGG + Intronic
1072149340 10:92673111-92673133 TATGGACAGTAGGCCAGGCGCGG - Intergenic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072545791 10:96436974-96436996 AATGTATAGCAGGCCAGGTGCGG - Intronic
1074336394 10:112580684-112580706 TGTGGGAGGCAGGCCAGATGGGG + Intronic
1075692019 10:124403278-124403300 TATGTAGAGCAGGGCAGAATGGG - Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1078110936 11:8391505-8391527 TATGCTCAGCTGGCCAGATGTGG + Intergenic
1078170049 11:8922925-8922947 TATGGAGAGCATGCCCGAGAGGG - Intronic
1078299884 11:10117652-10117674 TATTGGGAGCAGGGGAGATGGGG + Intronic
1079017234 11:16879536-16879558 TATGGAGTGTGTGCCAGATGTGG - Intronic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1079301359 11:19282057-19282079 TGTGGAGAACAAGACAGATGAGG + Intergenic
1080894249 11:36435915-36435937 TATGATGAGCAAGACAGATGGGG + Intronic
1081466160 11:43319701-43319723 TATGTACAGCGGGCCAGATGAGG - Intronic
1083259969 11:61517597-61517619 CATGGAGAATAGGGCAGATGTGG + Intronic
1083333574 11:61910413-61910435 CAGAGAGAACAGGCCAGATGGGG + Intronic
1084107106 11:66987399-66987421 TATGCCAAGGAGGCCAGATGGGG - Intergenic
1084166529 11:67377428-67377450 CATGGAGAGGAGGGCAGAGGTGG - Intronic
1084962780 11:72726070-72726092 GAGGGAGGGCATGCCAGATGAGG + Intronic
1085070081 11:73535849-73535871 TTTTAAGTGCAGGCCAGATGTGG - Intronic
1086399300 11:86447553-86447575 TAGAGAGACCAGGCCAGGTGTGG + Intronic
1088455383 11:110027986-110028008 TATGGAGAGTAAACCAGATGTGG + Intergenic
1088728004 11:112656435-112656457 TATGGAGAACAGGACACACGAGG - Intergenic
1088767392 11:112996845-112996867 TATGATGAGCAGGCCAGAAAAGG - Intronic
1089095459 11:115916543-115916565 TCAGGAGAGCAGGCGAAATGGGG + Intergenic
1089200144 11:116719803-116719825 TATTGCGAGCAGGCCCGATGGGG - Intergenic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1091281034 11:134381807-134381829 TGTGGAGGACAGGGCAGATGTGG - Exonic
1091624742 12:2113329-2113351 TCTGGAAAGCAGGTCACATGGGG + Intronic
1091663351 12:2400735-2400757 AGTGGTGAGCAGGCCAGATGGGG - Intronic
1093304659 12:17499317-17499339 TATGGCAAGGAGGCCAGTTGTGG + Intergenic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096641548 12:52998597-52998619 TCTGGTTAGCAGGCCAGGTGCGG - Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101374272 12:104157281-104157303 TATGGAGAGTAGGGGAGTTGGGG - Intergenic
1102970215 12:117160516-117160538 TTTGGAGAGCAGGCCTGTTTTGG - Intronic
1103007913 12:117436502-117436524 TATGGAGTCAAGGCCAGCTGGGG - Intronic
1103010514 12:117455092-117455114 GATGCAGAGCAGGCCTGAGGTGG + Exonic
1103019474 12:117522395-117522417 AATGGAGAGAAGGCCAGGGGTGG + Intronic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1104554891 12:129790570-129790592 TATGGAGAGCAGAGGAGAAGAGG - Intronic
1105504011 13:20994602-20994624 TATGGAGACCAAGCTGGATGTGG + Intronic
1107130312 13:36887560-36887582 TATGGAGAACAGATCAGATGGGG + Intronic
1108912394 13:55571993-55572015 TATAAAGAGCAGGCCAGCTAAGG + Intergenic
1108921597 13:55681394-55681416 AATGTAGAGAAGGCCAGGTGTGG - Intergenic
1109713953 13:66196048-66196070 TATGAACATCAGGCCAGGTGTGG - Intergenic
1112338853 13:98536652-98536674 AATGGAGAGAAGGGCAGGTGTGG - Intronic
1112409510 13:99150545-99150567 TACGGAGAGGGGGGCAGATGAGG + Intergenic
1115229512 14:31144670-31144692 AATGGGGAGCAGGCCAGATTTGG + Intronic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115863420 14:37714885-37714907 TATTGAGGGCTGGCCAGGTGTGG + Intronic
1116064333 14:39963476-39963498 AATAATGAGCAGGCCAGATGTGG + Intergenic
1117017861 14:51536705-51536727 TATGGACAAGAGGCCAGGTGCGG - Intronic
1118026684 14:61775542-61775564 TATAGAGGGTAGGCCAGGTGTGG - Intronic
1118542105 14:66839986-66840008 TATTGAAAGCAGGCCAGTTGTGG + Intronic
1118776765 14:68978535-68978557 TATGGAGAGGTGGCCAGGGGCGG + Intronic
1119881740 14:78105133-78105155 GATGCAGAGCAGGTCAGACGTGG - Intergenic
1121096175 14:91219624-91219646 TATGCTGAGGAGGCCAGATAAGG + Intronic
1122336468 14:100991323-100991345 TATGAATAACTGGCCAGATGTGG - Intergenic
1122359577 14:101151477-101151499 GATGGAGGGGAGGCCAGATTGGG + Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1122801272 14:104230823-104230845 TATGGAGATGAGGCCTGAGGAGG + Intergenic
1122982910 14:105199604-105199626 TAGGGAGAGCAGGGCAGAGGTGG - Intergenic
1123112531 14:105880035-105880057 CAGGGAGAGCAGGGCAGCTGGGG + Intergenic
1202833564 14_GL000009v2_random:60659-60681 CATGGAGAGCAGGCAACATGTGG + Intergenic
1125525390 15:40370853-40370875 TGAGGAGAGCAGGGCAGTTGGGG - Exonic
1126297029 15:47151149-47151171 TATGGAGGGCTGGCCATATATGG - Intergenic
1126414274 15:48401626-48401648 TATGGAGAGGAGGCAGGCTGGGG + Intergenic
1126564563 15:50081524-50081546 GATGGAGAAGAGGCCAGATTAGG - Intronic
1126874399 15:53024520-53024542 TATGAAGAGCAGGCAAGAGTAGG + Intergenic
1129043107 15:72707467-72707489 AATGGAAAAGAGGCCAGATGTGG - Intronic
1130917576 15:88318065-88318087 TGGGGAGAGGAGGCCAGATGAGG - Intergenic
1132772198 16:1569938-1569960 TAAATAAAGCAGGCCAGATGCGG - Intronic
1132898798 16:2242281-2242303 TATGGACAGTGGGCCAGGTGCGG - Intronic
1133378017 16:5305765-5305787 AATGGTGAGTAAGCCAGATGCGG + Intergenic
1134147813 16:11781310-11781332 AAAGGACAGCAGGCCAGATTGGG + Intronic
1135486372 16:22869202-22869224 TTTGTCCAGCAGGCCAGATGAGG - Intronic
1135894118 16:26383050-26383072 TATGAACAGGAGGCCAGAAGTGG - Intergenic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136714008 16:32262501-32262523 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136753897 16:32666918-32666940 GATGGAGGGCAGGTGAGATGGGG + Intergenic
1136814216 16:33203447-33203469 GATGGAGGGCAGGTGAGATGGGG - Intronic
1136820692 16:33313527-33313549 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136827255 16:33370066-33370088 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1136832321 16:33468837-33468859 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1138142603 16:54581806-54581828 CATGGAGAAAAGGCCACATGAGG - Intergenic
1138316270 16:56072960-56072982 TGTGGAGAGCATGCCTGAGGAGG + Intergenic
1138335871 16:56252408-56252430 CAAGGAGAGCAGTTCAGATGAGG + Intronic
1138375728 16:56562859-56562881 TATCAAAACCAGGCCAGATGTGG - Intergenic
1140256701 16:73343432-73343454 CATGAAGAGGAGGCCACATGCGG + Intergenic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1202992792 16_KI270728v1_random:26421-26443 GATGGAGGGCAGGTGAGATGGGG - Intergenic
1203056046 16_KI270728v1_random:927251-927273 GATGGAGGGCAGGTGAGATGGGG + Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1143410606 17:6706277-6706299 TAAGGGAAGCAGGCCAGAAGTGG - Intronic
1143475786 17:7203333-7203355 GATGGAGGGGAGGCCAGAGGTGG + Intronic
1145997047 17:29110806-29110828 TAAGGAGAGAAAGCCAGAGGTGG + Intronic
1146230332 17:31102450-31102472 AAGGGAGAGTAGGCCAGGTGCGG + Intronic
1148170545 17:45515912-45515934 GGTGGAGCGCATGCCAGATGAGG - Intergenic
1148171022 17:45519905-45519927 GGTGGAGCGCATGCCAGATGAGG - Intergenic
1148278660 17:46329900-46329922 GGTGGAGCGCATGCCAGATGAGG + Intronic
1148300870 17:46547762-46547784 GGTGGAGCGCATGCCAGATGAGG + Intronic
1148364998 17:47048647-47048669 GGTGGAGCGCATGCCAGATGAGG + Intergenic
1148390062 17:47265505-47265527 TATAGAGAGAATGCCACATGAGG - Intronic
1148914708 17:50965987-50966009 TATAGAAAGCAATCCAGATGTGG - Exonic
1150401634 17:64861501-64861523 GGTGGAGCGCATGCCAGATGAGG - Intronic
1150410044 17:64935088-64935110 TGGGGAGGGAAGGCCAGATGGGG + Intergenic
1150722913 17:67628647-67628669 TCTGGGGTGCAGGCCAGAGGAGG + Intronic
1150781744 17:68128804-68128826 GGTGGAGTGCATGCCAGATGAGG - Intergenic
1150864777 17:68838125-68838147 TATGGTGAGGAGGCCAGACCTGG + Intergenic
1151426318 17:74033090-74033112 GAAGGAGAGTAAGCCAGATGGGG + Intergenic
1152014773 17:77743351-77743373 ACTTGAGAGCAGGCCAGGTGTGG + Intergenic
1152664210 17:81558014-81558036 GGTGCAGAGCAGCCCAGATGTGG + Exonic
1153651398 18:7243702-7243724 TGTGGAGAGAATGCAAGATGAGG - Intergenic
1153837012 18:8972371-8972393 CATGGAGAGGAGGTCAGCTGTGG - Intergenic
1153956201 18:10098463-10098485 TAAAGAGAGTAGGCCAGATGTGG - Intergenic
1155918177 18:31576394-31576416 AGTGGAGAGAAGGCCAAATGAGG + Intergenic
1156234611 18:35190071-35190093 AATGGATGGCAGGCCAGATTTGG + Intergenic
1156252703 18:35366189-35366211 GAGGGAAAGCAGGCCAGATGGGG - Intergenic
1157147369 18:45177547-45177569 GAGGGAGAGCATTCCAGATGCGG - Intergenic
1157576734 18:48748702-48748724 TCTGGAGAGAAAGCCTGATGTGG - Intronic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1158784353 18:60691490-60691512 TATGGATAGCAGGCAACTTGGGG + Intergenic
1159908932 18:74125242-74125264 AATGCAGAGCAGGCAAGCTGCGG + Intronic
1162177630 19:8843036-8843058 TCTGAAGAGCAGGCAAGGTGGGG - Exonic
1162598261 19:11646163-11646185 AATGTAGAACAGGCCAGGTGCGG - Intergenic
1163404505 19:17113765-17113787 TCTGCAGAGCAGCCCAGAGGAGG + Intronic
1163492828 19:17626901-17626923 AATGGAGAACAGGCCAGATGCGG + Intronic
1163549511 19:17957824-17957846 TGTGGAGAGCAGGGCAGGAGTGG + Intronic
1166100710 19:40570051-40570073 TACGGAGTCCAGGACAGATGTGG - Intronic
1166907296 19:46120180-46120202 TTTGGAGAGGAGCCCAGCTGGGG - Exonic
1167268402 19:48494396-48494418 GATGGAGGTCAGGCCAGAGGAGG - Intronic
1167303603 19:48694544-48694566 TATGCAAAACAGGCCAGGTGTGG - Intergenic
1167876512 19:52418271-52418293 TATGCTGAGCTGGCCAGGTGTGG - Exonic
1168660696 19:58163628-58163650 CATGGAAATCAGGCCAGGTGTGG - Intergenic
1202639105 1_KI270706v1_random:67033-67055 CATGGAGAGCAGGCAACATGTGG - Intergenic
926041019 2:9673267-9673289 TTTGAAGAGCAGACCAGGTGTGG + Intergenic
926057999 2:9787370-9787392 TATGGAGGGCAGGCAGGTTGGGG + Intergenic
927085680 2:19672273-19672295 TATGGAGGCCAGCCCAGAGGCGG - Intergenic
927862818 2:26570778-26570800 TATGGACAGCAGGCTGGAGGGGG + Intronic
928299408 2:30112190-30112212 GCTGTAGAGCAGGCCAGGTGCGG + Intergenic
931633498 2:64322127-64322149 TCTGGAGAGCAGGCATCATGGGG - Intergenic
937037912 2:118797129-118797151 AATGGTGAGCAGGACTGATGTGG - Intergenic
938083241 2:128381297-128381319 TCTGGAGACCAGGCCTGAGGAGG + Intergenic
938210075 2:129459766-129459788 TGTGAGGAGCAGGCCAGGTGAGG + Intergenic
940378519 2:152986480-152986502 TATGGAGGGAAAGCCAGATGTGG + Intergenic
940583459 2:155611599-155611621 AATGGAGAGCAAGGTAGATGTGG + Intergenic
940815305 2:158291044-158291066 TATGGAGAGAGGGCTAGAGGTGG - Intronic
940894671 2:159069347-159069369 TACAGGGAGAAGGCCAGATGAGG + Intronic
942146307 2:173030451-173030473 TATGGAGAGTGGGGGAGATGAGG + Intronic
942618101 2:177815918-177815940 TCTACAGAGCAGGCCAGGTGTGG + Intronic
943669724 2:190648656-190648678 GCTGGAGAGCAGGCCGGAGGCGG + Intronic
944830487 2:203529262-203529284 TCAGTAGAGCAGGCCAGGTGCGG - Intronic
945905472 2:215588089-215588111 CATGGAGTGCATGCCAGAGGTGG - Intergenic
946617486 2:221525582-221525604 TTGAGAGAGCAGGCGAGATGTGG + Intronic
948473732 2:238203445-238203467 AAGGGAGAGCAGGCGGGATGGGG - Intronic
1170694678 20:18647659-18647681 GATGGAGAGGCAGCCAGATGTGG + Intronic
1174228844 20:49027404-49027426 AATGGAGAGCAGGCCAGGCAAGG + Intronic
1175794923 20:61765558-61765580 TAAGGAGAGCAGGGAAGAGGAGG + Intronic
1175893709 20:62326873-62326895 CATGGAGAGCAGGCCGGATGTGG - Exonic
1176068361 20:63212535-63212557 TTTGGTGAGCAGGCCTCATGGGG - Intronic
1180362843 22:11914830-11914852 CATGGAGAGCAGGCAACATGTGG + Intergenic
1180658169 22:17442271-17442293 AATGCAGATCAGGCCAGGTGTGG + Intronic
1181085832 22:20438928-20438950 TTTGGGGAGCAGGCCACATGCGG + Intronic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181789586 22:25253958-25253980 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1181824407 22:25502782-25502804 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1182012880 22:27015199-27015221 TCTGAAGAGCAGGTCAGAGGAGG + Intergenic
1182257906 22:29051205-29051227 GATGGGGAGCAGGGCAGAGGGGG - Intronic
1182414537 22:30212757-30212779 TCTGGTTAGCAGGCGAGATGGGG + Intergenic
1182943170 22:34297673-34297695 AAAGGAGAGCAGGCCAGGGGAGG - Intergenic
1185170877 22:49293306-49293328 TCTGTAGAACAGGCCTGATGGGG - Intergenic
949472295 3:4409072-4409094 TATAGAGAGCAAGTCACATGAGG - Intronic
949988859 3:9560630-9560652 TATGGCGTACAGGCCAGGTGTGG + Intergenic
950010514 3:9719701-9719723 TATACAAAGCAGGCCAGGTGTGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950455615 3:13091161-13091183 TAGGGAGTGCAGGACAGAGGTGG - Intergenic
950882167 3:16331074-16331096 TATGGAGAACACCCCAGAAGTGG - Intronic
951535594 3:23737886-23737908 TAAGAAAAGCAGGCCAGGTGTGG + Intergenic
955593281 3:60560630-60560652 TATGGCAAGCAGGCCAGATAAGG - Intronic
959152672 3:102626120-102626142 TAGAGAGGGCAGGCCAGAAGTGG - Intergenic
959590922 3:108079913-108079935 TTTCGAGAGGAGGCCAAATGGGG - Intronic
959986705 3:112581205-112581227 TATAGAGAGAAGGACTGATGGGG - Exonic
961603493 3:128077347-128077369 TGGGGAGAGCAGGCCATAAGAGG - Intronic
961739751 3:129025826-129025848 TCTGGAGAGCAGGACAGATGAGG - Intronic
962478810 3:135780716-135780738 AATGGAGAGCTAGCAAGATGAGG - Intergenic
962825353 3:139095901-139095923 AATGGTGGGCAGCCCAGATGAGG + Intronic
963068524 3:141282788-141282810 TATGAAAGGCAGGCCCGATGGGG + Intronic
966091733 3:176146365-176146387 TATGGAGAGCAGCTGAGATGTGG + Intergenic
966502380 3:180657947-180657969 TATTAATAGCAGGCCAGGTGCGG + Intronic
967354717 3:188555545-188555567 TATTGTGAGCAGATCAGATGTGG + Intronic
967756368 3:193174610-193174632 GATGGACAGCAGGCCAGATTTGG + Intergenic
968282731 3:197489428-197489450 AAAGGAGAGAAGGCCAAATGTGG + Intergenic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968427075 4:531289-531311 TCAGGAGAGCAGGCCAGATGGGG + Intronic
969720573 4:8891234-8891256 TAGGGAAAGCAGGCCTGAGGAGG + Intergenic
969888407 4:10237195-10237217 TATCAAGGGCAGGCAAGATGAGG - Intergenic
970399820 4:15706312-15706334 TATTTAGAACTGGCCAGATGTGG - Intronic
972086515 4:35223747-35223769 AATGGAAAACAGGCCAGGTGTGG + Intergenic
973026840 4:45283817-45283839 CATGGAGAGCAGGGAAGAGGGGG + Intergenic
973365142 4:49203131-49203153 CATGGAGAACAGGCAACATGTGG - Intergenic
973369355 4:49233469-49233491 CACGGAGAGCAGGCAACATGTGG - Intergenic
973391681 4:49561947-49561969 CACGGAGAGCAGGCAACATGTGG + Intergenic
973395448 4:49589323-49589345 CATGGAGAACAGGCAACATGTGG + Intergenic
973816190 4:54621606-54621628 TATGGACTGCAGGCCAGGTGCGG - Intergenic
974606959 4:64165251-64165273 TGTGGAGAGCATGCCTGATATGG - Intergenic
976880782 4:89922394-89922416 TATTGAGTACAGGCCAGGTGCGG - Intronic
977589120 4:98807175-98807197 AATGGAGAGTAAGCCAGATAAGG - Intergenic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
980496549 4:133592326-133592348 TTTGGAGAGGAGGCCAGCTGGGG + Intergenic
980622952 4:135333376-135333398 TATATAGTGCAGGCCAGGTGTGG + Intergenic
981647810 4:147019933-147019955 TATGGATAGCAGGCAAGAACTGG - Intergenic
982477728 4:155873430-155873452 TATGGACAGCAGGGGAGATAGGG - Intronic
984475923 4:180234898-180234920 GATGGAGAGCAACCCAGCTGTGG - Intergenic
985020923 4:185689541-185689563 TGTGGACAACAGGCAAGATGAGG - Intronic
1202766455 4_GL000008v2_random:152903-152925 CATGGAGAGCAGACAACATGTGG - Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987626993 5:20415048-20415070 TATGCATAGCAGCCAAGATGTGG + Intronic
987709788 5:21492409-21492431 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
988293694 5:29326154-29326176 AATGTATAGAAGGCCAGATGAGG - Intergenic
988749825 5:34181754-34181776 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
988827083 5:34948574-34948596 TAGTGAGAGCTGGCCAGGTGCGG + Intronic
988882016 5:35514395-35514417 TGTGGAGAAGAGGCCAGCTGTGG + Intergenic
991738084 5:69644958-69644980 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991760110 5:69911466-69911488 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
991787222 5:70206634-70206656 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991789660 5:70224684-70224706 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991814409 5:70499794-70499816 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991817544 5:70521086-70521108 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991839341 5:70786517-70786539 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
991879668 5:71207024-71207046 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
991882108 5:71225053-71225075 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
994421908 5:99533728-99533750 GCTGTAGGGCAGGCCAGATGGGG + Intergenic
994460934 5:100066853-100066875 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
994485081 5:100380281-100380303 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
995294031 5:110497714-110497736 TGTGTAAAGCAGGCCAGGTGGGG - Intronic
998351115 5:141502026-141502048 TAGGGAGAGCAGGCAAGCGGCGG - Intronic
998390152 5:141782157-141782179 AATGGAGAACAAGACAGATGAGG + Intergenic
1000357527 5:160414894-160414916 TCTGTAGAGCAGGCCAGGGGTGG + Intronic
1001076203 5:168629890-168629912 TATGCAGAGCATGCTAAATGGGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002968535 6:1991358-1991380 TGTGGGGAGTAGGCCAGGTGCGG - Intronic
1003302552 6:4897624-4897646 TCAGGAGACCAGGCCAGGTGTGG + Intronic
1003370667 6:5522921-5522943 TAAGGAGACAAGGCCAGATATGG + Intronic
1005547891 6:26888097-26888119 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
1006180590 6:32151451-32151473 TATGGAGACATGACCAGATGGGG - Intronic
1007565798 6:42849374-42849396 AATGAAAAGGAGGCCAGATGTGG - Intronic
1007781047 6:44254940-44254962 GATGAAGAGCTGGCCACATGCGG + Exonic
1007812024 6:44493157-44493179 GAGGGTGAGAAGGCCAGATGTGG - Intergenic
1009018652 6:57929178-57929200 GCTGTAGGGCAGGCCAGATGGGG - Intergenic
1011492918 6:87911078-87911100 GATGGAATGCATGCCAGATGTGG - Intergenic
1013247291 6:108298914-108298936 GAAGGAGAGCAGGGCAGCTGAGG + Intronic
1013702228 6:112786358-112786380 TAGGGAGCTCAGGCCAGGTGCGG - Intergenic
1013797896 6:113906453-113906475 TACGGACAGCAGGCCTCATGTGG + Intergenic
1014780834 6:125562756-125562778 GATGTATACCAGGCCAGATGGGG + Intergenic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019441152 7:1047813-1047835 AAAGGAGAGCAGGCAGGATGGGG - Intronic
1020046202 7:5042477-5042499 AATGCATAGCAGGCCAGGTGCGG + Intronic
1020468998 7:8514213-8514235 TATTGAAGGCAGGCAAGATGTGG - Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1021988380 7:26119214-26119236 TATAGTGAGCAGGCAACATGGGG - Intergenic
1022837626 7:34132420-34132442 TAGGGAGAGCAGGGCAGAACTGG - Intronic
1024345571 7:48310143-48310165 TATGGAGAGCATGCTGGCTGGGG + Intronic
1024413053 7:49069416-49069438 TAGGGAGAGCAGACCAAAAGAGG - Intergenic
1025063882 7:55836029-55836051 TATGGTAACCAGGCCAGGTGTGG - Intronic
1025928112 7:65975117-65975139 GCTGGAGGGCAGGCCGGATGGGG - Intronic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026552688 7:71381486-71381508 CCTGCAGAGCAGGCCAGGTGCGG + Intronic
1026786760 7:73306587-73306609 AAAGGAGTGGAGGCCAGATGTGG + Intronic
1027179240 7:75926503-75926525 TATTGAGTGCTGGCCAGGTGTGG + Intronic
1029016381 7:97319008-97319030 GGTGGAGAACTGGCCAGATGCGG - Intergenic
1029031081 7:97467627-97467649 AATGGCTAGCAGGCCAGATATGG + Intergenic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1030185799 7:106760475-106760497 CATGGAGAGCAGGCCCGAAAAGG - Intergenic
1030192345 7:106822176-106822198 GATGGAGAAATGGCCAGATGTGG + Intergenic
1030950434 7:115784755-115784777 GATGTAGTTCAGGCCAGATGTGG + Intergenic
1033315035 7:140290073-140290095 TCTGTAGAGCTGGCCAGAAGAGG - Intergenic
1033649298 7:143328746-143328768 TGTGAAGAGCAGGGCAGAAGGGG + Intronic
1034042189 7:147890559-147890581 TATTGATAGTAGCCCAGATGTGG + Intronic
1035344203 7:158187983-158188005 AATGGAGAGCAGGCAAGATGGGG + Intronic
1035688060 8:1540036-1540058 CAGGGAGAGCAGGCAAGAGGAGG - Intronic
1035856535 8:2982063-2982085 TATGGGTAACAGGCCAGGTGCGG + Intronic
1036177247 8:6550504-6550526 AATGGTGAGCAGGCCAGTTTTGG - Intronic
1036523853 8:9517181-9517203 TATAGTAAGCAGGCCAGGTGCGG - Intergenic
1038290595 8:26246557-26246579 AATGAAGAGCTGGCCAGGTGTGG + Intergenic
1039335311 8:36582574-36582596 TTTGGAGAGAAGACCTGATGGGG + Intergenic
1040102075 8:43514222-43514244 CATGGAAAGCAGGCAACATGTGG + Intergenic
1041884594 8:62793656-62793678 TATGGTGGGCAGGCCTGTTGAGG + Intronic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1043486234 8:80701737-80701759 TAGAGAGATCAAGCCAGATGAGG + Intronic
1044584241 8:93854492-93854514 GATGGTGAGCAAGACAGATGTGG + Intergenic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045084821 8:98670962-98670984 ACTGGAGTGCAAGCCAGATGCGG + Intronic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045993016 8:108332239-108332261 TATGGTGAGCAGAGCAGATTTGG + Intronic
1047480108 8:125273967-125273989 TATGCTGAGCAGGGCAGAGGAGG - Intronic
1048593691 8:135844807-135844829 TACAAAGAGCAGGACAGATGTGG + Intergenic
1050028134 9:1356912-1356934 GGTGGGGAGCAGGACAGATGGGG - Intergenic
1051135644 9:13917057-13917079 TCTGTTGAGCAGGCCAGGTGTGG - Intergenic
1052343023 9:27381507-27381529 TATGGAAACCAAGCCAGATGTGG + Intronic
1052877355 9:33576812-33576834 CATGGAGAGCAGGCAACATGTGG + Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053498648 9:38567581-38567603 CATGGAGAGCAGGCAACATGTGG - Intronic
1055505948 9:76949232-76949254 TATTATGAGTAGGCCAGATGTGG - Intergenic
1056203022 9:84294887-84294909 CGTGGAAAGCAGGCCATATGGGG + Intronic
1057161709 9:92893876-92893898 CATGGAGAGTAGGCAACATGTGG - Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1058937004 9:109779058-109779080 TATACACATCAGGCCAGATGCGG - Intronic
1059291549 9:113229243-113229265 TAAGGAGAGCTGGTCAGAAGTGG - Intronic
1060657367 9:125381123-125381145 TCTGGAGAGCAGGCCAGCTGGGG + Intergenic
1060798145 9:126526526-126526548 GATGGAGAGCAGGCCAGAGCCGG + Intergenic
1061446160 9:130639338-130639360 TGTGGAGAGCAGCCCATCTGCGG + Intergenic
1061550340 9:131331025-131331047 TGGGGAGAGCAGGCCACACGGGG + Intergenic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1203547210 Un_KI270743v1:137781-137803 CATGGAGAGCAGGCAACATGTGG - Intergenic
1185953642 X:4464758-4464780 AATGGAATGCAGGCCAGGTGTGG + Intergenic
1186281345 X:7996088-7996110 TATACAGTTCAGGCCAGATGTGG - Intergenic
1186767153 X:12782389-12782411 AATGGAGAGAAGGGCAGATTTGG + Intergenic
1186793048 X:13017623-13017645 TCTAGGGACCAGGCCAGATGTGG + Intergenic
1187482463 X:19670371-19670393 CATGCAGAGCAAGCCAGCTGTGG - Intronic
1187819954 X:23276785-23276807 AATGGAGACAAGGCCAGATGTGG + Intergenic
1188414249 X:29913149-29913171 TTCTGAGAGCAGGCCAGGTGAGG - Intronic
1188554788 X:31399287-31399309 TTTGGAGAGGAGTCCAGCTGTGG - Intronic
1189129364 X:38482153-38482175 TATGAAGAGCATTCCAGGTGAGG + Intronic
1190833160 X:54077399-54077421 AATGGGGAACAGGCCAGGTGTGG + Intronic
1191057258 X:56254698-56254720 TTTGGAGAGGAGTCCAGATGGGG - Intronic
1193832351 X:86304723-86304745 GATGGAGAGAAAGTCAGATGGGG + Intronic
1195614210 X:106900134-106900156 AATGGACAGCAGGCAAAATGGGG + Exonic
1197427792 X:126319757-126319779 TAAGGAGGGCTGGCCAGGTGTGG + Intergenic
1198675319 X:139124746-139124768 TATGGAGTGCAGTCCAGAGTTGG + Intronic
1199246834 X:145614621-145614643 TATGGTGAACAAGTCAGATGTGG - Intergenic
1199606685 X:149584389-149584411 ATTGGAGAGCAGTCCAGGTGAGG - Intronic
1199632438 X:149784979-149785001 ATTGGAGAGCAGTCCAGGTGAGG + Intronic
1201740951 Y:17324495-17324517 AAGGGAGTGCAGGCTAGATGTGG + Intergenic
1201941553 Y:19466018-19466040 TGTGGAGAGCAGGCAGGAAGTGG - Intergenic