ID: 908550857

View in Genome Browser
Species Human (GRCh38)
Location 1:65207358-65207380
Sequence CCTATAAGCTTCCTGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1120
Summary {0: 1, 1: 1, 2: 25, 3: 169, 4: 924}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908550846_908550857 30 Left 908550846 1:65207305-65207327 CCCTTGGGCACAAGAAGTCCTCC 0: 1
1: 0
2: 11
3: 167
4: 1074
Right 908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG 0: 1
1: 1
2: 25
3: 169
4: 924
908550847_908550857 29 Left 908550847 1:65207306-65207328 CCTTGGGCACAAGAAGTCCTCCC 0: 1
1: 0
2: 75
3: 567
4: 2261
Right 908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG 0: 1
1: 1
2: 25
3: 169
4: 924
908550851_908550857 12 Left 908550851 1:65207323-65207345 CCTCCCATCTCAGCTTTGGGGTC 0: 1
1: 0
2: 3
3: 17
4: 212
Right 908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG 0: 1
1: 1
2: 25
3: 169
4: 924
908550853_908550857 8 Left 908550853 1:65207327-65207349 CCATCTCAGCTTTGGGGTCTTTT No data
Right 908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG 0: 1
1: 1
2: 25
3: 169
4: 924
908550852_908550857 9 Left 908550852 1:65207326-65207348 CCCATCTCAGCTTTGGGGTCTTT No data
Right 908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG 0: 1
1: 1
2: 25
3: 169
4: 924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908550857 Original CRISPR CCTATAAGCTTCCTGAGGGC AGG Intronic
900753995 1:4420834-4420856 ACTGTAAGCTCCATGAGGGCAGG - Intergenic
900990981 1:6098229-6098251 CCTAGAACCTTCCTGAAGGGTGG - Intronic
901205000 1:7489568-7489590 ACTGTGAGCTTCCTAAGGGCTGG - Intronic
901593407 1:10365793-10365815 CCTGTAAGCTTGTTGAGGGTAGG - Intronic
901665916 1:10826062-10826084 CCCCACAGCTTCCTGAGGGCAGG + Intergenic
901777473 1:11570258-11570280 CATGTGAGTTTCCTGAGGGCAGG - Intergenic
901781114 1:11595281-11595303 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
902094736 1:13933641-13933663 CCTGTCAGCTCCATGAGGGCTGG - Intergenic
902104891 1:14026776-14026798 ACTGTGAGCTTCCTGAGAGCAGG - Intergenic
902243979 1:15107223-15107245 TCTGTAAGCTTCGTGAAGGCAGG - Intronic
902264793 1:15255608-15255630 CCTAGCAGCTTCCTGATTGCAGG - Intronic
902287350 1:15415181-15415203 GCTATAAGCCTCTTGAGGGCAGG - Intronic
902422228 1:16290014-16290036 AATATAAGCTCCATGAGGGCAGG + Intronic
902608743 1:17584478-17584500 AATATAAGCTTCACGAGGGCAGG - Intronic
902682290 1:18051856-18051878 ACTGTGAGGTTCCTGAGGGCAGG + Intergenic
902857635 1:19220600-19220622 ACTGTAAGCTCCATGAGGGCAGG + Intronic
902897208 1:19486876-19486898 TCTATGAGCTCCCTGAGGACAGG - Intergenic
903046774 1:20570233-20570255 CTTACTAGCTTCTTGAGGGCTGG - Intergenic
903052815 1:20614173-20614195 CCTATGAGCTCTGTGAGGGCAGG - Intronic
903373069 1:22849402-22849424 ACTATCAGCTCCCTGAGGTCAGG + Intronic
903427088 1:23261960-23261982 ACTACCAGCTTCCTGATGGCGGG - Intergenic
903664841 1:24999955-24999977 ACTGAAAGCTCCCTGAGGGCAGG + Intergenic
903714029 1:25349848-25349870 AATATAAGCTTCATGAGGACAGG - Intronic
903773983 1:25781366-25781388 CCTCTAAGTTTGCTGAGGCCTGG - Intronic
903803258 1:25985635-25985657 ACTATAATCTTCCTGAAGGTAGG + Intronic
904010514 1:27387293-27387315 GCTGTAAGCTTCATGAAGGCAGG + Intergenic
904203921 1:28840244-28840266 TATATAAGCTCCCAGAGGGCAGG - Intronic
904787036 1:32990968-32990990 CCTATAAGCTCCTCCAGGGCAGG + Intergenic
904822469 1:33255193-33255215 ACTAGAATCTTCGTGAGGGCAGG + Intergenic
905328613 1:37176128-37176150 ACTGTGAGCTTTCTGAGGGCAGG - Intergenic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
905787271 1:40768331-40768353 CCTATAAGATGCCTGAGGGCAGG - Intronic
906108400 1:43308033-43308055 ACTCTAAGCTCCCTGAGGGCAGG - Intronic
906381883 1:45337837-45337859 AATATAAGCTCCCTGAGGGCAGG - Intronic
906551112 1:46667437-46667459 CCTCTTAGCTTCCAGAGGGAAGG - Intronic
906568794 1:46818904-46818926 ACTACAAGCCTCCTGAAGGCAGG - Exonic
906613696 1:47220828-47220850 CATGTAAGCTCCATGAGGGCAGG - Intronic
906845625 1:49188490-49188512 ACTATAATCTGTCTGAGGGCAGG - Intronic
906928440 1:50144115-50144137 ACTATAAGCTCCCTGAGGATAGG + Intronic
907083804 1:51649988-51650010 CCTCTCAGCCTCCTGAGAGCTGG + Intronic
907174261 1:52503277-52503299 ACTGTAAGCTCCATGAGGGCTGG - Intronic
907208270 1:52794549-52794571 CCTGTGAGCTCCTTGAGGGCGGG - Intronic
907251838 1:53144656-53144678 CTTATAAGCTTCCTGAAGGCAGG - Intergenic
907345966 1:53780453-53780475 CCTGTAAGCTCCCGGAGGGCAGG + Intronic
907514460 1:54984660-54984682 TCTGTGAGCTCCCTGAGGGCAGG - Intronic
907515108 1:54988808-54988830 GATAGGAGCTTCCTGAGGGCAGG - Intronic
907585403 1:55612426-55612448 AATGTAAGCTTCCTGAGAGCAGG + Intergenic
907588949 1:55647330-55647352 ACTATAAGCTTCATGAGGGCAGG + Intergenic
907641957 1:56199627-56199649 GCTATAAGCTTCATGAAGGCAGG + Intergenic
907678408 1:56540297-56540319 ATTGTAAGCTTCTTGAGGGCAGG - Intronic
907730991 1:57065502-57065524 TCTATAAGCTTGCTGAGGGCAGG + Intronic
907792196 1:57677839-57677861 ACTATGAGCTCCTTGAGGGCTGG - Intronic
907813254 1:57893517-57893539 ACTGTATGCTTCCTGAGGGCAGG - Intronic
907813504 1:57895549-57895571 ACTGTATGCTTCCTGAGGGCAGG - Intronic
907874689 1:58474138-58474160 CCTGAAAGCTCCTTGAGGGCAGG - Intronic
907911030 1:58826074-58826096 TCTGTGAGCTTCTTGAGGGCAGG + Intergenic
907918427 1:58891545-58891567 AATGTAAGCTTCATGAGGGCAGG - Intergenic
908090142 1:60677262-60677284 ACCATGAGCATCCTGAGGGCTGG - Intergenic
908413565 1:63890472-63890494 ACTATGAGCTCCCTGAGGGCAGG - Intronic
908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG + Intronic
908769908 1:67586600-67586622 CCTCTAATATTCCTGAGTGCAGG + Intergenic
909575420 1:77170535-77170557 GATATAAGCTCTCTGAGGGCAGG + Intronic
910682570 1:89882536-89882558 ACTATAACCTCCCTGAGGGCAGG - Intronic
910754290 1:90670356-90670378 ACTATAAGCTGCATGAAGGCAGG + Intergenic
910792031 1:91061430-91061452 ACTGTAAGCTTCCTGAGGACAGG - Intergenic
910864086 1:91771848-91771870 ACTGTGAGCTTCTTGAGGGCAGG - Intronic
910874587 1:91866519-91866541 GATATAAGCTCCCTGAGGGCAGG - Intronic
911103841 1:94114859-94114881 GCAGTAAGCTTCCTGAGGACAGG + Intronic
911389445 1:97220498-97220520 CATGCAAGCTTCCTGAGGGCAGG + Intronic
911499977 1:98673542-98673564 AGTATAAGCTTCATGAGAGCAGG + Intronic
911661260 1:100504039-100504061 ACTATATGCTTTGTGAGGGCAGG + Intronic
911708703 1:101044061-101044083 ACTATAAGCTTTCTGACAGCAGG + Intergenic
911730364 1:101286547-101286569 GGTATAAGCTTCCTGATGGAAGG + Intergenic
912446637 1:109741334-109741356 AATGTAAACTTCCTGAGGGCAGG - Intronic
912491056 1:110063088-110063110 TCTAGAAGCTTCCTGAAGGATGG - Intronic
912549277 1:110474190-110474212 ACTACAAGCTCCCTGAGGGCAGG + Intergenic
912585354 1:110759128-110759150 ACTATAAGCTTCTTAAGGGCAGG + Intergenic
912595926 1:110875645-110875667 CCTAGGAGCTTCCTGAGGACAGG - Intronic
912824098 1:112889563-112889585 CCTATAAATTGCCTGAGGGCAGG + Intergenic
913279725 1:117174382-117174404 ACTATAAGCTTCTTGAGGGCAGG - Intronic
913335694 1:117707509-117707531 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
913547434 1:119883193-119883215 GCTATAAGCTCCAGGAGGGCAGG - Intergenic
913556725 1:119974870-119974892 GCTATAAGCTCCAGGAGGGCAGG + Intronic
914389125 1:147202674-147202696 CATATAAAATTCCTGAGGCCAGG - Intronic
914422752 1:147544115-147544137 ACTGTAAGTTCCCTGAGGGCAGG - Intronic
914940088 1:152014821-152014843 CCTCTAAGCTTCCACAGGGGAGG + Intergenic
915009610 1:152673412-152673434 GGTAAAAGCTTCCTGAGAGCAGG + Intergenic
916168171 1:161981607-161981629 AATATAAGCTTCAGGAGGGCAGG + Intergenic
916474496 1:165155733-165155755 TCTATGAGCTTCTTGAGGGCAGG + Intergenic
916495067 1:165339382-165339404 TCTATAAGCCTCCTCAGGCCTGG - Intronic
916496237 1:165350414-165350436 GCTATAAGCCTCCTGAAGGCAGG + Intronic
916550084 1:165841672-165841694 CATACAAGCTCCCTGAGGTCAGG - Intronic
916665617 1:166964419-166964441 ACTATAAGGTCCCTGAGGGCAGG + Intronic
916887493 1:169084243-169084265 ACTGTGAGCTTCCTGAGGGCAGG - Intergenic
916933319 1:169602237-169602259 AATATAAGCTTCTTGAAGGCAGG - Intronic
917145273 1:171884096-171884118 CCTAGAAGTTTCGTCAGGGCTGG - Intronic
917200871 1:172513788-172513810 TCTATATTCTTCCTCAGGGCTGG - Intergenic
917539037 1:175895761-175895783 ACTGTAAGCTCCCTGAGGGCAGG - Intergenic
917543781 1:175940951-175940973 ACAATAAGCTTCTTGAGGGTAGG + Intergenic
917948957 1:180008707-180008729 ACTATAAGCTCCATGAAGGCAGG - Intronic
917970903 1:180206846-180206868 CCTCTAAGCTTCACCAGGGCTGG + Intergenic
917999903 1:180483459-180483481 ACTGTAAGCTTCCTAAGAGCAGG + Intronic
918068695 1:181119321-181119343 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
918128130 1:181602212-181602234 AGTACAAGCTTCATGAGGGCAGG + Intronic
918384583 1:183992934-183992956 TTTATAAGCTCCATGAGGGCAGG + Intronic
918450389 1:184651776-184651798 ACTATAAGCCTCATGAGGGCAGG + Intergenic
920089205 1:203440475-203440497 CCTGCAAGCTGCCTGAGGGTGGG - Intergenic
920261288 1:204689706-204689728 CCTGGGAGCTCCCTGAGGGCAGG - Intergenic
920739677 1:208568833-208568855 GCTATAAGCTCTTTGAGGGCAGG - Intergenic
920988452 1:210912870-210912892 GCTCTAAGCTTCCTGAGGGTGGG - Intronic
921165730 1:212505525-212505547 ACTGTAAGTTCCCTGAGGGCAGG - Intergenic
921683210 1:218058951-218058973 CCTATAACTTTCATCAGGGCAGG - Intergenic
921711349 1:218376749-218376771 GCTATAAGCTACTTGAGGGCAGG - Intronic
921790329 1:219282574-219282596 CCTAGAAGCTTCCAAAGGGGAGG + Intergenic
921803600 1:219429858-219429880 ACTGTAAGCTTCTTGAGGGCAGG - Intergenic
921932007 1:220762447-220762469 ACTACAAGCTCCTTGAGGGCAGG + Intronic
922559225 1:226556346-226556368 ACTGTCAGCTTCTTGAGGGCAGG - Intronic
922605029 1:226884947-226884969 ACTATAAGCTTTCTGAGGATGGG - Intronic
922956774 1:229609132-229609154 ACTATATGCTCCATGAGGGCGGG - Intronic
922961610 1:229651637-229651659 ACTATAAGCTCCTTAAGGGCAGG - Intronic
923307020 1:232697564-232697586 CCTGTGAGCTTTCTCAGGGCAGG + Intergenic
923836134 1:237613302-237613324 AATATAAGCTCCCTGGGGGCAGG + Intronic
923842880 1:237693017-237693039 ACTATAGGCTTCTTGAAGGCCGG - Intronic
923999504 1:239535022-239535044 AATGTAAGCTGCCTGAGGGCAGG - Intronic
924018443 1:239754086-239754108 AGTATAAGCTCCCTTAGGGCAGG - Intronic
924200966 1:241658053-241658075 AATATAAGCTCCCTGAGGGCAGG + Intronic
924502228 1:244648580-244648602 ATTATAAGCTTCATGAGGGTAGG + Intergenic
1063152891 10:3352857-3352879 GATAGAAGCTCCCTGAGGGCAGG - Intergenic
1063606058 10:7523920-7523942 ACAGTAAGCTCCCTGAGGGCAGG + Intergenic
1063739814 10:8805488-8805510 AATATAAGCTACTTGAGGGCAGG - Intergenic
1063778082 10:9287503-9287525 ACTGTAAGCTTCTTGAAGGCAGG - Intergenic
1063877760 10:10497783-10497805 ACTGTAAGCATCCTAAGGGCTGG + Intergenic
1064002464 10:11674907-11674929 ACTCTAAACTTCTTGAGGGCAGG - Intergenic
1064648248 10:17482179-17482201 AATATAAACTTCATGAGGGCAGG + Intergenic
1065129165 10:22602928-22602950 ACTTTAAACTGCCTGAGGGCAGG - Intronic
1065775144 10:29112848-29112870 ACTGTAAGCTTCCTAAGGGAGGG - Intergenic
1066021842 10:31311679-31311701 CCTGTAAGCTTCTTGAGGTCAGG + Intergenic
1066119216 10:32267539-32267561 AGTATAAGCTCCATGAGGGCAGG + Intergenic
1068634260 10:59331094-59331116 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
1068744959 10:60519366-60519388 GCTATAAGCTCCTGGAGGGCAGG - Intronic
1068980771 10:63060252-63060274 GCTGTAAGTTTCCTGAGGGAAGG + Intergenic
1069346606 10:67477287-67477309 CCTACAGGTTTCCTGATGGCAGG - Intronic
1069507206 10:69011357-69011379 AATATAAGCTTCTTGAGAGCTGG + Intronic
1069608068 10:69752814-69752836 CCAGGGAGCTTCCTGAGGGCAGG - Intergenic
1069821402 10:71230777-71230799 CCCATAATCTTTCTGTGGGCGGG - Intronic
1069893263 10:71665134-71665156 AATATAAGCTTTATGAGGGCAGG - Intronic
1070401579 10:76057464-76057486 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
1071534889 10:86420286-86420308 CATGTAAGCTTCATGAAGGCAGG - Intergenic
1072040755 10:91603908-91603930 ACTGTGAGCTTCTTGAGGGCAGG + Intergenic
1072104359 10:92259706-92259728 ACTCTAAGCTTCTTGAGGCCAGG + Intronic
1072178671 10:92957000-92957022 CCTCTGAGCTTCTTGAGGGCAGG - Intronic
1072238146 10:93470745-93470767 ACTATAAGCTGCATGTGGGCAGG + Intronic
1072324527 10:94284671-94284693 AGTAAAAGCTTTCTGAGGGCAGG - Intronic
1072611554 10:97020607-97020629 CCTCTGAGCTTGCAGAGGGCAGG + Intronic
1072826217 10:98609268-98609290 ACTGTAAGCTCCTTGAGGGCAGG + Intronic
1072909165 10:99484677-99484699 ACTATGACCTTCCTGTGGGCAGG - Intergenic
1072934643 10:99700470-99700492 AATGTAAGCTTCCTGAGGACAGG + Intronic
1072983591 10:100120207-100120229 CCCTTAAGCTCCCGGAGGGCTGG - Intergenic
1073046473 10:100641999-100642021 ACTCTAAGCTCTCTGAGGGCAGG + Intergenic
1073107002 10:101037929-101037951 ACTATAAACTTCATGAGGACAGG - Intronic
1073295106 10:102434007-102434029 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
1073387794 10:103141800-103141822 AATATAAGTTTCATGAGGGCTGG - Intronic
1073582165 10:104678621-104678643 ACTGTTAGCCTCCTGAGGGCAGG + Intronic
1073786285 10:106893416-106893438 CCTATAAGCTCTCTGAGGGCAGG + Intronic
1073788600 10:106917264-106917286 ACTCTAAGCTTCTTGAGGACTGG + Intronic
1073816037 10:107207957-107207979 ACTATATGCTCCATGAGGGCAGG + Intergenic
1073837052 10:107456342-107456364 CCTATAAGCCACCTAAGAGCAGG + Intergenic
1074033651 10:109715567-109715589 CTTATAAGCTGCTTGAGGGAAGG - Intergenic
1074266757 10:111912020-111912042 AGTATAAGCTTCATGAGAGCTGG - Intergenic
1074285881 10:112097910-112097932 AGTATAAGCTTCCTGAGGATAGG + Intergenic
1074287464 10:112111492-112111514 CCTGTGAGCTCCATGAGGGCAGG - Intergenic
1074693445 10:116027279-116027301 ACTATGACCTTCCTGAGGGTAGG + Intergenic
1074816154 10:117142231-117142253 CTGCTAAGCTTCCTGCGGGCAGG + Intergenic
1075889599 10:125935272-125935294 ACTATAAGCTTCCTGAAGGCAGG + Intronic
1076119683 10:127925592-127925614 ACTAAAAGCTTCCTGTGGCCTGG - Intronic
1076545180 10:131240422-131240444 CCCATAAATTTCCTGAGAGCAGG + Intronic
1077614395 11:3664696-3664718 ACCATGAGCTTCCTGAGGGAAGG + Intergenic
1077894831 11:6446461-6446483 ACTATAAGCTTAATAAGGGCAGG + Intergenic
1078038626 11:7835905-7835927 AATATAAGCTCCATGAGGGCAGG - Intergenic
1078181922 11:9018969-9018991 AATGTAAGCTTCATGAGGGCAGG + Intergenic
1078851252 11:15166003-15166025 TATGTAAGCTTCCTGGGGGCAGG + Intronic
1078974855 11:16461924-16461946 ACTCTAAGGTTCTTGAGGGCAGG + Intronic
1079312476 11:19378843-19378865 GCTCTGAGCTCCCTGAGGGCAGG + Intronic
1079349373 11:19679781-19679803 GGTATGAGCTTCCTGAGGGCAGG + Intronic
1079461207 11:20679741-20679763 TCTGTAAGCTTCAAGAGGGCAGG + Intronic
1079961963 11:26935452-26935474 AATATAAGCTTCTGGAGGGCAGG + Intergenic
1080125892 11:28733231-28733253 AAAATAAGCATCCTGAGGGCAGG + Intergenic
1080399228 11:31918850-31918872 AATGTAAGCTTCATGAGGGCAGG - Intronic
1080403179 11:31955866-31955888 ACTATAAGCTTCGTGAGGGCGGG - Intronic
1080694824 11:34594202-34594224 TGTATAAGCTCTCTGAGGGCAGG + Intergenic
1080748950 11:35135259-35135281 CCTCTAAGCTACCTGAGAACAGG - Intergenic
1081219319 11:40440125-40440147 ACTATAAGTTACATGAGGGCAGG + Intronic
1081321476 11:41696871-41696893 TCTATAAGCTTAGTGAGGGCAGG + Intergenic
1081617512 11:44599562-44599584 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
1081654019 11:44845479-44845501 TCTACAAGCTCCGTGAGGGCAGG - Intronic
1081806110 11:45891511-45891533 GCTGCAAGTTTCCTGAGGGCAGG - Intronic
1081837215 11:46165712-46165734 ATTATAAGCTTATTGAGGGCAGG + Intergenic
1082819627 11:57536200-57536222 GCTTTAAGCTCCATGAGGGCAGG - Intergenic
1083019386 11:59491237-59491259 ACTATAAGTTTCCTAATGGCTGG + Intergenic
1083129721 11:60613817-60613839 AATATAAGCTCCCTGAAGGCAGG - Intergenic
1083287677 11:61670880-61670902 ACTAGAAGCTTCATGTGGGCAGG - Intergenic
1083796181 11:65018091-65018113 AGTGTAAGCTTCCTAAGGGCAGG + Intronic
1083943735 11:65912498-65912520 CCTAATAGCCTCCTGAGTGCTGG + Intergenic
1084229808 11:67743424-67743446 AATGCAAGCTTCCTGAGGGCAGG + Intergenic
1084439269 11:69162169-69162191 ACTGCAAGCTACCTGAGGGCAGG - Intergenic
1084590878 11:70089537-70089559 CCTTTCACCTTCCTGAGGTCTGG + Intronic
1085384529 11:76149593-76149615 CCTGGCAGCTTCCTGAGGGCAGG - Intergenic
1085774091 11:79350077-79350099 TCTGGAAGTTTCCTGAGGGCAGG - Intronic
1086259056 11:84915901-84915923 ACTATAAGCTACTTGAGGGCAGG - Intronic
1086384309 11:86291448-86291470 CATATAAGCTTCAAGAGGGCAGG - Intergenic
1086496702 11:87411373-87411395 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
1086940440 11:92792233-92792255 ACTCTAAGCTTCTTGAGGGCAGG + Intronic
1087086800 11:94227800-94227822 ACTATAAGCCTCATGAGAGCAGG - Intergenic
1088086075 11:105981977-105981999 ACTGTAAGCTCCTTGAGGGCAGG + Exonic
1088212270 11:107469880-107469902 AATATAAGCTTAGTGAGGGCAGG - Intergenic
1088232749 11:107689592-107689614 CATATAAGCTTCTTGAGAACAGG + Intergenic
1088543856 11:110940379-110940401 CCACCAAGCTTCTTGAGGGCAGG + Intergenic
1088612632 11:111592522-111592544 ATTATATGCTCCCTGAGGGCTGG + Intergenic
1088621111 11:111685042-111685064 CATTTAAGCTTCCTGAAGACAGG - Intronic
1088735661 11:112725786-112725808 CCTGCAAGCTCCCTGAGGACAGG - Intergenic
1088852941 11:113720273-113720295 ACTATAAGCTCCCTGAGGGTAGG - Intergenic
1089112683 11:116069303-116069325 CGTGTAAGCTCCTTGAGGGCAGG + Intergenic
1089316109 11:117592440-117592462 CCTGGAAGCCCCCTGAGGGCTGG + Intronic
1089348261 11:117805793-117805815 AATGCAAGCTTCCTGAGGGCAGG - Intronic
1089349552 11:117814653-117814675 CTTATAAGCTACATGAGGGAGGG - Intronic
1089513067 11:119013027-119013049 ACTGTGAGCTTCCTGAGGACAGG + Intronic
1089568123 11:119383187-119383209 AATGTAAGCTCCCTGAGGGCAGG - Intergenic
1090211729 11:124925463-124925485 CCTATAAGCTTCATAGGGGTAGG - Intronic
1090470195 11:126974007-126974029 CCTGTGTGCTCCCTGAGGGCAGG + Intronic
1090502031 11:127270384-127270406 AATGTAAGCTTCCTGAGGACAGG - Intergenic
1090730740 11:129571603-129571625 ACTATAAGCTCCTTGAGAGCAGG - Intergenic
1091034819 11:132223576-132223598 ACTCTAAGCTTCATGAGGGCAGG + Intronic
1091109687 11:132954242-132954264 ACTATAAACTCCTTGAGGGCAGG - Intronic
1091171546 11:133524034-133524056 ACTGTAAGCTTCATGAGAGCAGG + Intronic
1091639416 12:2223802-2223824 CATATAAGTTTCTTGAGGGATGG - Intronic
1091841746 12:3626515-3626537 AACATAAGCTTCATGAGGGCAGG + Intronic
1091894235 12:4088109-4088131 CCTCTTAGCTTCCTGAGGGCTGG + Intergenic
1092810856 12:12270120-12270142 GCTGTAAGCTTCTTGAGGGTAGG - Intergenic
1093007996 12:14071763-14071785 ATTATAAACTTCCTGAGGCCAGG - Intergenic
1093083250 12:14838030-14838052 TCTATAAGCTCCCTGGGGGCAGG - Intronic
1094045690 12:26163934-26163956 CCTCTAAGCTTCTTGACAGCAGG - Intronic
1094355484 12:29573480-29573502 CTCATAAACTCCCTGAGGGCTGG - Intronic
1095400146 12:41804923-41804945 ACTTTAATCTTCCTGAGGCCAGG - Intergenic
1095743508 12:45632530-45632552 GATATAAGCTTCTTGAGGACAGG - Intergenic
1096253622 12:50050000-50050022 CCCATAAGCTCCTTGAAGGCAGG + Intergenic
1096407896 12:51357223-51357245 ACTGGAAGCTTCCTGAGGGCAGG + Intronic
1096417760 12:51428301-51428323 GTTAGAAGCTTCTTGAGGGCAGG + Intronic
1096525987 12:52210782-52210804 CCTGGAAGCTTCCCAAGGGCAGG + Intergenic
1096533513 12:52256629-52256651 ACTATAAGCTCCCTCAGGGCAGG + Intronic
1096625116 12:52890287-52890309 ACTGTAAGCTCCATGAGGGCAGG - Intergenic
1096753196 12:53776447-53776469 TCTAAAAGCCTCCAGAGGGCAGG - Intergenic
1097178482 12:57157235-57157257 ACTATAAGCTCCATGAGGCCAGG - Intronic
1097351470 12:58553729-58553751 CTCAAAAGCTTCCTGAGGACAGG - Intronic
1097960104 12:65524008-65524030 ACTGTAATCTTCATGAGGGCAGG - Intergenic
1097980894 12:65737245-65737267 ACTGTAAGCTTCATGTGGGCAGG - Intergenic
1098008232 12:66021534-66021556 GATATAAGCTCCATGAGGGCAGG + Intergenic
1098080232 12:66776561-66776583 ATTATAAGCTTCTTGAGAGCAGG - Intronic
1098097508 12:66974420-66974442 AATATAAGCTTCATGAAGGCAGG + Intergenic
1098505506 12:71245488-71245510 TCTGTAAGCATCTTGAGGGCAGG + Intronic
1098924431 12:76333925-76333947 ACTGTGAGCTTCATGAGGGCAGG + Intergenic
1099300576 12:80889816-80889838 CCTATAAACTTCTTGAGGGTGGG + Intronic
1099404080 12:82237955-82237977 CCCATAAGCTTCTTGAGAGCAGG + Intronic
1099593669 12:84628804-84628826 GCTAAAAGCTTCATGAAGGCAGG - Intergenic
1100206968 12:92360854-92360876 TCTAGAAGCTCCCTGAAGGCAGG + Intergenic
1100282151 12:93128214-93128236 CCTATAGGGTGCCTCAGGGCGGG - Intergenic
1100555176 12:95686239-95686261 ACTATAAGTTCCCTGAGGGCTGG - Intronic
1100695281 12:97085960-97085982 ACTATAAGTTCCATGAGGGCAGG + Intergenic
1100792378 12:98144511-98144533 ACTGTAAGCTCCATGAGGGCAGG - Intergenic
1100866730 12:98865504-98865526 AATATAAGCTCCATGAGGGCAGG - Intronic
1100872152 12:98921295-98921317 GCTATGAACTTGCTGAGGGCAGG - Intronic
1100922714 12:99506928-99506950 ACTATAAGCTCCATGAAGGCTGG + Intronic
1100944391 12:99764220-99764242 CCTATAAGCTCCTTGAAGACAGG - Intronic
1101327033 12:103724544-103724566 CTTATAAGCTCTTTGAGGGCTGG + Intronic
1101496069 12:105255463-105255485 ACTATAAGCTTCTCGAGGGCAGG + Intronic
1101545717 12:105710629-105710651 ACTAGGAGCTTCCTGAGGACAGG + Intergenic
1101671763 12:106882071-106882093 ACTAAAAGCTTCTTGAGGACAGG + Intronic
1101718406 12:107331305-107331327 CCTGCAAGCTCCATGAGGGCGGG - Intronic
1101880991 12:108625584-108625606 ACTATAAGCTTCCTGAGAGCAGG - Intronic
1101898209 12:108771286-108771308 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
1102014237 12:109637352-109637374 ACTATAAGCTCCATGAGAGCAGG - Intergenic
1102037159 12:109777713-109777735 CTTATCCTCTTCCTGAGGGCTGG + Intergenic
1102415868 12:112762183-112762205 ATTATAAGCTACCTGAGGGATGG + Intronic
1102444548 12:112991831-112991853 ACTATAAGCTCCATGAGGACAGG + Intronic
1102887791 12:116534563-116534585 CATATAAATTTCCTGCGGGCCGG - Intergenic
1103173999 12:118845741-118845763 ACTATAAACTTCATGAGGACAGG + Intergenic
1103820648 12:123695354-123695376 CTTATAACCATCCTGATGGCTGG - Intronic
1104120797 12:125797864-125797886 ACTAAAAGCTTCTTGAGAGCAGG - Intergenic
1104222201 12:126795911-126795933 ACTGTAAACTACCTGAGGGCAGG + Intergenic
1104444957 12:128825099-128825121 GGTGTAAGCTTCCTGATGGCAGG + Intergenic
1104571359 12:129928800-129928822 ACTGTAAGCTGCCTGAGAGCAGG - Intergenic
1104589843 12:130075469-130075491 CCCACAAGCTTTCTGAGGCCAGG - Intergenic
1106550964 13:30770124-30770146 AATATAAGCTTCCAAAGGGCAGG + Intergenic
1106846465 13:33742913-33742935 AATGTAAGCTTCATGAGGGCAGG - Intergenic
1107032133 13:35864130-35864152 TCTATAAGCTTCTGAAGGGCAGG + Intronic
1107097319 13:36550574-36550596 ACTATAAGCTCCATGAGGACAGG - Intergenic
1107111182 13:36699789-36699811 ATTATAAGCTCCGTGAGGGCAGG - Intergenic
1107372975 13:39772426-39772448 ACTACAAGCTCCCTGAGGGCAGG - Intronic
1107477501 13:40753295-40753317 CTTCTAAGCTGCCTAAGGGCAGG + Intronic
1107953080 13:45483909-45483931 AATATAAGCTCCATGAGGGCAGG - Intronic
1108088589 13:46821959-46821981 GCTATGGGCTTCCTGAGGGCAGG + Intergenic
1108270137 13:48751360-48751382 ACTATGAGCTCCCTGAGGGCCGG + Intergenic
1109288266 13:60438069-60438091 ACTGTAAACTTCTTGAGGGCAGG + Intronic
1110101580 13:71612974-71612996 ACCATCAGCTTGCTGAGGGCAGG - Intronic
1110287922 13:73771676-73771698 ACTGTAAGCTGCCTGAGGGCAGG - Intronic
1110451368 13:75640618-75640640 TCTATGAGCTAACTGAGGGCAGG + Intronic
1110528970 13:76574484-76574506 TCTACAAGCTTCCTGAAGGCAGG + Intergenic
1110791895 13:79594618-79594640 ACAATAAGCTTTATGAGGGCAGG + Intergenic
1111337081 13:86838790-86838812 CCTAGAAGCTTCCTGAGCCAGGG - Intergenic
1111826811 13:93277751-93277773 ACTATAAGTTTTCTAAGGGCAGG + Intronic
1112203270 13:97299335-97299357 AATATAAGCTCCCTGATGGCAGG - Intronic
1112529117 13:100183416-100183438 CCTATAAACTTCTTCAGGGTAGG - Intronic
1112632017 13:101172236-101172258 CTCAGAAGCTCCCTGAGGGCAGG - Intronic
1112815946 13:103273567-103273589 AGTATAAGCCTCCTGAGAGCAGG + Intergenic
1112976004 13:105318609-105318631 TATGTAAGCTCCCTGAGGGCAGG + Intergenic
1113338813 13:109402378-109402400 ACTGGAAGCTCCCTGAGGGCAGG - Intergenic
1113505759 13:110814605-110814627 CATCTAAGCTTCATGAGGACGGG - Intergenic
1113526956 13:110987105-110987127 CCTGTGAGCTCCCTGAGAGCAGG + Intergenic
1115136765 14:30118907-30118929 CATATAAACTTCTGGAGGGCAGG - Intronic
1115274440 14:31591928-31591950 ACTATAAGCTCCATAAGGGCAGG - Intronic
1115318341 14:32050490-32050512 AATAGCAGCTTCCTGAGGGCAGG + Intergenic
1115348598 14:32368836-32368858 ACTATAAGTTTCAAGAGGGCAGG - Intronic
1115670363 14:35604562-35604584 ACTATAAGCTTCTAGAGGGCAGG - Intronic
1115708090 14:36018617-36018639 ACTGTAAGCTCCCTGAGGCCAGG + Intergenic
1115714748 14:36090770-36090792 CCTGTAAGCTCCCAGAAGGCAGG - Intergenic
1116777036 14:49193262-49193284 GCTATAAGCTCCATGAGGGCAGG + Intergenic
1116795225 14:49383084-49383106 TCTGTAAGTTTCCTGAGGGCAGG - Intergenic
1117528457 14:56635428-56635450 ACTATGAGCTTCATGAGGGTAGG - Intronic
1117933132 14:60868600-60868622 GATATGAGCTCCCTGAGGGCAGG + Intronic
1118105292 14:62652097-62652119 TATGCAAGCTTCCTGAGGGCAGG - Intergenic
1118141692 14:63090876-63090898 ATGATAAGATTCCTGAGGGCAGG + Intronic
1118333664 14:64833711-64833733 ACTGTAAGCTACCTGAGGTCAGG + Intronic
1118730302 14:68661318-68661340 GCAGTAAGCCTCCTGAGGGCAGG + Intronic
1118737897 14:68715410-68715432 ACTGTACGCTTCCTAAGGGCGGG + Intronic
1118799139 14:69173177-69173199 AATATAAGCTTCTTAAGGGCAGG - Intergenic
1118845484 14:69544886-69544908 AACATAAGCTTCATGAGGGCAGG - Intergenic
1119033175 14:71208336-71208358 CCTGTAAGCTATCTGAGGGTGGG - Intergenic
1119133027 14:72192065-72192087 ATTATAAGCTCCATGAGGGCAGG + Intronic
1119264382 14:73255344-73255366 ACTATAAGCTTCTTGAGGACTGG + Intronic
1119564585 14:75617749-75617771 ATTATAAGCTCCATGAGGGCAGG - Intronic
1119634705 14:76264556-76264578 ACTGTAAGCTTCTTGAGGGCAGG - Intergenic
1120256596 14:82127803-82127825 ACTATAAACTCCATGAGGGCAGG - Intergenic
1120708645 14:87771129-87771151 AGCATAAGCTTCTTGAGGGCCGG + Intergenic
1121076854 14:91076142-91076164 GCTATGAGCTTCTTAAGGGCAGG - Intronic
1121245902 14:92460676-92460698 CCCAGAAGCTCCCAGAGGGCAGG - Intronic
1121482242 14:94288159-94288181 GCTATAAGTTTCCTGAAGGCAGG - Intronic
1121489137 14:94345563-94345585 CCTAGTAGCTTCCTGGTGGCAGG + Intergenic
1121513647 14:94534511-94534533 CATGTAACCTTCATGAGGGCAGG - Intergenic
1121629550 14:95412391-95412413 TCTGCAAGCTCCCTGAGGGCAGG + Intronic
1122337475 14:101003311-101003333 GCTATGAGCTTCTTGAGGACAGG + Intergenic
1122848794 14:104515502-104515524 CGTATGAGCATCCTGAGGGCGGG - Intronic
1123498681 15:20858517-20858539 ACAAAAAGCTTCTTGAGGGCAGG + Intronic
1123555915 15:21432145-21432167 ACAAAAAGCTTCTTGAGGGCAGG + Intronic
1123592157 15:21869478-21869500 ACAAAAAGCTTCTTGAGGGCAGG + Intergenic
1123953621 15:25311064-25311086 CCTGTAATCCTCCTGAGGTCAGG - Intergenic
1125639168 15:41215251-41215273 AATATAAGCTCCTTGAGGGCGGG + Intronic
1125817564 15:42599815-42599837 ACTGTAAGCTTTTTGAGGGCAGG - Intronic
1126097262 15:45098321-45098343 TCTGTAAGCTCCATGAGGGCAGG + Intronic
1126111996 15:45180793-45180815 ACTGTGAGCTTCCTGAGGGCAGG + Intronic
1126331997 15:47543049-47543071 ACTGTAAGTATCCTGAGGGCAGG + Intronic
1126335686 15:47584056-47584078 TCTGTAAACTTCTTGAGGGCAGG + Intronic
1126456444 15:48867077-48867099 GCTAAAATCTTCATGAGGGCAGG - Intronic
1126490040 15:49226300-49226322 CCTGAAAGCCTCCTGAGGGAGGG - Intronic
1126740188 15:51769467-51769489 ACTACAAGCTCCTTGAGGGCAGG - Intronic
1126753761 15:51904295-51904317 ACTATATGCTTTTTGAGGGCAGG + Intronic
1126836080 15:52666774-52666796 AATATAAGCTTCATGAGGGCAGG - Intronic
1127720821 15:61697662-61697684 CCTGAAATCTCCCTGAGGGCAGG - Intergenic
1127954074 15:63837221-63837243 ACCATAAGCTCCTTGAGGGCAGG - Intergenic
1128040899 15:64572508-64572530 GATATAAGCTTCCTGAGGACAGG + Intronic
1128679556 15:69638112-69638134 ACTCTAAGCTCTCTGAGGGCAGG + Intergenic
1129607089 15:77030282-77030304 GCTCTGAGCTGCCTGAGGGCTGG - Intronic
1129670085 15:77602841-77602863 ACTGTGAGCTCCCTGAGGGCAGG + Intergenic
1129692795 15:77723362-77723384 TCTAGGAGCTTCTTGAGGGCAGG - Intronic
1129694950 15:77735197-77735219 CCCGCAAGCTTCCAGAGGGCAGG - Intronic
1129716519 15:77854877-77854899 ACTATGAGCTCCTTGAGGGCAGG + Intergenic
1129884068 15:79026487-79026509 ACCATAGGCTTCCGGAGGGCAGG + Intronic
1130132610 15:81156910-81156932 ACCATAAGCTCCCTGAGGGCAGG + Intergenic
1130218055 15:81991471-81991493 ACTGTAAGCTTCTTGAGGACAGG + Intergenic
1130220454 15:82015074-82015096 ACTGTAAGCTTCATGAGAGCAGG - Intergenic
1130444098 15:83982644-83982666 CTCATAGGCTCCCTGAGGGCTGG - Exonic
1130736209 15:86552636-86552658 CCTAGAAGTTCCATGAGGGCAGG - Intronic
1131086405 15:89579203-89579225 ACTATAAGCTCCAAGAGGGCAGG - Intronic
1131456958 15:92589081-92589103 ACTATTAGTTTCCTGAGGACAGG - Intergenic
1131517828 15:93090776-93090798 ACCATAAGCATCATGAGGGCAGG + Intergenic
1131539889 15:93267089-93267111 GCAAAAAGCTTCCTGTGGGCCGG - Intergenic
1131796155 15:96018849-96018871 ACTATAAGCTCTCGGAGGGCAGG - Intergenic
1131834114 15:96373256-96373278 CCTAAAAACTCCTTGAGGGCAGG - Intergenic
1132107525 15:99074099-99074121 CCTGGAAGCTTCATGAAGGCAGG + Intergenic
1202964258 15_KI270727v1_random:159354-159376 ACAAAAAGCTTCTTGAGGGCAGG + Intergenic
1133328419 16:4956484-4956506 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1133543271 16:6777042-6777064 TCTGAAAGCTACCTGAGGGCAGG + Intronic
1133707331 16:8367309-8367331 ACTTTAAGCTCCATGAGGGCAGG - Intergenic
1133708561 16:8379067-8379089 ACTGTAAGCTTTGTGAGGGCAGG - Intergenic
1133930842 16:10230958-10230980 CCTGTAAGCTCCATGAGGGCAGG + Intergenic
1134265455 16:12688699-12688721 ACTCTGAGCTTCTTGAGGGCAGG + Intronic
1134266924 16:12700795-12700817 ACTCTCAGCTCCCTGAGGGCAGG - Intronic
1134285339 16:12856715-12856737 ACTGTGAGCTTCTTGAGGGCAGG - Intergenic
1134336662 16:13305966-13305988 CCCATGAGCTTCTGGAGGGCAGG - Intergenic
1134511966 16:14855759-14855781 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134660227 16:15978575-15978597 ATTCTAAGCTTTCTGAGGGCAGG + Intronic
1134699607 16:16254259-16254281 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134972222 16:18540412-18540434 CCTGTAAGTTCCCTGAGGTCAGG - Intronic
1135081887 16:19443557-19443579 ACTGTGAGCTTCTTGAGGGCAGG + Intronic
1135428996 16:22366329-22366351 AATATAAGCTCCATGAGGGCAGG - Intronic
1135633308 16:24053264-24053286 AATATAAGCTCCATGAGGGCAGG - Intronic
1135642420 16:24132491-24132513 AATATAAGTTTCATGAGGGCAGG - Intronic
1135644354 16:24148379-24148401 AGTGTAAGCTTCATGAGGGCAGG + Intronic
1135668933 16:24358627-24358649 ACTGTAAACTCCCTGAGGGCAGG - Intronic
1135763450 16:25156293-25156315 CATGTAAGCTTCCTGAGAACAGG + Intronic
1135844496 16:25906510-25906532 AATATAAGCTTTTTGAGGGCAGG - Intronic
1136082042 16:27858599-27858621 ACTATCAGCTCCTTGAGGGCAGG - Intronic
1136514510 16:30759932-30759954 AATATAAGCTTCGTAAGGGCAGG - Exonic
1137468301 16:48731297-48731319 AATGTAAGCTGCCTGAGGGCTGG - Intergenic
1137516022 16:49145106-49145128 GCTGTGAGCTCCCTGAGGGCAGG - Intergenic
1137597740 16:49736004-49736026 ACTATAAGCTCCATGAGGGCAGG + Intronic
1137778178 16:51073955-51073977 AATGTGAGCTTCCTGAGGGCAGG - Intergenic
1137803560 16:51283359-51283381 ACAGTGAGCTTCCTGAGGGCAGG + Intergenic
1138075627 16:54039613-54039635 CTTGTAATCTTCATGAGGGCGGG - Intronic
1138250881 16:55501006-55501028 ACTATAAACTACATGAGGGCAGG - Intronic
1138310152 16:56016691-56016713 GCTACAAGGTTCCTGTGGGCTGG - Intergenic
1138338735 16:56273705-56273727 TTTTTAAGCTTCATGAGGGCAGG + Intronic
1138822746 16:60281356-60281378 CCAGTAAGCTTCCTGAAAGCAGG + Intergenic
1138855371 16:60685005-60685027 ACTATAAGCTCCATGAGGGCAGG - Intergenic
1139223909 16:65215363-65215385 CATGTAAGCTTCATGAGGGCAGG + Intergenic
1139339251 16:66257248-66257270 TGCATAAACTTCCTGAGGGCAGG + Intergenic
1139463912 16:67143689-67143711 AATATAAGCTCCGTGAGGGCAGG - Intronic
1139761850 16:69190471-69190493 ACTCTAAACTTCCTGAGGACAGG - Intronic
1140089546 16:71826347-71826369 ACTATAAGCTTCATGAGGGCAGG - Intergenic
1140222822 16:73056615-73056637 CCTATATTGTTCCGGAGGGCAGG + Intronic
1140680219 16:77377369-77377391 TAAATAAGCTTCCTGAAGGCAGG + Intronic
1140707758 16:77646700-77646722 CCCAAGAGCTTCCTGAAGGCAGG - Intergenic
1140833554 16:78773117-78773139 ATTGTAAGCTTCATGAGGGCAGG + Intronic
1140910891 16:79451308-79451330 CCTATTAGCCTCCTGTGGACAGG - Intergenic
1141067992 16:80929405-80929427 ACTATAACCTCCATGAGGGCAGG - Intergenic
1141216763 16:82032465-82032487 ACCATAAACTTCATGAGGGCAGG - Intergenic
1141805720 16:86340270-86340292 ACTCTAAGCTTCCGGAGGGCAGG + Intergenic
1142331904 16:89460328-89460350 CCTATAAATGTCCTGAGGTCAGG + Intronic
1142832071 17:2556587-2556609 ACTATAAGCTCCATGAGGGCAGG - Intergenic
1143044753 17:4068785-4068807 AATATAAGCTGCTTGAGGGCAGG - Intronic
1143296863 17:5877689-5877711 ACTATAAGCTTCATGAGAGTGGG + Intronic
1143558065 17:7674853-7674875 CCTATGAGCCGCCTGAGGTCTGG - Exonic
1143558562 17:7677704-7677726 CATATACACTTCCTAAGGGCAGG + Intronic
1143795470 17:9332800-9332822 AATATAAGCTCCCTGAGGGCAGG + Intronic
1143874367 17:9980714-9980736 ACTGTAAGCTCCCTGAGGGTGGG - Intronic
1144215100 17:13048434-13048456 ACTGTAAGCTACCTGAGGGCAGG + Intergenic
1144620102 17:16813173-16813195 TCTAGATGCTCCCTGAGGGCAGG - Intergenic
1144701618 17:17344336-17344358 GCTGTAAGCTCCCTGAGGGTAGG + Intronic
1144821695 17:18079260-18079282 GCTCTGAGCTTCCTGAGGGCAGG + Intergenic
1144892584 17:18502526-18502548 TCTAGATGCTCCCTGAGGGCAGG + Intergenic
1145139630 17:20441761-20441783 TCTAGATGCTCCCTGAGGGCAGG - Intergenic
1145796253 17:27656939-27656961 TCTAGATGCTCCCTGAGGGCAGG + Intergenic
1145797379 17:27663779-27663801 ACTAGAAGCTCCCTAAGGGCAGG + Intergenic
1145810692 17:27762243-27762265 TCTAGATGCTCCCTGAGGGCAGG + Intronic
1145811775 17:27768713-27768735 ACTAGAAGCTCCCTAAGGGCAGG + Intronic
1146463517 17:33066798-33066820 CCTAGATGCTTCCTGGGGCCAGG + Intronic
1146565633 17:33910608-33910630 ACTATAAACTTCATGAGGGCAGG + Intronic
1147010085 17:37438938-37438960 ACTATAAGCTTTCTGAAGACAGG - Intronic
1147047022 17:37760288-37760310 GCTGTGAGCTTCCTGGGGGCAGG - Intergenic
1147302298 17:39539619-39539641 CCCAGAAGCTTCCTGAAGGTGGG - Intronic
1147895701 17:43750004-43750026 CCTGACAACTTCCTGAGGGCTGG - Intergenic
1148155581 17:45423671-45423693 ACAGTAAGCTACCTGAGGGCAGG + Intronic
1148339905 17:46867182-46867204 ACTGTGAGCTTCTTGAGGGCAGG + Intronic
1148716219 17:49718002-49718024 ACTATAAGCCTCATGAGGGCAGG + Intronic
1148744315 17:49910046-49910068 ACTACAGGCTCCCTGAGGGCAGG - Intergenic
1148761950 17:50008890-50008912 CCTACAAGCTCCATGAGGTCAGG - Intergenic
1148775487 17:50093126-50093148 ACTTTAAGCTCCGTGAGGGCAGG - Intergenic
1149288821 17:55195764-55195786 GCTGTAAACTTCTTGAGGGCAGG + Intergenic
1149514061 17:57266728-57266750 AATGTAAGCTCCCTGAGGGCAGG + Intronic
1149967527 17:61180835-61180857 AATATAAGCTTCATGAGGACAGG + Intronic
1150068209 17:62129481-62129503 ACTATAAGCTTCATGGGGACAGG + Intergenic
1150123025 17:62619030-62619052 GCTGTAAGCTTCCTTAAGGCAGG - Intergenic
1150145788 17:62767993-62768015 CCTATCACCTTCCTGTGAGCTGG + Intronic
1150387268 17:64772333-64772355 ACAGTAAGCTACCTGAGGGCAGG + Intergenic
1150694114 17:67389516-67389538 CCTAGGAGCTTCAGGAGGGCAGG - Intronic
1150886216 17:69088996-69089018 AATATAAGCTCCATGAGGGCAGG + Intronic
1150952995 17:69823089-69823111 CTAATAAGCTTCTAGAGGGCAGG + Intergenic
1151302122 17:73234190-73234212 TCTATAAAGTTCCAGAGGGCAGG - Intronic
1151314823 17:73315314-73315336 ACTCTAGGCGTCCTGAGGGCAGG - Intergenic
1151325729 17:73378937-73378959 CCCTCCAGCTTCCTGAGGGCAGG - Intronic
1151680261 17:75619347-75619369 CCTCCAAGCCTCCTGTGGGCAGG - Intergenic
1151893761 17:76966641-76966663 CCCAGGAGCTCCCTGAGGGCAGG - Intergenic
1152317249 17:79588380-79588402 CCAAAAAACATCCTGAGGGCAGG + Intergenic
1153334817 18:3912508-3912530 ACTGTAAGCTCCCTGAGGGAAGG - Intronic
1153589955 18:6663145-6663167 ACTCTAAGCTCCCTGAGGACAGG - Intergenic
1153744711 18:8165779-8165801 ACTATAAGCTTCCAGAATGCTGG - Intronic
1153809656 18:8740826-8740848 ACTCTAGGCTTCCTGAGGGCAGG + Intronic
1153986486 18:10355554-10355576 ACTGTAAGCTTTCTGAGGGCAGG - Intergenic
1154030534 18:10749686-10749708 TCTCTGAGCTTCCTGAGGACAGG + Intronic
1154055065 18:11004871-11004893 ACTGTAAGCTTCTTGAGAGCAGG + Intronic
1154456730 18:14535306-14535328 ACAAAAAGCTTCTTGAGGGCGGG + Intronic
1155224814 18:23719958-23719980 ACTATAAGCTTCAGGAGGCCAGG + Intronic
1155327635 18:24681255-24681277 ATTATAAGCTTTTTGAGGGCAGG - Intergenic
1155439924 18:25851648-25851670 ACTGTAAGCTCCTTGAGGGCAGG + Intergenic
1155949578 18:31896032-31896054 GCTGTTAGCTTCTTGAGGGCAGG - Intronic
1156110294 18:33718181-33718203 ACTATAATCTCCCTGAAGGCAGG - Intronic
1156449383 18:37258503-37258525 CGCTTAGGCTTCCTGAGGGCAGG + Intronic
1156505300 18:37586879-37586901 CCTATCAGCTTCCAAAAGGCAGG + Intergenic
1156801467 18:41119892-41119914 ACTCTAAATTTCCTGAGGGCTGG + Intergenic
1157269609 18:46262047-46262069 CACATAAGCTACCTGAGGGCTGG + Intronic
1157283849 18:46363737-46363759 ACTATAAGCTCCTTGAGGGCAGG + Intronic
1157452267 18:47797737-47797759 CATGTAAGCTACTTGAGGGCAGG - Intergenic
1157548778 18:48566334-48566356 TCTGTAAGCTCCATGAGGGCAGG - Intronic
1158313699 18:56187432-56187454 CCTTTAAGTTCCTTGAGGGCAGG + Intergenic
1158608479 18:58917334-58917356 CCTGTAAGCTGCCTGAGGACAGG - Intronic
1158904540 18:61999639-61999661 CATATAAGCTCTGTGAGGGCAGG - Intergenic
1158951244 18:62497444-62497466 CCCATGAGCTCCTTGAGGGCAGG - Intergenic
1159047354 18:63382085-63382107 ACTGTAAGTTTCTTGAGGGCAGG + Intergenic
1159620665 18:70634624-70634646 CCTTTTAGCTTCCTGAGTGTGGG + Intronic
1159861110 18:73650806-73650828 ATTCTAAGCTTCTTGAGGGCAGG - Intergenic
1159964150 18:74579437-74579459 CATATAAACTCCATGAGGGCAGG + Intronic
1160477728 18:79207835-79207857 GCCATAAGCTCCCTGAGGACAGG - Intronic
1162857138 19:13477370-13477392 CATGTAAGCTCCCAGAGGGCAGG + Intronic
1163057964 19:14735682-14735704 CCTAAAAGCTCCATGAAGGCAGG + Exonic
1163122971 19:15229042-15229064 ACTGTCAGCTCCCTGAGGGCAGG - Intronic
1163335598 19:16669585-16669607 ACTACAAGCTTTTTGAGGGCAGG + Intronic
1163561735 19:18023374-18023396 CCTACAAGCCCCCTAAGGGCAGG + Intergenic
1165113230 19:33514019-33514041 CATGTAAGCTCCCTGAGGGCAGG + Intronic
1165151124 19:33760877-33760899 ACTGGAAGCTTCATGAGGGCAGG + Intronic
1165700107 19:37930926-37930948 ACTATAAGCTCCCTGTGGGCAGG + Intronic
1165923436 19:39312902-39312924 GCTATAAGCTCCCTGAGGACAGG + Intronic
1167090748 19:47342009-47342031 AATATCAGCTCCCTGAGGGCAGG - Exonic
1167639647 19:50673626-50673648 CCTAGAAACTCCCTGAAGGCGGG + Intronic
925439555 2:3872599-3872621 CCTGTCAGCTCCCGGAGGGCAGG + Intergenic
925829722 2:7882429-7882451 CCTGTCAGCTTCCTGAGGTCAGG + Intergenic
925988188 2:9232587-9232609 ATCATAAGCTTCCTGGGGGCAGG + Intronic
926242714 2:11100857-11100879 ACTGGAAGCTTCCTGAGGACAGG - Intergenic
926350137 2:11986601-11986623 ACTGTAAGCTTCGTGAGGTCAGG + Intergenic
926399063 2:12476770-12476792 CTTGTAAGCATCTTGAGGGCAGG + Intergenic
926745529 2:16153820-16153842 ATTGTAGGCTTCCTGAGGGCAGG + Intergenic
926763508 2:16302055-16302077 CCCATACTCTTCCTGAGGGTAGG - Intergenic
926826205 2:16907375-16907397 AATATAAGCTTCATGAGGGCAGG - Intergenic
927099774 2:19779194-19779216 ACTGTAAGCTCCCTGAGAGCAGG - Intergenic
927155564 2:20219332-20219354 AATGAAAGCTTCCTGAGGGCGGG + Intronic
927483718 2:23474157-23474179 AATATGAGCTCCCTGAGGGCAGG + Intronic
928705309 2:33943299-33943321 ATTATAAGCTTCTTTAGGGCAGG + Intergenic
929015281 2:37487449-37487471 AATATAAGTTCCCTGAGGGCAGG + Intergenic
929119427 2:38472097-38472119 AGTATAAGCTCCCTAAGGGCAGG - Intergenic
929167793 2:38901106-38901128 CCGATAAGCCCCTTGAGGGCAGG - Intronic
929199721 2:39221975-39221997 ATTTTAAGCTTCTTGAGGGCAGG + Intronic
929249976 2:39742580-39742602 CCTAGAAGCTTCCAGAGAGATGG - Intronic
929413653 2:41725402-41725424 ACTATAAGCTTCATAAGGACAGG + Intergenic
929451163 2:42038516-42038538 TCTATAAACTTCATGAGGGCAGG - Intergenic
929723975 2:44404084-44404106 ACTGTAAGCTTCCAGAAGGCAGG + Intronic
929892652 2:45931325-45931347 ACTATAAGCTCCCTGAAAGCAGG - Intronic
929950199 2:46404241-46404263 CATATAAGATGCCAGAGGGCAGG + Intergenic
930172185 2:48263142-48263164 CCTATGAGCTCCTTGAGGTCAGG - Intergenic
930383266 2:50658846-50658868 TGTATAAGCTTCCTGAGAGCTGG + Intronic
930540673 2:52702731-52702753 TCTATTAGCTCCCTGAGAGCTGG - Intergenic
931371751 2:61669550-61669572 TCTGTAAGCTCCCTGAGAGCAGG + Intergenic
931493602 2:62777686-62777708 TTTATAAGCTTCTTGAGGACAGG - Intronic
931729415 2:65139952-65139974 ACTATAAGCTCCTTGAGTGCAGG + Intergenic
931764498 2:65442791-65442813 ATTGTAAGCTTACTGAGGGCAGG + Intergenic
931789615 2:65652846-65652868 GCTAGAAGCTTCCTGAGAGAAGG + Intergenic
932316106 2:70784223-70784245 CCTACAGGCTTCCTGCTGGCTGG - Intronic
932398503 2:71464150-71464172 ACTGGAAGCTCCCTGAGGGCAGG + Intronic
932478831 2:72025974-72025996 CCTGAAAGCTCCTTGAGGGCAGG + Intergenic
932845194 2:75128031-75128053 ACGGTAAGCTTCCTGAGGGCAGG + Intronic
933191049 2:79334481-79334503 ACTAGGAGCATCCTGAGGGCAGG + Intronic
933527928 2:83467373-83467395 ACTCTAAACTTCCTGAAGGCAGG - Intergenic
934542820 2:95190269-95190291 AATATAAGCATCATGAGGGCAGG + Intergenic
934607515 2:95708344-95708366 CATAGAGGCTTCCTGAGGGCAGG + Intergenic
934776915 2:96945034-96945056 CCTATTAGCCTCCTGAGAACAGG + Intronic
935067663 2:99664803-99664825 ACTGGAAGTTTCCTGAGGGCAGG - Intronic
935125879 2:100222320-100222342 ACTGTAAGCTACATGAGGGCAGG + Intergenic
935511039 2:103974445-103974467 CCTATGACCTTACTGAGGGGTGG + Intergenic
935786295 2:106551818-106551840 CCTATTGGTGTCCTGAGGGCTGG - Intergenic
935809539 2:106783762-106783784 ACTATAAGCTTCTAGAGGTCAGG + Intergenic
935975179 2:108571123-108571145 ACTCTAAGCTTCTTGAGGGAAGG - Intronic
936540909 2:113350535-113350557 CAGAGAGGCTTCCTGAGGGCAGG + Intergenic
936977800 2:118236901-118236923 AATGTAAGCTTCTTGAGGGCAGG - Intergenic
937412609 2:121689615-121689637 CCCATAAGGTTCCTGTGGTCTGG + Intergenic
938285562 2:130112414-130112436 ACAAAAAGCTTCTTGAGGGCAGG + Intronic
938336206 2:130500955-130500977 ACAAAAAGCTTCTTGAGGGCAGG + Intronic
938353617 2:130619710-130619732 ACAAAAAGCTTCTTGAGGGCAGG - Intronic
938430042 2:131226487-131226509 ACAAAAAGCTTCTTGAGGGCAGG - Intronic
938738098 2:134204790-134204812 ACTATATGCTCACTGAGGGCAGG - Intronic
938984686 2:136562785-136562807 GTTATAGGCTCCCTGAGGGCAGG + Intergenic
939130423 2:138229259-138229281 ACTACAAGCTCCTTGAGGGCAGG - Intergenic
939219892 2:139288219-139288241 CTTTTAAGCTCCATGAGGGCAGG + Intergenic
940333019 2:152495752-152495774 CGTATATGCTTCCTGGAGGCAGG - Intronic
940554630 2:155207820-155207842 ACTATAAGCCTTCTAAGGGCAGG - Intergenic
941163557 2:162061813-162061835 AATATAAGCTTCATAAGGGCAGG - Intronic
941635751 2:167933304-167933326 ATTGTTAGCTTCCTGAGGGCAGG - Intergenic
941666975 2:168251857-168251879 AATATAAGCTCCCTGAGGGCAGG + Intergenic
941767581 2:169315251-169315273 ACTATGAGCTTCTTGAGGGTAGG - Intronic
941892048 2:170592657-170592679 ACCATAAGGTTCATGAGGGCAGG + Intronic
942086464 2:172448863-172448885 GCTATAAACTCCTTGAGGGCAGG - Intronic
942143127 2:172998087-172998109 ATTATAAGCTTCCTGAAGGCAGG - Intronic
942310921 2:174655806-174655828 ACTATAAGCTCTATGAGGGCAGG + Intronic
942370970 2:175284286-175284308 ACTCTAAGCTTCAAGAGGGCAGG - Intergenic
942544676 2:177051056-177051078 ACTATAAGCTCCATGAAGGCAGG - Intergenic
943308696 2:186299822-186299844 ACTATGTGCTTCCTGAGGGCTGG - Intergenic
944279658 2:197881072-197881094 CCTGTGAGCTCCCTGAGGGCAGG + Intronic
944986818 2:205187003-205187025 CCTACCAGCTTCCTGAAGACAGG - Intronic
945124366 2:206492057-206492079 TCTATAAGCTTCATGAGGGAAGG - Intronic
945159543 2:206875097-206875119 ACTATAAGCATCCTGAGGGCAGG - Intergenic
945279915 2:208026261-208026283 CCTATAAACTCCCTGAGGGCAGG + Intergenic
945452548 2:210010094-210010116 ACTATAAACTCTCTGAGGGCGGG + Intronic
945777362 2:214123569-214123591 AATATAAGGTTCCTGAGGACAGG - Intronic
945901265 2:215540160-215540182 ACTATAAGCTCCATGAAGGCAGG + Intergenic
946156044 2:217807513-217807535 CCAATGGGCCTCCTGAGGGCAGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946216257 2:218186080-218186102 CATATAAGCTTCACGAAGGCAGG + Intergenic
947138515 2:226999094-226999116 ATTGTAAGCTTCATGAGGGCAGG + Exonic
947746572 2:232511097-232511119 GCTATTAGCTCCATGAGGGCAGG + Intergenic
947963191 2:234257373-234257395 AATGTAAGCTTCCTGAGGGTAGG - Intergenic
947982715 2:234424183-234424205 CCTATAAGCTCCTTGAGAACAGG + Intergenic
948193677 2:236079166-236079188 GCTGTGAGTTTCCTGAGGGCAGG - Intronic
948486180 2:238282726-238282748 AATGTAAGCTCCCTGAGGGCAGG - Intronic
948572573 2:238926984-238927006 CCTTGATCCTTCCTGAGGGCAGG - Intergenic
1168753608 20:300646-300668 TCTGTAATCTCCCTGAGGGCAGG - Intergenic
1168754727 20:308395-308417 ACTTTGAGCTCCCTGAGGGCAGG + Intergenic
1168956747 20:1839568-1839590 ACTGTGAGCTTCCTGAGGGTAGG - Intergenic
1169203285 20:3726039-3726061 CATCTGGGCTTCCTGAGGGCTGG - Intergenic
1169632283 20:7647147-7647169 CCTAGAAGCTTCCTGAGCTAGGG - Intergenic
1169852145 20:10063957-10063979 ACTATAAACTCCATGAGGGCAGG - Intergenic
1169998009 20:11580979-11581001 ACTATAAGTATCCTGAAGGCAGG - Intergenic
1170278013 20:14614540-14614562 ATTATAAACTTCCTGAGGGCAGG + Intronic
1170388273 20:15844284-15844306 ATTATAAGCTTCCTGACTGCAGG - Intronic
1171354397 20:24533165-24533187 CGTATAAGCTGCCTGATTGCAGG - Intronic
1172097942 20:32469752-32469774 GCTGTCAGCTTGCTGAGGGCAGG - Intronic
1172795985 20:37537970-37537992 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
1173077248 20:39830962-39830984 ACTATGATCTTCATGAGGGCAGG + Intergenic
1173658822 20:44719124-44719146 TCTGTAAGCTCCCAGAGGGCTGG + Intronic
1173691117 20:44961910-44961932 ACTATAAGCTTTCTGAGGGCTGG + Intergenic
1173834368 20:46115630-46115652 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
1174158500 20:48533528-48533550 AGTGTAAGCTCCCTGAGGGCAGG + Intergenic
1174251907 20:49226206-49226228 ACTGTAAGATTCCTGAGGGCAGG + Intronic
1174764790 20:53242924-53242946 ACTGTAAGCTCCCAGAGGGCAGG - Intronic
1174767283 20:53265988-53266010 ACTCTAAGCTTCCCAAGGGCAGG - Intronic
1174786508 20:53437902-53437924 AGTAAAAGCTTCCTGAGGGCTGG + Intronic
1174901480 20:54505522-54505544 ACTGTAAGCTCCATGAGGGCAGG - Intronic
1174916382 20:54658385-54658407 TCTGCAAGCTTTCTGAGGGCAGG + Intergenic
1175205416 20:57307595-57307617 ACTGTAAGCTTCTGGAGGGCAGG + Intergenic
1175262264 20:57682042-57682064 ACTAGTAGCTCCCTGAGGGCAGG + Intronic
1175296593 20:57913088-57913110 AGTCTAAGATTCCTGAGGGCAGG - Intergenic
1175451195 20:59070046-59070068 ACAGTGAGCTTCCTGAGGGCAGG + Intergenic
1175476552 20:59279123-59279145 ACTGTGAGCTTCTTGAGGGCTGG - Intergenic
1175490726 20:59379609-59379631 ATTTCAAGCTTCCTGAGGGCAGG - Intergenic
1175522446 20:59610718-59610740 ATTGTAAGCTCCCTGAGGGCAGG + Intronic
1175554019 20:59835055-59835077 ACTATGAGCTTCCCAAGGGCAGG + Intronic
1175948953 20:62572241-62572263 CCTCTGAGCTTCCTGTGTGCTGG + Intergenic
1176817433 21:13618027-13618049 ACAAAAAGCTTCTTGAGGGCAGG - Intronic
1176897303 21:14396099-14396121 GCTATAAGCTCCCTGAGCTCAGG - Intergenic
1177666712 21:24169158-24169180 ACTATAAGCTCCATGAGGCCAGG - Intergenic
1177802122 21:25838369-25838391 GCAATAAGATTCCTGAGGACTGG - Intergenic
1178429866 21:32509632-32509654 AATGCAAGCTTCCTGAGGGCAGG - Intronic
1178474074 21:32920976-32920998 ATTATAAACTCCCTGAGGGCAGG - Intergenic
1178541173 21:33451963-33451985 CCTGTATGCTTCCTGTGTGCTGG - Intronic
1179773896 21:43646924-43646946 CCTAAAAGCACCCTGAAGGCAGG + Intronic
1181184462 22:21092840-21092862 ACTATAAGCTCCTTGAGGGCAGG + Intergenic
1181775631 22:25158381-25158403 ACTGTAAGCTCCCTGAGGTCAGG - Intronic
1181861462 22:25822479-25822501 ACTATAAGCTCCATGAGGACAGG + Intronic
1182053199 22:27328913-27328935 CCTGTAAACTTCATGAGGACTGG - Intergenic
1182081258 22:27530405-27530427 CATAGAAGTTTCCTGAGGGCAGG + Intergenic
1182371769 22:29816256-29816278 CCTAGAAGCTTCCCCAGGGTGGG + Intronic
1182639018 22:31752057-31752079 CCTATTAGCTTCCCCAGGGATGG + Intergenic
1182770448 22:32791986-32792008 ACTATAGGCTACTTGAGGGCAGG + Intronic
1182879958 22:33724802-33724824 ACTGTAAACTCCCTGAGGGCAGG - Intronic
1182937628 22:34240763-34240785 ACTATGAGTTTCCTGAGAGCGGG - Intergenic
1182942630 22:34292227-34292249 GGTATAAGCTTCCTGAGAGCAGG + Intergenic
1183775035 22:39958441-39958463 AATGTAAGCTCCCTGAGGGCAGG + Intronic
1184007826 22:41723659-41723681 ACTATAAGTTTCATGAGGGCAGG - Intronic
1184184304 22:42854161-42854183 ACTATAAGTTCCCTGAGGACAGG + Intronic
1184361844 22:44023853-44023875 CCTCTAAGCTTCCCGTGGGTAGG + Intronic
1184416279 22:44353538-44353560 CCTGAAAGCTTCCCCAGGGCTGG - Intergenic
1184950253 22:47836889-47836911 ACAGTAAGATTCCTGAGGGCAGG + Intergenic
1185211747 22:49574425-49574447 CCTGGAAGCTTCCACAGGGCAGG - Intronic
949182512 3:1151195-1151217 GCTTTAAGCTTCCAGATGGCAGG + Intronic
949374895 3:3378237-3378259 CCTGTAAGCTCCATGAGGGCTGG - Intergenic
949718138 3:6957304-6957326 CTTGTCAGCTTGCTGAGGGCAGG + Intronic
949862515 3:8519120-8519142 ACTGTAAGCTCCATGAGGGCAGG - Intronic
949903393 3:8838380-8838402 CCCCTAAGCTTTCAGAGGGCTGG - Intronic
950206013 3:11081694-11081716 ACTTTAAGCTCCCTGAGGGCAGG + Intergenic
950221169 3:11197326-11197348 GCTGTGAGCTTCCTGAGGGCTGG + Intronic
950735875 3:15007570-15007592 ACTAAAAGTTTCATGAGGGCAGG + Intronic
951008441 3:17647277-17647299 CTTGTAAGCTTCATGAGGGTAGG - Intronic
951024084 3:17812038-17812060 TCTATAAGCCTCATGAGGGCAGG + Intronic
951080691 3:18446222-18446244 CCTGTTAGCTTCCTCAGAGCTGG - Intergenic
951432898 3:22628557-22628579 GCTCTAAGCTCCTTGAGGGCAGG + Intergenic
951569216 3:24044496-24044518 ACTGTAAGCTCCCAGAGGGCAGG - Intergenic
953505615 3:43483092-43483114 GCTATAAGCTTCCTGTGCTCTGG + Intronic
953656686 3:44860017-44860039 CCTGCAAGCTCCTTGAGGGCAGG - Intronic
953741498 3:45542840-45542862 GCTTTAAGCTCCATGAGGGCAGG - Intronic
953800528 3:46019371-46019393 GCTGCAAGCTTCTTGAGGGCAGG - Exonic
954420742 3:50417810-50417832 CCCACAAGGTCCCTGAGGGCAGG + Intronic
954547110 3:51446314-51446336 CTTATAAGCTTACTTAAGGCTGG + Intronic
954788033 3:53109248-53109270 TCTATAGACTCCCTGAGGGCAGG + Intronic
954857779 3:53661151-53661173 CCTAACACCTTTCTGAGGGCTGG + Intronic
955075203 3:55607167-55607189 CCCATAAGCTCCATGGGGGCAGG - Intronic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
955190494 3:56757013-56757035 ACTAGAAACTTCCTGAGGTCAGG + Intronic
955341435 3:58128461-58128483 ACAGTAAGCTCCCTGAGGGCAGG - Intronic
955469606 3:59273025-59273047 AATATAAGCTTCATGAGGGCAGG - Intergenic
955743624 3:62119070-62119092 ACCAGAAGCTCCCTGAGGGCAGG - Intronic
955967837 3:64407181-64407203 AGTAGAAGCTTCATGAGGGCAGG + Intronic
956318992 3:67974216-67974238 AATGTAAGCTGCCTGAGGGCAGG + Intergenic
956384522 3:68702709-68702731 ACTCTAAGCTCCTTGAGGGCAGG - Intergenic
956609575 3:71108840-71108862 CTCATAAGCCTCCTGAAGGCAGG + Intronic
956664840 3:71632416-71632438 AGTATAAGCTTCTTGAGGGTTGG - Intergenic
956831374 3:73051990-73052012 ACTATAAGCTTCTGGAGAGCTGG + Intronic
956872981 3:73436255-73436277 CCTTTTGGCTTCCTGAGGACAGG + Intronic
956882559 3:73525924-73525946 ACTGTGAGCTTCCTGAGGGCAGG + Intronic
956962783 3:74422144-74422166 CTTATGAGCTTCTTGAGGGCAGG - Intronic
957046374 3:75378270-75378292 AATACAAGCTCCCTGAGGGCAGG + Intergenic
959117228 3:102192837-102192859 CCTTTAAGGTTCCTAAGGACAGG - Intronic
959416158 3:106078316-106078338 ACTATGAGTTTCCTGAGGACAGG + Intergenic
959629668 3:108493639-108493661 ACTATAAGATTCATGAGGGTAGG - Intronic
960427287 3:117524329-117524351 ATTATAAGCTTCCGGAGAGCAGG - Intergenic
960602306 3:119470132-119470154 GCTGCAAGCTTCCTGAGGTCAGG + Intronic
960902499 3:122566227-122566249 AGTATAAGCTGCCTGAGAGCAGG - Intronic
961016233 3:123470319-123470341 GCTATAAGCTACTTGAGGGCAGG - Intergenic
961388261 3:126536638-126536660 ACTGTAAACTTCCTGAGGGCAGG - Intronic
961847046 3:129774489-129774511 ACTGAAAGCTTCATGAGGGCAGG - Intronic
961915339 3:130368484-130368506 CCTATAAACTCCTTGAAGGCAGG - Intronic
962384235 3:134920111-134920133 GCTGCAAGCTCCCTGAGGGCTGG + Intronic
962493266 3:135914663-135914685 AATATAAGCTTCATTAGGGCAGG - Intergenic
962743969 3:138383770-138383792 AATATAAGCTTCATGAGAGCAGG - Intronic
962793026 3:138828548-138828570 AATATAAGCTTCATGATGGCAGG - Intronic
962848993 3:139293925-139293947 ACTATAAGCTCCCTGAAGGCAGG - Intronic
963122990 3:141792065-141792087 ACTGTAAGCTTCATGAAGGCAGG - Intronic
963913106 3:150831743-150831765 GATATAAGCTCCTTGAGGGCAGG - Intergenic
963934363 3:151036880-151036902 CCTATAAGCTCCATGAGGGCAGG + Intergenic
964218232 3:154313338-154313360 ACTATAAGCTCTCTGAGGACAGG + Intronic
964565869 3:158051880-158051902 CAGAGAAGCTTCATGAGGGCAGG + Intergenic
964734935 3:159907308-159907330 ACTATAAACCCCCTGAGGGCAGG + Intergenic
965431162 3:168590561-168590583 ACTACAAGCTCCCTGAGGGTAGG - Intergenic
965612330 3:170557480-170557502 ACTATGAGATCCCTGAGGGCAGG - Intronic
965698805 3:171438553-171438575 ATTATAAGCTTCTTAAGGGCAGG - Intronic
966016167 3:175140359-175140381 ACTATAAGCTCTCTGAGGACAGG - Intronic
966410475 3:179641749-179641771 CCTATACACTTCTTGAGGGCAGG + Intergenic
967532582 3:190566113-190566135 ATTTTAAGCTGCCTGAGGGCAGG + Intronic
967853007 3:194096163-194096185 ACTATAAGCTCTATGAGGGCAGG - Intergenic
967990208 3:195125067-195125089 TCTATCAGCTTCTTGAGGGCGGG - Intronic
968264429 3:197351735-197351757 ACTGTAAGCTTCATGGGGGCTGG - Intergenic
968588711 4:1446934-1446956 GCTAGGAGCTCCCTGAGGGCAGG - Intergenic
968625998 4:1626953-1626975 CCTGGAGGCTGCCTGAGGGCAGG + Intronic
968627291 4:1631789-1631811 CTTAAAAGCTTCCTGAGGACGGG + Intronic
969059910 4:4426230-4426252 ACCCTGAGCTTCCTGAGGGCGGG + Intronic
969061298 4:4437365-4437387 ACTGTGAGCTCCCTGAGGGCAGG + Intronic
969199431 4:5590844-5590866 ACTATAAGTTTCCTGAGGGCTGG - Intronic
969387979 4:6869078-6869100 ACTGTAAGCTTCCTGAGGGGCGG - Intronic
969407135 4:7001006-7001028 ACTCTAAGCTTCCTGAGGGCAGG + Intronic
970273486 4:14371649-14371671 CCTGTAAGCTTTGTGAAGGCAGG - Intergenic
970507485 4:16746161-16746183 TCTGTAAGCTTACTGAGGGTGGG - Intronic
970520831 4:16882179-16882201 GCTGTGAGCATCCTGAGGGCAGG + Intronic
970561793 4:17288804-17288826 ACTGTAAGCTTCATGAGGGCAGG - Intergenic
970597943 4:17616972-17616994 ATTACAAGCTTCCTGAAGGCAGG - Intronic
970792546 4:19875788-19875810 GCTATCAGCATCCTGAGGGCAGG - Intergenic
970873274 4:20841340-20841362 TCTTTAAGCTTCCTGACAGCAGG - Intronic
970879982 4:20917489-20917511 GCCATAAGCTTCCTGAGGGCAGG - Intronic
971310135 4:25518639-25518661 ACTATAATCCCCCTGAGGGCAGG + Intergenic
971477174 4:27083358-27083380 ACTGTAAGCTTCTTGAGGCCAGG - Intergenic
971567323 4:28161758-28161780 GCTCTAAGGTTCTTGAGGGCAGG + Intergenic
972218033 4:36919141-36919163 CATATAAGCTACCTGATGGCTGG - Intergenic
972363519 4:38351183-38351205 CCTAAAAGCCTCCTGAGGAAGGG + Intergenic
972403187 4:38724085-38724107 GCTATAACCTTCATGTGGGCAGG + Intergenic
972432599 4:38997875-38997897 CCAGTAAGCTTCTTGAGGGCAGG - Intronic
972522742 4:39876242-39876264 TCTATAAACTCCTTGAGGGCAGG + Intronic
973026543 4:45280428-45280450 CTTATGAGCTTCTTAAGGGCTGG + Intergenic
973231294 4:47841968-47841990 AATGTAAGCTTCATGAGGGCAGG - Intergenic
973539081 4:51917590-51917612 AATGTAAGCTTTCTGAGGGCAGG + Intergenic
973607258 4:52600153-52600175 ATTATAAGCTTTGTGAGGGCAGG + Intronic
973630206 4:52813179-52813201 ACTAAAAGCTTCTTGAGGCCAGG - Intergenic
975110213 4:70615150-70615172 CCTATAAGCTCTGTGATGGCAGG + Intergenic
975406268 4:73994246-73994268 CATGTAAGCCTCATGAGGGCGGG - Intergenic
975807761 4:78130683-78130705 TCTATAAGCTTCATGAGGATAGG - Intronic
976199392 4:82563378-82563400 ACTGTAAGCTTCCTGAGACCAGG + Intergenic
976588049 4:86820632-86820654 ACTATAAACTTTGTGAGGGCAGG + Intergenic
977243300 4:94600144-94600166 AATGTAAGCTTCATGAGGGCAGG + Intronic
977254897 4:94729548-94729570 GCTATAAGCTCCCTGATGTCAGG - Intergenic
977463986 4:97359712-97359734 CATATATGCTTCATGAAGGCAGG + Intronic
977547627 4:98402855-98402877 ACTATAAGCTCCTTGAGGGCAGG - Intronic
978294786 4:107192341-107192363 ACTAAAGGCTTCATGAGGGCAGG + Intronic
978649028 4:110978158-110978180 CCTATAAGCTTTCTGAAGGCAGG + Intergenic
978764517 4:112390499-112390521 GCTACAAGCTTCATGAGGTCAGG + Intronic
978827808 4:113046007-113046029 ACTCTAAGCTCCTTGAGGGCAGG - Intronic
979229645 4:118332921-118332943 GCAGTAAACTTCCTGAGGGCCGG - Intronic
979397442 4:120205523-120205545 AATGTAAGTTTCCTGAGGGCAGG - Intergenic
979606101 4:122640593-122640615 ACTATAAGCTCCATAAGGGCTGG - Intergenic
979614814 4:122731104-122731126 CCTTTAAGCACCTTGAGGGCAGG - Intergenic
980211629 4:129795736-129795758 GCTATAAATTTCTTGAGGGCAGG - Intergenic
980880896 4:138709062-138709084 GCTGTGAGCATCCTGAGGGCTGG + Intergenic
981011338 4:139928379-139928401 CCCATAAACTACCTGAGGGCAGG - Intronic
981112438 4:140951238-140951260 CAGATATGCTCCCTGAGGGCAGG + Intronic
981496947 4:145404470-145404492 ACTATAAGTTTCATGAAGGCAGG + Intergenic
981765501 4:148244215-148244237 CATATTGGCTTCTTGAGGGCCGG + Intronic
981778337 4:148395917-148395939 CCTGTAAGTATACTGAGGGCAGG - Intronic
982047633 4:151464658-151464680 ACAATAAGCTTCCTGATGACTGG - Intronic
982093716 4:151901186-151901208 ACTATAAGCTCCTTGAAGGCAGG - Intergenic
982100703 4:151964976-151964998 ACTGCAAACTTCCTGAGGGCAGG - Intergenic
982264556 4:153526427-153526449 ACAGCAAGCTTCCTGAGGGCAGG - Intronic
982363148 4:154545125-154545147 AATTTAAGCTTCTTGAGGGCAGG - Intronic
982736844 4:159015898-159015920 ATTATAAGCTTTCTGAGGACTGG - Intronic
982819092 4:159924265-159924287 GCTATGAGCTACCTGAGGGTAGG - Intergenic
984258167 4:177411801-177411823 ACTATAAGCTCCAAGAGGGCAGG + Intergenic
984501022 4:180558719-180558741 CATATGAACTTTCTGAGGGCAGG - Intergenic
984747687 4:183238857-183238879 TCTGTAAGATCCCTGAGGGCAGG + Intronic
984852334 4:184164956-184164978 CCTGTGGGCTTCCTGAGTGCTGG - Intronic
986230922 5:5864302-5864324 CCTAGACACTACCTGAGGGCAGG - Intergenic
986242729 5:5975930-5975952 AGTATAAGCTTGATGAGGGCAGG - Intergenic
986612066 5:9578859-9578881 CTCATAAGCTCCCTGAAGGCAGG + Intergenic
987040731 5:14059854-14059876 AATATAAGCTTCCTGAGGGCAGG - Intergenic
987092735 5:14522262-14522284 ACTATAAGCTCCATGAGGGAAGG + Intronic
988513204 5:31883088-31883110 AATATAAGCTCCCTGAGAGCAGG - Intronic
988578503 5:32448481-32448503 ACTATAAGCTTCACGAGGGCAGG + Intergenic
988817718 5:34851077-34851099 CATAGAAGCTCCCTCAGGGCGGG + Intronic
988854730 5:35216883-35216905 GCTGTAAGCTACCTGAGGGCAGG - Intronic
988972357 5:36482111-36482133 AGTGGAAGCTTCCTGAGGGCAGG + Intergenic
989124099 5:38034292-38034314 ACTCTAGGCTTCCTGAGGGGTGG + Intergenic
990599617 5:57344604-57344626 AATATAAGCTCCATGAGGGCAGG + Intergenic
991096521 5:62745440-62745462 CCTTTAAGCTCGGTGAGGGCAGG + Intergenic
991612267 5:68461889-68461911 ACTATAAGCTCCATGAGGACAGG - Intergenic
992189436 5:74276721-74276743 AACATAAGCTTCATGAGGGCAGG - Intergenic
992625465 5:78632704-78632726 ACTGTAAGCTCCCTGAGGGCAGG - Intronic
992664582 5:78994627-78994649 TCTATAAACTTCATGAAGGCAGG + Intergenic
992845562 5:80743449-80743471 GCTATAAGCACCCTGAGGGTGGG + Intronic
993635591 5:90339199-90339221 CCTATAAGTTCCCTTGGGGCTGG + Intergenic
993694174 5:91040394-91040416 ACTATATGCTTCATGAGGACAGG + Intronic
993940399 5:94051137-94051159 CCTCTAAGCTTCTTGAGGACTGG - Intronic
994102421 5:95908472-95908494 GCTATAAGCTCTATGAGGGCAGG + Intronic
994534581 5:101012116-101012138 AATATAAGCTTACTGAAGGCAGG - Intergenic
995544067 5:113212754-113212776 CCTCTGAGCTCCCTGTGGGCAGG - Intronic
996284820 5:121777057-121777079 AATATAAGCTTCATGAGGGTAGG + Intergenic
997384974 5:133465434-133465456 AGAATAAGCTTCCTGAGGCCAGG + Intronic
997405017 5:133638753-133638775 CATATAAGCTCCACGAGGGCTGG + Intergenic
997529661 5:134573997-134574019 CCAGAAAGCTCCCTGAGGGCAGG - Intronic
997577713 5:134995555-134995577 ACTGTAAGCTTCCCGGGGGCTGG + Intronic
997592860 5:135086352-135086374 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
997639915 5:135442399-135442421 CCTGTTGGCTTCCTGAGGACAGG + Intergenic
998016522 5:138736466-138736488 CCTATAAGCTCCTTGAGTGGCGG + Intronic
998076460 5:139240632-139240654 GCTATCAGCTCCCTGAGGGCAGG - Intronic
998602334 5:143597777-143597799 ATTATAAGCTTCTTGAGGGCAGG + Intergenic
998799366 5:145853594-145853616 GCTTTGAGCTTCTTGAGGGCAGG - Intergenic
998910908 5:146959349-146959371 ACTGTAAGCTTTCTGAAGGCAGG - Intronic
999055420 5:148570314-148570336 CCTCTGAGCTCCCTGAGGGAAGG - Intronic
999116368 5:149167707-149167729 GCTCTAAGCTTGATGAGGGCAGG - Intronic
999217379 5:149946630-149946652 ACTGTGAGCTTCATGAGGGCAGG + Intergenic
999501500 5:152151228-152151250 CCTATATGCGTCCTGACAGCTGG - Intergenic
999538215 5:152542068-152542090 ACTATAAGCTCCCTGGGAGCAGG - Intergenic
999690138 5:154139361-154139383 ACTGTAAGCTTCGTGAGGGCAGG + Intronic
999707749 5:154289488-154289510 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
999844800 5:155467580-155467602 AATATAAGCTTCGTGAGGACAGG + Intergenic
1000201269 5:159013298-159013320 TCTGTAAGCTCACTGAGGGCAGG - Intronic
1000357215 5:160410793-160410815 TATATAAGCTTCCTGGGGGTAGG + Intronic
1000364375 5:160477468-160477490 CTCATGAGCTTCCAGAGGGCAGG + Intergenic
1000898176 5:166881511-166881533 ACTATCAACTCCCTGAGGGCTGG + Intergenic
1000987216 5:167874253-167874275 ACTATAAGCTCTCTGAGGGCAGG + Intronic
1001126800 5:169026924-169026946 ACTTCAAGCCTCCTGAGGGCAGG - Intronic
1001256575 5:170187888-170187910 GCCATCAGCTTCCTGGGGGCAGG - Intergenic
1001283807 5:170407709-170407731 CCAACACGCTTCCTGAGGGCAGG + Intronic
1001459080 5:171893232-171893254 CCCATACACATCCTGAGGGCAGG + Intronic
1001551734 5:172607646-172607668 ACTATAAGCTTCTTGAGGATGGG - Intergenic
1001748855 5:174112496-174112518 CCTGGGAGCTTCCTGAGGGCAGG - Intronic
1001785554 5:174409680-174409702 TGTGTAAGCTTCATGAGGGCAGG - Intergenic
1001982613 5:176047120-176047142 CCTATAACCTGCCTGGGGTCTGG + Intergenic
1002019635 5:176354778-176354800 TCCATTAGCTTCCTGAGGACAGG - Intronic
1002234850 5:177796937-177796959 CCTATAACCTGCCTGGGGTCTGG - Intergenic
1003401418 6:5794276-5794298 CATATAAGCAACATGAGGGCAGG - Intergenic
1003464952 6:6370124-6370146 ACTATAAGCTCCTTGAGGGTGGG - Intergenic
1003618187 6:7673886-7673908 ACTATAAGGTTCTTGAGGGCAGG - Intergenic
1003716395 6:8651328-8651350 CCTATGAGCTTGCTGTGTGCAGG + Intergenic
1004021800 6:11782749-11782771 AATATAAGCTCCATGAGGGCAGG - Intronic
1004087583 6:12465769-12465791 AATATAGGCTTCCTGAGGGCAGG + Intergenic
1004264211 6:14134725-14134747 ACTGTAAGCTCCTTGAGGGCAGG - Intronic
1005018628 6:21397112-21397134 CATACAAGCTTCATTAGGGCAGG - Intergenic
1005167042 6:22936826-22936848 CCTGTAAGCTCCATGAGTGCAGG + Intergenic
1006145584 6:31957413-31957435 ACTGTAAGCTTCTTGAGGGTAGG - Intronic
1006305890 6:33218362-33218384 AATGTAAGCTCCCTGAGGGCAGG + Intergenic
1006430812 6:33994611-33994633 GCTATACGCTGCCTGAGGACAGG - Intergenic
1006434710 6:34020170-34020192 ACTGGAAGCTCCCTGAGGGCAGG + Intronic
1006741884 6:36314699-36314721 CCTGTGAGCATCCTGTGGGCAGG + Intergenic
1006750154 6:36371963-36371985 CATATAAGCTCCCTGAGGGCAGG - Intronic
1006916419 6:37596847-37596869 ACTAGAAGCTCCCTGAAGGCAGG + Intergenic
1006917098 6:37601775-37601797 ACTAGAAGCTCCCTGAAGGCAGG + Intergenic
1007102658 6:39260794-39260816 ACTAGAAGCTCCCTGAGGACAGG - Intergenic
1007149173 6:39671075-39671097 ACTATAAGCTTCTTGAAGTCAGG - Intronic
1007229570 6:40338916-40338938 CTTGTAAGCTCCCTGAGGGCAGG + Intergenic
1007251563 6:40498742-40498764 AATGTGAGCTTCCTGAGGGCAGG - Intronic
1007258584 6:40545865-40545887 AATATAAGCTTAATGAGGGCAGG + Intronic
1007286182 6:40749079-40749101 ACTGTAAGCTTCCAGAGGGCAGG + Intergenic
1007432026 6:41782016-41782038 ACTATGAGCTCCTTGAGGGCGGG + Intronic
1007635394 6:43296956-43296978 CCTGTAAGCTCCCTAAGGGTAGG + Intronic
1007696302 6:43736305-43736327 ACAGTAAGCTCCCTGAGGGCAGG - Intergenic
1007741204 6:44010618-44010640 CCTGCAAGCTTCCTAAGAGCAGG + Intergenic
1008044686 6:46839406-46839428 ACTGTAAGCTCCATGAGGGCAGG + Exonic
1008098311 6:47363292-47363314 GCCATAAGCTTCATGAGGGGAGG + Intergenic
1008493693 6:52111633-52111655 ACTGTAAGCTTCCTGAGGGCAGG - Intergenic
1010167872 6:72938767-72938789 ACTATAAGCTTCTTGATGGTAGG - Intronic
1010213698 6:73383179-73383201 CCTAAAAGATTTCTTAGGGCCGG + Intronic
1010287999 6:74101783-74101805 ACTGTAAGTTTCATGAGGGCAGG - Intergenic
1010503746 6:76631822-76631844 CCTAGAAGCTGCCTTGGGGCCGG - Intergenic
1010771449 6:79836516-79836538 GCTATAGGCTCCCCGAGGGCAGG - Intergenic
1010946282 6:81976771-81976793 ATTGTAAGCTTCCTGAGGCCAGG + Intergenic
1010989128 6:82459484-82459506 AATTCAAGCTTCCTGAGGGCAGG + Intergenic
1011143936 6:84191199-84191221 CCTTAAAGCTACCTGTGGGCAGG + Intronic
1011478941 6:87775398-87775420 ACTAAAAGCTTTCTGATGGCCGG - Intergenic
1011664500 6:89621685-89621707 ACTTTAAGCTTCTTGAGGTCAGG + Intronic
1012469005 6:99548689-99548711 CCTATAATCCTCCTGTAGGCAGG + Intronic
1012884244 6:104826313-104826335 ACTATAAACTTCTTGAAGGCAGG - Intronic
1012992336 6:105938826-105938848 CCTATATCCTTCCTGAAGACAGG - Intergenic
1013324708 6:109032986-109033008 ATTATAAGGTTCCTTAGGGCTGG - Intronic
1013817821 6:114119839-114119861 ACTGTAAATTTCCTGAGGGCAGG - Intronic
1013996221 6:116311302-116311324 AATATAAGCATCCTGAGGGCAGG + Intronic
1014066395 6:117131754-117131776 ACTATGAGCTTGCTGAGGGAAGG - Intergenic
1014159094 6:118146682-118146704 CCTCTAAACTTCCTGGAGGCAGG + Intronic
1014733884 6:125068543-125068565 CCTATAAGCTCCTTAAGGGCAGG + Intronic
1014743717 6:125175131-125175153 CATTTAAGCTCCTTGAGGGCAGG + Intronic
1015306876 6:131718977-131718999 AATAAAAGCTTCGTGAGGGCAGG - Intronic
1015341129 6:132102113-132102135 CCTCTAAGATTCATGAGGGCAGG - Intergenic
1015555825 6:134460261-134460283 AATATAAGCTTCATGAAGGCAGG + Intergenic
1015579282 6:134705732-134705754 ACTATAAGCTCCATGAAGGCAGG + Intergenic
1015767958 6:136738984-136739006 ATCATAAGCTTTCTGAGGGCAGG - Intronic
1015821490 6:137266062-137266084 ACCATAAGCTCCCTTAGGGCAGG - Intergenic
1015890318 6:137963757-137963779 CCTATAAGACTGCTGAGGCCGGG + Intergenic
1016801758 6:148175928-148175950 GCTGTAAGCTTCCAGAAGGCAGG - Intergenic
1017161658 6:151371286-151371308 CTTGTAAGTTTCTTGAGGGCAGG - Intronic
1017164762 6:151397395-151397417 ACTGTAAGCTCCCTGAGGGCAGG + Intergenic
1017917871 6:158846605-158846627 CCTACAAGCTTCTTAAAGGCAGG + Intergenic
1017965194 6:159258252-159258274 ACTGTAAGCTCCTTGAGGGCAGG - Intronic
1018008696 6:159648100-159648122 AATACAAGCTTCTTGAGGGCAGG + Intergenic
1018039633 6:159910544-159910566 ACTATAAGCTCCTTGAGGGCAGG + Exonic
1018205036 6:161429316-161429338 ACTATAAGCTCCCTGAGGGCAGG - Intronic
1018371250 6:163170312-163170334 CCTGTAAAATCCCTGAGGGCAGG + Intronic
1018434591 6:163749087-163749109 CCTCTCAGCTGGCTGAGGGCGGG + Intergenic
1018776575 6:167022913-167022935 AGCATGAGCTTCCTGAGGGCAGG - Intronic
1020565615 7:9791152-9791174 ACTGTAAGCTTCATCAGGGCAGG - Intergenic
1021028789 7:15703314-15703336 CCAACCAGCTTCCTGATGGCAGG + Intergenic
1021359664 7:19695570-19695592 CAAATAAGTTTCCTGAGGGCTGG - Exonic
1021821877 7:24506548-24506570 ACTATAAGCTTCTTGAAGGCAGG - Intergenic
1021970527 7:25961197-25961219 ACTGTAAGCTCCCTGAGGGCAGG + Intergenic
1022006150 7:26267294-26267316 ACTATGGGCTTCCTGAAGGCAGG - Intergenic
1022346213 7:29516962-29516984 ACTATAAGCTTCATGAGGACTGG + Intergenic
1022443879 7:30454408-30454430 ACTTGAAGCTCCCTGAGGGCAGG + Intronic
1022487097 7:30787505-30787527 TCTGTAAGCCTCCTGAGAGCAGG + Intronic
1022526180 7:31038863-31038885 ACTATAAGCTTCAGGAGGGCAGG + Intergenic
1022601524 7:31764739-31764761 CCTATCAGCTTCCTGAGGATAGG + Intronic
1022748252 7:33195132-33195154 TCTATAAGCTTCCTGAGGGCAGG + Intronic
1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG + Intronic
1023082634 7:36539496-36539518 AATATAAGCTTTCTGTGGGCAGG + Intronic
1023202862 7:37717765-37717787 ATTATAAGCTCCTTGAGGGCAGG + Intronic
1023631217 7:42166246-42166268 ACTATAAGATCCTTGAGGGCAGG + Intronic
1023759623 7:43452622-43452644 ACTGTAAGCTCCATGAGGGCAGG - Intronic
1023880429 7:44317051-44317073 TATATAAGCTCCCTAAGGGCAGG + Intronic
1024977386 7:55126238-55126260 ATGGTAAGCTTCCTGAGGGCAGG + Intronic
1025922373 7:65925558-65925580 TCTTTAAGCTTCTTGAGGGTAGG + Intronic
1026617829 7:71922059-71922081 ACAGTAAGCTCCCTGAGGGCAGG - Intronic
1027196151 7:76031898-76031920 ACTATAACCTTCATGAAGGCAGG - Intronic
1027441168 7:78220428-78220450 ATTATAAGCTTCTTGAGGGCAGG + Intronic
1027780703 7:82516273-82516295 AGTATGAACTTCCTGAGGGCTGG + Intergenic
1029341481 7:99948322-99948344 TATATGAGTTTCCTGAGGGCAGG + Intergenic
1029669226 7:102017469-102017491 TCGCTAAGCTCCCTGAGGGCAGG + Intronic
1029928707 7:104347519-104347541 GCTAGAAGCTTCCTAAGGACAGG + Intronic
1030110540 7:106023018-106023040 ACAATAAGCTTTCTGAGAGCAGG - Intronic
1030217747 7:107063439-107063461 ATTATAAGCTCCATGAGGGCAGG - Intronic
1030538747 7:110802918-110802940 ACTGTTAGCTCCCTGAGGGCAGG - Intronic
1031218780 7:118934920-118934942 ACCAGAAGCATCCTGAGGGCAGG + Intergenic
1031375637 7:121022066-121022088 TCTGTAAGCTTCCTAAGGTCAGG + Intronic
1032275594 7:130452528-130452550 CCTATCAGCTCCTTGAAGGCAGG + Intergenic
1032489217 7:132311416-132311438 CCTAGGAGCTTCTTGAGTGCAGG + Intronic
1032599467 7:133278142-133278164 CACATAAGCTCCCTGAGGACAGG - Intronic
1033411760 7:141124525-141124547 ACTGTAAGCTCTCTGAGGGCGGG + Intronic
1033518748 7:142138180-142138202 CCTCTAAGCTCTCTGAGGGCAGG + Intronic
1033604832 7:142919249-142919271 TCTTAGAGCTTCCTGAGGGCAGG + Intronic
1033991136 7:147288289-147288311 AATATAAGCTCCCTGAGGGCAGG + Intronic
1034417655 7:150973774-150973796 CAGACAAGCTCCCTGAGGGCAGG + Intronic
1034458609 7:151185989-151186011 ACAGTAAGCTCCCTGAGGGCAGG + Intronic
1034514201 7:151561634-151561656 CTTAAAAGCTTCATGATGGCCGG + Intronic
1034771730 7:153785306-153785328 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
1035149729 7:156859880-156859902 CCTATAAGTCTCCTGAAGTCAGG - Intronic
1035279955 7:157771556-157771578 GTTGTAAGCTCCCTGAGGGCAGG - Intronic
1035322538 7:158042624-158042646 CCTGCAAGCTTCGGGAGGGCAGG + Intronic
1036220157 8:6914707-6914729 AATGTAAGCTCCCTGAGGGCAGG + Intergenic
1036573857 8:10006399-10006421 ACTGCAAGCTTCATGAGGGCAGG - Intergenic
1036958313 8:13215111-13215133 CATGTAAGCTTCCAAAGGGCAGG - Intronic
1037130510 8:15403233-15403255 ACTATATCCTACCTGAGGGCAGG - Intergenic
1037478166 8:19277964-19277986 GCTATAAGCTTCAAGAAGGCAGG + Intergenic
1037487133 8:19358311-19358333 AATATAAGCTCCCTGAAGGCAGG - Intronic
1037741334 8:21611543-21611565 CATGTAAGCTCCGTGAGGGCAGG + Intergenic
1038054531 8:23845946-23845968 ACTGTAAGCTTACTGAAGGCAGG + Intronic
1038265192 8:26033797-26033819 ACTATAAGCTACTTGAGGGCAGG + Intronic
1038697728 8:29820952-29820974 GCTATAAGCTCCCTGAGGGCTGG + Intergenic
1038776502 8:30536084-30536106 ACTATAAGGTCCCTGAGTGCAGG - Intronic
1038972580 8:32653243-32653265 AACATAAGCTCCCTGAGGGCAGG - Intronic
1039415934 8:37394129-37394151 AATGTGAGCTTCCTGAGGGCAGG - Intergenic
1039539016 8:38346464-38346486 AATATAAGCATCCTGAGAGCAGG + Intronic
1039605622 8:38877951-38877973 CCCACAAGCTTCATGAGGGAAGG + Intergenic
1039781549 8:40791612-40791634 AATATAAGCTTGTTGAGGGCAGG + Intronic
1039784366 8:40819595-40819617 ACTGCAAGCTTCCTGAGGGCAGG - Intronic
1039996477 8:42538661-42538683 CCTTTAAGCTCCCTGAATGCAGG - Intronic
1040866013 8:52049715-52049737 ACTCTAATCTGCCTGAGGGCAGG - Intergenic
1040963488 8:53060827-53060849 ACTGTGAGCTTCCTGAGGGAGGG - Intergenic
1041664191 8:60426498-60426520 ACTGTAAGCTCCCTTAGGGCGGG - Intergenic
1041858159 8:62481499-62481521 CCTATGAGATGCTTGAGGGCTGG + Intronic
1042562778 8:70085543-70085565 CTTTTAAGCTTTGTGAGGGCAGG - Intergenic
1042673289 8:71287720-71287742 CACATCAGCTTCCTGAGGCCAGG + Intronic
1042795129 8:72653534-72653556 ACTATAAGCTCCATGAGGTCAGG + Intronic
1042962282 8:74316424-74316446 ACTAGAAGCACCCTGAGGGCAGG + Intronic
1043063348 8:75533002-75533024 ATTATAAGCTCCATGAGGGCAGG + Intronic
1043158623 8:76818014-76818036 CCTCTAAACTCCTTGAGGGCAGG - Intronic
1043458693 8:80437921-80437943 ACTATAAGCACCCTGAGGACAGG - Intergenic
1043766020 8:84133223-84133245 ACTATAAGCTTCATGACAGCAGG - Intergenic
1043887925 8:85623762-85623784 CCTATAAGCTCCAAGAGCGCAGG + Intergenic
1044304417 8:90621273-90621295 CCTATTAGCATCCTGAGTGTGGG - Intergenic
1044373631 8:91444188-91444210 GATATAAGCTTCTTGAGGGCAGG + Intergenic
1044531995 8:93317644-93317666 ATTATAAGGTTCTTGAGGGCAGG + Intergenic
1044649206 8:94476636-94476658 AATATAAGCTACATGAGGGCAGG + Intergenic
1044743296 8:95349197-95349219 AATATGAGCTTCATGAGGGCAGG + Intergenic
1045295833 8:100871136-100871158 CGTGTAAGCTTCCTGAAGGCAGG - Intergenic
1045344117 8:101279433-101279455 ACTGTGAGCTTCCTGAGAGCAGG + Intergenic
1045836483 8:106527296-106527318 CATATAAGCTCCATGAGAGCAGG - Intronic
1045913868 8:107443169-107443191 GCCATAAGATTTCTGAGGGCAGG + Intronic
1046564535 8:115882430-115882452 CATGTAAGCTCCATGAGGGCAGG - Intergenic
1047167461 8:122455210-122455232 CCTATAAGCTCCACGTGGGCAGG + Intergenic
1047204214 8:122790450-122790472 ACTATGACCTTCCTGAAGGCAGG - Intronic
1047407871 8:124600484-124600506 TCTGTGAGCTTCCTGAAGGCAGG + Intronic
1048010780 8:130454078-130454100 ACTATAAGCTTCATGAGCCCAGG - Intergenic
1048236235 8:132693562-132693584 AATATAAGCTTCTTGAGGGCAGG - Intronic
1048255315 8:132901120-132901142 ACTCTAAGCTGCTTGAGGGCAGG + Intronic
1048317751 8:133374831-133374853 ACTGTCAGCTGCCTGAGGGCAGG - Intergenic
1048387311 8:133924121-133924143 AATATAAGCTCCTTGAGGGCAGG + Intergenic
1048628208 8:136210453-136210475 ACTGTAAGCTTCCTGAGAGTGGG - Intergenic
1049628932 8:143641107-143641129 CCTCAAAGATTCATGAGGGCTGG + Intronic
1050159201 9:2699464-2699486 CATATAAGATTCCGGAAGGCAGG - Intergenic
1050692454 9:8243125-8243147 ACTATAAGCTCCGTGAGGGCAGG - Intergenic
1052067952 9:24045825-24045847 GCTATAAGCTCCCTGAGGCAAGG + Intergenic
1052363349 9:27583631-27583653 ACTGAAAGCTTCCGGAGGGCAGG + Intergenic
1052785721 9:32826485-32826507 CCTCGACGCTTCCTGAGGTCAGG - Intergenic
1053047596 9:34932957-34932979 AGTATAAGCTTCATGAGAGCAGG + Intergenic
1053287843 9:36861372-36861394 AATATAAGCTCCATGAGGGCAGG - Intronic
1053289952 9:36873268-36873290 ACTGTGAGCTCCCTGAGGGCAGG + Intronic
1053534214 9:38910122-38910144 CCTGTAAGCTCCTTGAGGGCAGG - Intergenic
1054206438 9:62134541-62134563 CCTGTAAGCTCCTTGAGGGCAGG - Intergenic
1054631920 9:67453805-67453827 CCTGTAAGCTCCTTGAGGGCAGG + Intergenic
1054706998 9:68472735-68472757 CCTATAAACTCCCTGAGGGAAGG - Intronic
1054843671 9:69769995-69770017 CCGACAAGCTACCTGATGGCAGG - Intergenic
1055013112 9:71588704-71588726 ACTATAATCTTCTTGAGGGCAGG - Intergenic
1055071201 9:72167965-72167987 GCTATAAGCTCCCTGAGAGCAGG + Intronic
1055502018 9:76910568-76910590 CCTGTGAGCTCCTTGAGGGCAGG - Intergenic
1055721061 9:79175316-79175338 CTTATAAGCTGTTTGAGGGCAGG + Intergenic
1056113270 9:83417324-83417346 AATATAAGCTCCCTGAGAGCAGG - Intronic
1056311518 9:85346314-85346336 ACTGTTGGCTTCCTGAGGGCAGG - Intergenic
1057731672 9:97614482-97614504 TTTATAAGCTTCATGAGGACAGG - Intronic
1057789058 9:98110622-98110644 ACTAGGAGCTTCTTGAGGGCAGG + Intronic
1057832951 9:98420558-98420580 ACTGTGGGCTTCCTGAGGGCAGG - Intronic
1057993492 9:99797879-99797901 TCTATGAGCTTCTTGAGGGCAGG - Intergenic
1058063438 9:100523389-100523411 ACTGTGAGCTTCCTGAGGGCAGG + Intronic
1058140306 9:101350725-101350747 AATAAAAGCTTCATGAGGGCAGG + Intergenic
1058397466 9:104570855-104570877 CATATAAGCTCCCTGAGGGTAGG + Intergenic
1058515676 9:105771917-105771939 TCTGTAAGCTCCTTGAGGGCAGG + Intronic
1058823248 9:108752375-108752397 ACTGTAAGCTGCATGAGGGCAGG - Intergenic
1059404769 9:114092836-114092858 ACTAGAAGCCTCCTGAGAGCAGG + Intronic
1059437417 9:114285025-114285047 ACTATAAGCCCCGTGAGGGCAGG - Intronic
1059446442 9:114341252-114341274 GTTATAAGCTCCCAGAGGGCAGG + Intronic
1059538118 9:115102758-115102780 ACTATAAGCTCTATGAGGGCAGG + Intronic
1059694494 9:116718008-116718030 ACTATAAGCTCTGTGAGGGCAGG - Intronic
1059770817 9:117423198-117423220 ACTGTAAGCTTCATGAGTGCAGG - Intergenic
1059771077 9:117426475-117426497 TCTGTAAGCTTCATGAGTGCAGG - Intergenic
1059819196 9:117953063-117953085 TCTTTAAGCTCCATGAGGGCAGG - Intergenic
1059935711 9:119308403-119308425 TCTGTAAGCTCCTTGAGGGCAGG + Intronic
1060050799 9:120376825-120376847 ACTATAAACTCCATGAGGGCAGG - Intergenic
1060055649 9:120410549-120410571 ACTATGAGCTCCCTGAGGGAAGG + Intronic
1060172246 9:121471324-121471346 TCTGTGAGCTTCCTGAGTGCAGG + Intergenic
1060225678 9:121788886-121788908 CCAATCAGCTCCCTGGGGGCTGG - Intergenic
1060279628 9:122207051-122207073 GCCACAAGCTCCCTGAGGGCAGG + Intronic
1060356837 9:122916310-122916332 ACTATAAGCTCCATGAGGGCAGG + Exonic
1060399078 9:123337234-123337256 ACTATAAACTCCATGAGGGCAGG - Intergenic
1061067178 9:128285776-128285798 GCTGTAAGCTTCATGAGGGCAGG + Intronic
1061141164 9:128767828-128767850 ATTGAAAGCTTCCTGAGGGCAGG + Intronic
1061420549 9:130471006-130471028 CCTCTCAGCTCCCCGAGGGCAGG - Intronic
1061621636 9:131814589-131814611 CCTTTCTGCTTCCTGTGGGCAGG - Intergenic
1061737601 9:132671813-132671835 AATGTAAGCTTCATGAGGGCAGG - Intronic
1062035037 9:134379232-134379254 CCTGTGGGCTCCCTGAGGGCGGG + Intronic
1203529928 Un_GL000213v1:131470-131492 ACAAAAAGCTTCTTGAGGGCAGG + Intergenic
1186058140 X:5673266-5673288 CCTATAATCTGCATAAGGGCAGG + Intergenic
1186068226 X:5789495-5789517 ACTGTAAGTTCCCTGAGGGCTGG - Intergenic
1186237693 X:7531412-7531434 TCTATAAGCTTCCAGAGGGCAGG - Intergenic
1186556033 X:10559770-10559792 ACTATAAGCTCCATGAAGGCAGG + Intronic
1187332441 X:18353948-18353970 GCTCTAAGCCTCCTGAGGGGCGG - Intronic
1187378867 X:18782149-18782171 ACTATAAGCTCCTTGAGGGTAGG + Intronic
1187514713 X:19958360-19958382 GATAGAAGCTTCCAGAGGGCAGG - Intronic
1187878676 X:23826102-23826124 GCTATAATCTTCCTGAGGCCAGG - Intergenic
1187964049 X:24593143-24593165 CCTATAAATTCCCCGAGGGCAGG + Intronic
1187977757 X:24720351-24720373 CCTGTAAGCTCCTGGAGGGCTGG + Intronic
1188252731 X:27918630-27918652 AATATAAGCTTCCTGTGGGCAGG + Intergenic
1188529907 X:31128233-31128255 ACTATAAGCCTCTTGAGGACGGG + Intronic
1189400828 X:40667191-40667213 AATATAAGCTTTGTGAGGGCAGG - Intronic
1189740433 X:44112088-44112110 CCAATAAGCATCTTGAGGGTCGG + Intergenic
1191880585 X:65840803-65840825 GTTATAAGCTTCCTGAGAGCAGG + Intergenic
1192173167 X:68869297-68869319 CCTGTAAGCTCCATGAAGGCGGG + Intergenic
1192563683 X:72144882-72144904 CCTATAAGCTTCGTGGGGGGTGG - Intergenic
1193774758 X:85628229-85628251 CCTACAGGCTCCCTGATGGCAGG + Intergenic
1194143708 X:90237479-90237501 CCTACAAGTTCCCTGAGAGCAGG + Intergenic
1194288949 X:92045217-92045239 ACTACAAGCTCCCTAAGGGCAGG - Intronic
1194777313 X:97981073-97981095 TCTGTAAGCTCCCTGAGGGCAGG - Intergenic
1194869644 X:99113315-99113337 CCTGAAAGCTCCATGAGGGCAGG + Intergenic
1195164831 X:102209002-102209024 AGTCTAAGCTTTCTGAGGGCAGG - Intergenic
1195194027 X:102478089-102478111 AGTCTAAGCTTTCTGAGGGCAGG + Intergenic
1195990862 X:110680896-110680918 ACTATAACCTTCTTGAGGGCAGG + Intronic
1196017790 X:110957888-110957910 ACCATAAGCTTCATGAGGGTAGG - Intronic
1196065702 X:111461985-111462007 CCCTAAAGCTTCCTGAGGGAAGG - Intergenic
1196122104 X:112062313-112062335 ACTGTAAGCTTCTTGAGAGCAGG - Intronic
1197238296 X:124093426-124093448 ACTGTAAGCTCCTTGAGGGCAGG + Intronic
1197635066 X:128905163-128905185 GCTACAAGCTCCTTGAGGGCAGG + Intergenic
1197682348 X:129399938-129399960 CCCTTAAGCTTGGTGAGGGCAGG - Intergenic
1197714332 X:129695503-129695525 CATGTAAGCTTCCCAAGGGCAGG + Intergenic
1197819298 X:130529472-130529494 CCTGCAAGGTTCCTGAGTGCGGG - Intergenic
1197994633 X:132360014-132360036 AATCTAAGCTTCATGAGGGCAGG - Intergenic
1198043050 X:132873592-132873614 ACTATGAGCTTCCTAAGAGCAGG - Intronic
1198154686 X:133947174-133947196 CCTGGAAGCTTCTAGAGGGCAGG + Intronic
1198183395 X:134231930-134231952 ACTATAAGCTCCAAGAGGGCAGG - Intergenic
1198223729 X:134626299-134626321 ACAGTAAGCTCCCTGAGGGCAGG + Intronic
1198405107 X:136304616-136304638 AGTGTAAGCTTCCTGAGGACAGG - Intronic
1198486683 X:137094374-137094396 ACTATAAGCTACGTGAAGGCAGG + Intergenic
1198523202 X:137473564-137473586 AATGTAAGCTCCCTGAGGGCAGG - Intergenic
1199141529 X:144319524-144319546 CAAATAAGCTTCCTGAGGTCAGG - Intergenic
1199522760 X:148754848-148754870 ATTATGAGCTTCCGGAGGGCAGG - Intronic
1199807597 X:151315892-151315914 ACTAAAAGCTCCTTGAGGGCAGG - Intergenic
1200606467 Y:5269785-5269807 ACTACAAGCTCCCTAAGGGCAGG - Intronic
1202627169 Y:56871549-56871571 AGTATAAGCTTCATGAGGACAGG - Intergenic