ID: 908550370

View in Genome Browser
Species Human (GRCh38)
Location 1:65202649-65202671
Sequence TTCATCCAATTCCCAGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908550370_908550374 20 Left 908550370 1:65202649-65202671 CCAGTTCCTGGGAATTGGATGAA 0: 1
1: 0
2: 0
3: 16
4: 184
Right 908550374 1:65202692-65202714 GCATCATTCAAGGCATTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
908550370_908550373 19 Left 908550370 1:65202649-65202671 CCAGTTCCTGGGAATTGGATGAA 0: 1
1: 0
2: 0
3: 16
4: 184
Right 908550373 1:65202691-65202713 AGCATCATTCAAGGCATTTGAGG No data
908550370_908550372 10 Left 908550370 1:65202649-65202671 CCAGTTCCTGGGAATTGGATGAA 0: 1
1: 0
2: 0
3: 16
4: 184
Right 908550372 1:65202682-65202704 TCATTACAAAGCATCATTCAAGG 0: 1
1: 0
2: 3
3: 15
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908550370 Original CRISPR TTCATCCAATTCCCAGGAAC TGG (reversed) Intronic
900132585 1:1093723-1093745 TCCATCCAGTCACCAGGAACTGG - Intronic
900502642 1:3014029-3014051 TTGGTCCTATTCCCAGGTACTGG - Intergenic
900612338 1:3549446-3549468 TTCCTCCAAAACCCAGGACCGGG + Intronic
900764616 1:4495610-4495632 TTCATCAACTTCCCAGCATCTGG - Intergenic
902367030 1:15982592-15982614 TTCTTCCAAATCCCACTAACTGG - Intergenic
902652652 1:17846568-17846590 TGCAACCACTTCCCAGGCACTGG - Intergenic
908550369 1:65202644-65202666 TTCATCCAGTTCCTGGGAATTGG + Intronic
908550370 1:65202649-65202671 TTCATCCAATTCCCAGGAACTGG - Intronic
911466958 1:98267067-98267089 TTCATTCAATTTCATGGAACAGG - Intergenic
912840530 1:113035247-113035269 TTCAGCCCATTCCCAGTAACTGG - Intergenic
913039440 1:115008347-115008369 TTCCACCAAATCCCAGTAACAGG + Intergenic
915002119 1:152603165-152603187 TTCACCGTCTTCCCAGGAACAGG - Intergenic
915895220 1:159806759-159806781 TTCCTCCTTTTCCTAGGAACTGG - Intronic
915924827 1:160008787-160008809 CTCATCCAATTCCCATGAGAAGG - Intergenic
918527252 1:185478618-185478640 TTCATCATATTCCCAGGTTCTGG - Intergenic
918908984 1:190540653-190540675 TTAATGCATTTCCCAGGAAAGGG - Intergenic
919168824 1:193928338-193928360 TTCATCCAGATACCAGGAATTGG + Intergenic
921053037 1:211524695-211524717 TTGACCCAATTCCCAGGGAATGG - Intergenic
922815887 1:228448962-228448984 TTCATGCGTTTCCCAGGAAAGGG - Intergenic
924159149 1:241212310-241212332 TGTATCCAAAACCCAGGAACAGG + Intronic
924868102 1:248008155-248008177 TTCTTCCAATTCCCAGGCTCTGG - Intronic
1063486092 10:6422647-6422669 TTCTTGCAATTACCAGGTACTGG - Intergenic
1064530703 10:16306599-16306621 TTCATCCACTTCCCTGCAAAGGG + Intergenic
1071937694 10:90549324-90549346 TTCCACCAAAGCCCAGGAACAGG - Intergenic
1073501781 10:103945879-103945901 CTCATCCACCTCCCAGGAGCCGG - Intergenic
1074651283 10:115526942-115526964 GTCTTCCATCTCCCAGGAACAGG + Intronic
1075821883 10:125321460-125321482 TTCATCCTATACTCAGAAACTGG + Intergenic
1076344463 10:129770944-129770966 TTAATCAAATGCCCATGAACAGG - Intergenic
1078426177 11:11253122-11253144 TTCTTCCAATTCCAAGAAAATGG - Intergenic
1079830388 11:25259328-25259350 TTCATCAAATTACCTGGACCAGG - Intergenic
1079937994 11:26641781-26641803 TACCTCCAATTCCGAGGAGCTGG + Intronic
1079954370 11:26844148-26844170 CTCATTCAATTCTCAGGAAGTGG + Intergenic
1079973953 11:27069642-27069664 TTGTTCCAGTTCTCAGGAACTGG + Intronic
1080076599 11:28157543-28157565 TTCCACCAATGCCCAGTAACAGG - Intronic
1083478553 11:62929047-62929069 CCCATGCATTTCCCAGGAACAGG + Intergenic
1083841613 11:65308130-65308152 TTCATTCAATTCCCAGTCATTGG + Intergenic
1083849809 11:65358499-65358521 TACATCCTACTCCCAGGATCTGG - Intergenic
1085459035 11:76682072-76682094 TTAGTCCAATGCCCAGGAAGAGG - Intergenic
1085626842 11:78080146-78080168 TTCATCCAATACCCACAAATGGG + Exonic
1087694837 11:101364779-101364801 TTCATCCATGTCCCAGCAAAGGG + Intergenic
1088013091 11:105026854-105026876 TTCCTCCACATCACAGGAACAGG + Exonic
1088016267 11:105063931-105063953 TTCCTCCACATCACAGGAACAGG + Intronic
1088018772 11:105093068-105093090 TTCCTCCACATCACAGGAACAGG + Intronic
1088021334 11:105123236-105123258 TTCCTCCACATCACAGGAACAGG + Intergenic
1089648175 11:119893954-119893976 GTCCTCCATTTCCCAGGGACAGG + Intergenic
1090267755 11:125364184-125364206 GACATCCACTTCCCAGGAACTGG - Intronic
1091012427 11:132015508-132015530 TTCATCCAATTCATAGGCATGGG + Intronic
1091424073 12:370915-370937 TTCATCCATGTCCCTGGAAAGGG + Intronic
1091935421 12:4430951-4430973 TTCATCCATTGCCCTGAAACGGG + Intronic
1093990114 12:25580504-25580526 TTCATCCTATTTCCAGGGACTGG + Intronic
1094523173 12:31214651-31214673 ATCCCCCAATCCCCAGGAACTGG - Intergenic
1095283535 12:40384480-40384502 TTCCTCCAATTCTAAGGAATAGG - Intergenic
1096878687 12:54649705-54649727 TTCACCAAGGTCCCAGGAACAGG - Intergenic
1098433978 12:70449719-70449741 TTCATACAATTACAATGAACGGG + Intergenic
1098673045 12:73254267-73254289 TTCAACCAAAGCCCAGTAACAGG - Intergenic
1098816888 12:75176811-75176833 TTGGTCAAATTCCCAGGACCTGG - Intronic
1101181975 12:102228867-102228889 TTCCTCCAGTTCACAGGCACAGG + Intergenic
1103469375 12:121167661-121167683 TGAATCGCATTCCCAGGAACTGG + Intronic
1104397023 12:128442895-128442917 TTTCTCCAATTGCCAGGAACTGG - Intronic
1106028908 13:25980482-25980504 GTCATGCATTTCCCAGGCACTGG - Intronic
1106439602 13:29754322-29754344 TTCAGCCTATACCCAGGAATGGG + Intergenic
1106583244 13:31035693-31035715 TGCCTCTAATTCCCAGGATCTGG + Intergenic
1107406775 13:40122044-40122066 ATCATGCAAATCCCTGGAACAGG - Intergenic
1109332697 13:60949624-60949646 TTCATCCAATTCTTAAGAATTGG + Intergenic
1109987370 13:70006644-70006666 TTCAACCAATTTCCAGTAAGGGG - Intronic
1110628597 13:77679440-77679462 TGCACCAAAGTCCCAGGAACAGG - Intergenic
1112477752 13:99747641-99747663 GTCAGCGAAGTCCCAGGAACAGG - Intronic
1113678801 13:112227429-112227451 TTAAACCATTTCCCAGGAAGGGG + Intergenic
1114080659 14:19199688-19199710 TTCATCCAACGCCCAGGCTCAGG - Intergenic
1114205875 14:20570792-20570814 TTCCTCCAAAGCCCAGTAACAGG - Intergenic
1116832642 14:49737464-49737486 TTTTTCTACTTCCCAGGAACTGG - Intronic
1117821098 14:59650091-59650113 TTCATCCAAGTCCCTGCAAAGGG - Intronic
1118508573 14:66444304-66444326 TTCATCAAGTTTCTAGGAACTGG + Intergenic
1120082020 14:80227507-80227529 TTCCACCAAGGCCCAGGAACAGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124185543 15:27525015-27525037 TTCATGTAATCACCAGGAACTGG + Intronic
1124381592 15:29172353-29172375 CTCATTCAATTCCAAGGAGCAGG + Intronic
1124820314 15:33038777-33038799 TCCATCCAATTTCCAACAACAGG - Intronic
1127847501 15:62884010-62884032 TGCTTCCAAATCCAAGGAACAGG - Intergenic
1130892526 15:88145184-88145206 CTCTTCCATTTGCCAGGAACTGG + Intronic
1132734392 16:1378354-1378376 TGCACCCAAGTCCCAGGATCAGG + Intronic
1134686906 16:16165486-16165508 TTCCTAGAATTCCCAGGGACAGG - Intronic
1134770958 16:16809209-16809231 CTCATCCATCTCCAAGGAACAGG - Intergenic
1138075044 16:54033841-54033863 TTCATCCCATTCCAGGGAATAGG + Intronic
1138100620 16:54249410-54249432 TTAATACAATTCCCAGGACAGGG - Intronic
1142518273 17:447565-447587 TTCACCCAATTTGCAGGATCAGG + Intergenic
1146604873 17:34249592-34249614 GGCATCCAATGCCCAGAAACTGG + Intergenic
1147119482 17:38327494-38327516 TTCAGTCACTTCCCAGGGACAGG + Exonic
1147475711 17:40709807-40709829 TTCATACAATTCCCAGGGATTGG - Intergenic
1147520177 17:41163610-41163632 TTCATCCAATTCCCTCCATCTGG - Intergenic
1147738447 17:42655856-42655878 TGGATCCAACTCCCAGGAATTGG + Intergenic
1155723247 18:29046057-29046079 TTCATCCAAGTCCCTGCAAAGGG + Intergenic
1156551192 18:38019190-38019212 TTCATACACTTTCCAGGAAGAGG - Intergenic
1156796295 18:41050518-41050540 TTCATCCCATGACCAGGAACCGG + Intergenic
1162194538 19:8974249-8974271 CTCATCCAATCCCCAGGAATAGG + Exonic
1165656064 19:37533286-37533308 TGCATCAATTTCCCCGGAACAGG + Exonic
1166001347 19:39879387-39879409 CTCATTTAATTCCCAGTAACAGG + Intronic
1166004130 19:39895638-39895660 CTCATTTAATTCCCAGTAACAGG + Intronic
926121957 2:10246163-10246185 TTCATCCAATTCCATGGCCCAGG - Intergenic
927286494 2:21362451-21362473 TTCCTGCACTTCCCAGTAACAGG - Intergenic
927398171 2:22679904-22679926 TTCATCCCATTATCAGGAAATGG - Intergenic
928489068 2:31762332-31762354 TTCATCCTTTTCCCTGGAATAGG + Intergenic
932573906 2:72952356-72952378 TCCATCCCATCCCCAGGCACAGG + Intronic
935471789 2:103469636-103469658 TTCATGAATTTCCCAGGAAAGGG + Intergenic
935764811 2:106355886-106355908 TTGAAACAATTCCAAGGAACTGG - Intergenic
935978612 2:108604726-108604748 TTCATCCAACTCAGAGGAGCAGG - Intronic
937785202 2:125887707-125887729 TTCAACCAAAGCCCAGTAACAGG + Intergenic
937842662 2:126539248-126539270 TCCATCCATTTCCCAGAAGCTGG - Intergenic
939188229 2:138885190-138885212 TTCCTCCTAATCCCAGAAACTGG + Intergenic
940409917 2:153349674-153349696 TTAATCCAACTCCTAGGAAAAGG + Intergenic
940706977 2:157118239-157118261 TTCCTCCAATTCAGAGGAACTGG + Intergenic
942462264 2:176176572-176176594 TTCAGCTAATTCTCAGGAAAAGG - Intergenic
946819183 2:223612895-223612917 TTCAGTGAATTCCCAGGGACTGG - Intergenic
947545484 2:231007573-231007595 TTCCTCCTATTCCCAGTAACTGG - Intronic
1169817803 20:9676483-9676505 TTCACACAGTTCCCAGGAATAGG - Intronic
1174384133 20:50176607-50176629 TTCATCCAGTTCTCAGGGCCAGG - Intergenic
1177174657 21:17690628-17690650 TTCATGAATTTCCCAGGAAAAGG - Intergenic
1177529694 21:22343269-22343291 TTCATGAAATTTCCAGGAAAAGG + Intergenic
1180500115 22:15922997-15923019 TTCATCCAATGCCCAGGCTCAGG + Intergenic
1181451224 22:23023050-23023072 TTCATCCATTATCCAGTAACAGG + Intergenic
1182238922 22:28899115-28899137 TTCATCTAATTCCTAGGATGAGG - Intronic
1182878959 22:33716790-33716812 TTTATCCACTTCCTAGGAACCGG - Intronic
949170036 3:986583-986605 TTCAACCAAAGCCCAGTAACAGG + Intergenic
952830106 3:37557501-37557523 TTGTTCCAACTCCCATGAACTGG - Intronic
953978369 3:47399756-47399778 TTAAACCAAGTCCCAGGAAGGGG - Intronic
954289343 3:49641206-49641228 TTCATTCCATTCCCTGGATCTGG - Intronic
954692314 3:52402152-52402174 TTCCTCCCATTCCCAGGGCCTGG + Exonic
956603655 3:71049994-71050016 GTCATCCACTTCCCAGGCAAAGG - Intronic
961053083 3:123763914-123763936 TTCATGGAACTCCCATGAACTGG + Intronic
961099417 3:124185924-124185946 TTCCTCCATCTCCCAGCAACTGG - Intronic
964748569 3:160034067-160034089 TTCCTCCAAATGCCAGGAAATGG + Intergenic
966242598 3:177771143-177771165 TACATCCAATTCACAAGAATTGG - Intergenic
967144019 3:186590773-186590795 TTCCTCTAATTCTCAGCAACTGG + Intronic
968636829 4:1685022-1685044 TCCAGCAAATTCCCAGGAAGGGG + Intergenic
969976276 4:11105317-11105339 TTCATCCATGTCCCAGCAAAGGG - Intergenic
972191381 4:36595764-36595786 TTTATGCAATTTCCAGGAAGGGG + Intergenic
974060716 4:57032486-57032508 TGCATCCAATTCCCAAGGACAGG - Exonic
975742876 4:77447396-77447418 CTCATGCAATTATCAGGAACAGG + Intergenic
977126127 4:93170661-93170683 TAAATCCAATTCCCAGAAAGAGG + Intronic
983027395 4:162755315-162755337 TTCCACCAAATCCCAGTAACAGG - Intergenic
984038772 4:174703073-174703095 ATCAACAAATTGCCAGGAACTGG + Intronic
984239843 4:177205143-177205165 ATCATGCAATTACCAGGCACTGG - Intergenic
984504218 4:180596313-180596335 TTCATGCAATATCCAGGAGCTGG + Intergenic
990503546 5:56422276-56422298 TTGGACCAAGTCCCAGGAACTGG + Intergenic
990638434 5:57755906-57755928 CACATTCTATTCCCAGGAACTGG + Intergenic
991611745 5:68456621-68456643 TTCATTCAAATCCCTGGAGCTGG - Intergenic
994228474 5:97283677-97283699 TTCATCCTAGACACAGGAACAGG - Intergenic
994458137 5:100040266-100040288 CTTTTCTAATTCCCAGGAACAGG - Intergenic
998024016 5:138797799-138797821 TCCTTCCAGTTCTCAGGAACTGG - Intronic
998380226 5:141719169-141719191 TTAATACACTTCCCAGGAAGGGG - Intergenic
998969074 5:147571755-147571777 TTTATTCAGTTCTCAGGAACCGG - Intergenic
1000023099 5:157336016-157336038 TTCATGGGCTTCCCAGGAACTGG - Intronic
1002948607 6:1786420-1786442 TGCATCCTATTCCCAGAGACTGG - Intronic
1003726048 6:8765550-8765572 CTTATCCAGTTCCCAGGCACTGG - Intergenic
1004736154 6:18408570-18408592 ATCCTCCATTTCCCAGGGACTGG + Intronic
1007245450 6:40458759-40458781 TCTTTCCAATTCCCAGGAGCTGG + Intronic
1008022191 6:46592165-46592187 TTCATTCCATTTCCAGGAAAGGG + Intronic
1011461649 6:87611236-87611258 TTCATGCAAGTCCTAGGATCTGG - Intronic
1014112865 6:117639329-117639351 TACTTCAAATGCCCAGGAACTGG + Intergenic
1014753269 6:125276384-125276406 TTCAGCCCCTTCCCAGGACCTGG - Intronic
1014986171 6:128013148-128013170 TTCATGGAAGTCCCAGGAAAAGG - Intronic
1015183694 6:130388795-130388817 TTGATGCAATTCCCACAAACTGG - Intronic
1016075532 6:139790714-139790736 TTCTTTCTATTACCAGGAACAGG - Intergenic
1019338832 7:498528-498550 TACATCCATGTCCCAGGAAAGGG + Exonic
1019932831 7:4234921-4234943 TTCTTCCTAATCCCAGGAAGAGG - Intronic
1021954974 7:25815268-25815290 TTCATCCAATTCCCAGCCAGGGG - Intergenic
1021960769 7:25870925-25870947 TTCACCCAATTCCCATGAGGTGG - Intergenic
1026481728 7:70785324-70785346 TTCTTCCAATGGGCAGGAACAGG - Intronic
1029176920 7:98671201-98671223 TTCCTCCATCTCCCAGGAATAGG + Intergenic
1030252709 7:107464974-107464996 TCCATCCATTTCTCAGGAAGGGG - Intronic
1030673954 7:112365562-112365584 TTCATCCATGTGCCAGCAACAGG + Intergenic
1032147571 7:129398088-129398110 ATCCTTCAATTCCTAGGAACAGG + Intronic
1033651176 7:143345317-143345339 TTCATCCATTTAGCAGGTACGGG - Intronic
1036709813 8:11071054-11071076 TTCATCTCATTCACTGGAACAGG + Intronic
1037276715 8:17188247-17188269 TTCATCCAATACCCTGAAGCTGG + Intronic
1037634687 8:20691270-20691292 TCCTTCAAATCCCCAGGAACTGG - Intergenic
1038163479 8:25062533-25062555 TTCATGTACTTACCAGGAACTGG - Intergenic
1041043228 8:53867342-53867364 CTCATCCAAATCCCAAGAGCTGG - Intronic
1044923677 8:97191037-97191059 TTGATCCAATTACCAGCAACAGG - Intergenic
1045333399 8:101177163-101177185 TCCAGCCAATTCCCAGCAGCTGG + Intergenic
1046089638 8:109485683-109485705 TTCATCCAAATCTCAGGAAGTGG + Intronic
1046949222 8:120003829-120003851 TTCATCAACCACCCAGGAACTGG + Intronic
1047956993 8:129983906-129983928 TACATCCCATTGGCAGGAACCGG + Intronic
1048333303 8:133485719-133485741 TTCTTCCCATTCCCAGGGGCAGG + Intronic
1052502717 9:29312734-29312756 TTCATCCAAGGCCCTGGAAGGGG - Intergenic
1056520042 9:87392513-87392535 TTCACTCAATTATCAGGAACAGG + Intergenic
1057218574 9:93243381-93243403 TTCAGCCAACTGCCAGGGACGGG - Intronic
1059703184 9:116795588-116795610 TTCATCAAATGCCCAGGATAGGG - Intronic
1059996124 9:119911815-119911837 TTCATGCAATACCTAGGAAAAGG - Intergenic
1060529976 9:124342381-124342403 TTCATCCAAATCCCAGCTCCAGG + Intronic
1188329777 X:28854837-28854859 TGCATTCTGTTCCCAGGAACTGG - Intronic
1188801019 X:34529741-34529763 TTCTTGCTTTTCCCAGGAACAGG - Intergenic
1189154879 X:38746702-38746724 TTCCACCAAATCCCAGTAACAGG + Intergenic
1191842189 X:65521242-65521264 TTCATTCATTCCCCAGGCACTGG + Intronic
1194580559 X:95665929-95665951 TCCTTCCATTTCCCAGGAAGGGG + Intergenic
1194833962 X:98658822-98658844 TTCTGCCAAATCCCAGTAACAGG - Intergenic
1194836312 X:98687360-98687382 TTCATCCATTTCCCTGCAAAGGG + Intergenic
1194909156 X:99617834-99617856 TTCATCCATGTCCCAGAAAAGGG + Intergenic
1196890820 X:120289020-120289042 TTCACCCAAGTCAAAGGAACAGG + Intronic
1197804805 X:130388576-130388598 TTCATCCAAGTCCCTGCAAAGGG - Intergenic
1199305974 X:146268190-146268212 CTCACCCCATTCCCAGGCACTGG - Intergenic