ID: 908549067

View in Genome Browser
Species Human (GRCh38)
Location 1:65191319-65191341
Sequence CTTTAGGCAGAAATCCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908549067_908549072 18 Left 908549067 1:65191319-65191341 CCATTCTGGATTTCTGCCTAAAG No data
Right 908549072 1:65191360-65191382 CAGCATTATTGGTAAATAAGAGG 0: 1
1: 0
2: 0
3: 20
4: 162
908549067_908549071 7 Left 908549067 1:65191319-65191341 CCATTCTGGATTTCTGCCTAAAG No data
Right 908549071 1:65191349-65191371 GAGGTTTATTTCAGCATTATTGG 0: 1
1: 1
2: 0
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908549067 Original CRISPR CTTTAGGCAGAAATCCAGAA TGG (reversed) Intronic