ID: 908549067 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:65191319-65191341 |
Sequence | CTTTAGGCAGAAATCCAGAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908549067_908549072 | 18 | Left | 908549067 | 1:65191319-65191341 | CCATTCTGGATTTCTGCCTAAAG | No data | ||
Right | 908549072 | 1:65191360-65191382 | CAGCATTATTGGTAAATAAGAGG | 0: 1 1: 0 2: 0 3: 20 4: 162 |
||||
908549067_908549071 | 7 | Left | 908549067 | 1:65191319-65191341 | CCATTCTGGATTTCTGCCTAAAG | No data | ||
Right | 908549071 | 1:65191349-65191371 | GAGGTTTATTTCAGCATTATTGG | 0: 1 1: 1 2: 0 3: 22 4: 198 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908549067 | Original CRISPR | CTTTAGGCAGAAATCCAGAA TGG (reversed) | Intronic | ||