ID: 908551599

View in Genome Browser
Species Human (GRCh38)
Location 1:65214054-65214076
Sequence TTGCTAGGGCTGCCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908551599 Original CRISPR TTGCTAGGGCTGCCACAGAC TGG (reversed) Intronic
900387298 1:2416501-2416523 GTCCTGGGTCTGCCACAGACGGG - Intergenic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
906807379 1:48792382-48792404 TTCCTAGGGATGCCACAAACTGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
910236888 1:85046224-85046246 TTACAAGCGATGCCACAGACTGG - Intronic
914949949 1:152104476-152104498 TTGCTAGGGCTGTCATAGCAAGG + Intergenic
919936312 1:202253023-202253045 TTATTTGGGCTGCCACAGTCTGG - Intronic
920323600 1:205143744-205143766 TTGCTTGAGCTGCCAAAGAAGGG - Exonic
921446985 1:215258494-215258516 TTGCTAGAGTTGCCACCGACAGG - Intergenic
922452730 1:225749986-225750008 CTCCTAGCTCTGCCACAGACTGG + Intergenic
923148636 1:231215114-231215136 TTGCCAGAGCTGCCACAGCTGGG - Intronic
923877831 1:238069220-238069242 TTGCCAGGTATGTCACAGACAGG + Intergenic
1064065569 10:12178221-12178243 GTGGTAGGGCTGCCACACGCTGG - Intronic
1067740583 10:48892942-48892964 TTGCTAGGGCAGTCAAAAACTGG + Intronic
1070953961 10:80452840-80452862 CTGCCTGGGCTGTCACAGACAGG + Intergenic
1071755186 10:88529327-88529349 TTTCTAGTGCTGCCTCTGACTGG + Intronic
1074759761 10:116658327-116658349 TTCCTCGTGGTGCCACAGACTGG + Intergenic
1076346966 10:129785755-129785777 GTGCCTGGGCTTCCACAGACTGG + Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077507157 11:2935122-2935144 CTGCCAGGGCTCCCCCAGACCGG - Intergenic
1078196733 11:9142932-9142954 TTGGGAGGGCTGCAAAAGACAGG + Intronic
1079328439 11:19514034-19514056 CTCCTGGGGCTGCCACAAACTGG - Intronic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1081486262 11:43532002-43532024 TTGCTAGGGCTGCCATAACAAGG - Intergenic
1091402869 12:191161-191183 TTGCTTGGGCTGTGGCAGACTGG + Exonic
1094496520 12:30992504-30992526 TGGGTAGGGCAGCCACAGGCTGG + Exonic
1096649703 12:53056029-53056051 TTCCTGGGGCAGCCACAAACAGG + Intronic
1102732959 12:115130509-115130531 TTGCCAGGGTTGGGACAGACAGG + Intergenic
1105641339 13:22268214-22268236 TGCTTAGGGCTGCCACAAACTGG + Intergenic
1106112125 13:26786294-26786316 TTGCTGGGGGTGCCACAGCCTGG - Intergenic
1108355868 13:49628372-49628394 TTGCTGGGCTTGCCACAGAGAGG - Exonic
1117003302 14:51393688-51393710 TTGCTAGGGCTGCCATAGCAAGG + Intergenic
1119703097 14:76768408-76768430 TTGCTAGGGACTCCCCAGACAGG + Intronic
1120740642 14:88105762-88105784 TTGTGATGGCTGCAACAGACTGG + Intergenic
1122885881 14:104710068-104710090 TAGCTGGGGATGGCACAGACAGG - Exonic
1128589584 15:68883200-68883222 CTGCTAAGGCTGCCACTGTCAGG + Intronic
1129615573 15:77096821-77096843 CTGCTACGGCTGTCACAGCCTGG - Intergenic
1132797640 16:1733185-1733207 TTGCCAGCGCAGCCTCAGACAGG + Intronic
1133449226 16:5889694-5889716 TAGCATGGGCTGCCACGGACAGG - Intergenic
1134429615 16:14190878-14190900 TTTCCAGTTCTGCCACAGACTGG + Intronic
1135989047 16:27206133-27206155 TTGAGAGTGGTGCCACAGACTGG - Intronic
1137315740 16:47320255-47320277 TTGAAAGGGCTGCTACAAACTGG - Intronic
1140218740 16:73028455-73028477 ATGCTGGGGCTGCCACACACCGG + Intronic
1140858274 16:78997034-78997056 TTGATAGTGCTGCCACAGAGCGG + Intronic
1145288806 17:21526732-21526754 CTGCTAGGGCTACCAGACACTGG - Intronic
1145968562 17:28939765-28939787 ATGCTTGTGCTGCCACAAACAGG + Intronic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1150646814 17:66983754-66983776 TTGCAGGGGCTGCCACCCACTGG + Intronic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1152420871 17:80192489-80192511 CTGCTTGAGCTGCCAAAGACAGG - Exonic
1153736464 18:8074186-8074208 TTGCTAAGACTACCACAGATTGG - Intronic
1153943281 18:9995335-9995357 TTGCCAGGGCAACCAAAGACTGG - Intergenic
1157066368 18:44355599-44355621 TTTCTAGGGCAGCCAGAGAAAGG - Intergenic
1161431398 19:4234375-4234397 TGCCTGGGGCTGCCACAGAGGGG - Intronic
1164305987 19:24004073-24004095 TTCCTGTGGCTGCCACAGTCCGG - Intergenic
1166292508 19:41872102-41872124 TTACCAGGGCGGCCACACACGGG + Exonic
1166380621 19:42353447-42353469 CTGCTGGGGCCTCCACAGACTGG + Exonic
929863841 2:45701070-45701092 TTCCTAGGGCTGCCACAAAAAGG - Intronic
930334659 2:50029716-50029738 CTGCTTGGGCCACCACAGACTGG - Intronic
931073193 2:58678221-58678243 ATGGTAGGGTTGCCACAGGCAGG + Intergenic
934762581 2:96864676-96864698 TGGCCAGGGCTCCCACAGAGTGG - Intronic
934922830 2:98359718-98359740 TGGCCAGGGCGTCCACAGACAGG - Intronic
937886823 2:126905597-126905619 TTGTTTGGGCTGCTCCAGACTGG - Intergenic
939070412 2:137533720-137533742 TAGCCTGGGCTGCCACTGACAGG + Intronic
939837542 2:147149801-147149823 TTGCTGCGGCTGCTACAGACAGG - Intergenic
940162810 2:150731477-150731499 CTGCTAGGGCTGGCACATATGGG - Intergenic
1170480350 20:16759149-16759171 TTGCTAGGCCTGCTTCAGAAAGG - Intronic
1173470694 20:43321176-43321198 TTGCAGGGGCTGCCCCAGACCGG + Intergenic
1174139122 20:48400514-48400536 TTGCCAGAGCAGCCACAGAGGGG - Intergenic
1175068143 20:56308051-56308073 CAGCTAGGGTTGCCACAGGCTGG - Intergenic
1175950772 20:62581968-62581990 TTGCCAGAGCTGCCCCAGGCGGG + Intergenic
1180096281 21:45556676-45556698 TGGCCGGAGCTGCCACAGACAGG + Intergenic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180735588 22:18014155-18014177 CTGGTAGGACTTCCACAGACAGG - Intronic
1183453226 22:37907573-37907595 TTGCCAGGGCTCCCCCAGCCTGG + Intronic
1184848129 22:47101650-47101672 GTGCTAGGGCTGTAACAGACCGG + Intronic
949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG + Intronic
950408171 3:12817347-12817369 CTGAGAGGGCTGCCACACACCGG - Exonic
950980839 3:17302898-17302920 TTGCTAGGGCTTCCAAAGTGGGG - Intronic
953244258 3:41176459-41176481 TTGCTAGGGCTCCTGGAGACTGG + Intergenic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
963368679 3:144369586-144369608 CTGGTAGGGGTGCCACAGGCAGG - Intergenic
967382323 3:188872787-188872809 TTTCAACGCCTGCCACAGACTGG - Intronic
968641202 4:1716059-1716081 TTTCAAGGGCTGCCAAAGAGGGG - Exonic
970584335 4:17500707-17500729 TTGTTTGGGTAGCCACAGACTGG - Intronic
970589620 4:17547893-17547915 GTGCTAGGGCTGCCACAGACTGG - Intergenic
972394459 4:38646776-38646798 TTGCTAGGGCTGCCATAGCTGGG - Intergenic
974920611 4:68234325-68234347 TTGCTAGGGGTGCCAGAGTTAGG + Intronic
975351639 4:73353618-73353640 TTGCTAGGGCTGCCATAATAAGG - Intergenic
975793367 4:77980596-77980618 TTGCTAAGTCTGCTACAGATAGG - Intergenic
977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG + Intronic
984231128 4:177100537-177100559 TTGATAGGGCTTCCAAAGTCTGG - Intergenic
984891610 4:184498868-184498890 CTCCTAGGGCTGCCCCAGCCTGG + Intergenic
985164511 4:187078703-187078725 GTGTTAGGGCCTCCACAGACAGG + Intergenic
985585485 5:731004-731026 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985599000 5:815325-815347 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985599923 5:822431-822453 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985971141 5:3379503-3379525 TTGCTCGGGCTGCCCCAACCAGG + Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
999240936 5:150127010-150127032 TTGCTGGGGCTGCCACAGCTCGG + Intronic
1001159280 5:169300025-169300047 TTGCAAGGGCAGCCAGAGAGCGG + Intronic
1005577188 6:27200884-27200906 TTGCTAGGGCTACCATAGATGGG + Intergenic
1005842360 6:29752171-29752193 TTGCTAGAGCTGGCACAGGGAGG - Intergenic
1006283911 6:33078586-33078608 TTGCTAAGGGTTCCACAAACAGG + Intronic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1014887937 6:126804428-126804450 TTGTTAGTGCTGCCACCTACAGG - Intergenic
1016402514 6:143695847-143695869 TTGCTACGGCTGCTAAACACAGG - Intronic
1017722575 6:157254086-157254108 TTTCTAGTACTGCCACAGACAGG + Intergenic
1018423783 6:163662608-163662630 TTGCTAGGGCTGGGAGACACTGG - Intergenic
1019429631 7:992700-992722 TTGCTGGGGCTCCCTCAGAGCGG + Intergenic
1019822875 7:3258998-3259020 TTGCTGGGGCTGCCACTGAGAGG - Intergenic
1029312853 7:99683725-99683747 TTGCTTGGACTCCCACACACAGG + Intergenic
1036392155 8:8332899-8332921 TTGCAACGGCTGCCACACTCTGG + Intronic
1036700311 8:11008871-11008893 TTGCTAGGGCTCTTACAGCCTGG + Intronic
1040879749 8:52192050-52192072 TTCCCAGGGCTGGCACAGAGGGG + Intronic
1041709156 8:60877039-60877061 TTGCTGGGGCTGCCATAACCAGG - Intergenic
1044934772 8:97283028-97283050 ATTCTAGGGCTGCCAGAGATTGG - Intergenic
1047302146 8:123622673-123622695 TTGCTAGGTCTTCCAGTGACAGG - Intergenic
1051125605 9:13801014-13801036 GTGCTAGAGCTGGCACATACTGG + Intergenic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1057140463 9:92723856-92723878 TTGCTAGGGCTGCGGCTGAGGGG - Intronic
1057149294 9:92782165-92782187 TTGCTAGAGGTGAAACAGACAGG + Intergenic
1057975496 9:99601834-99601856 TTGCTAGTGCTCGCACAGAGTGG + Intergenic
1058971396 9:110086653-110086675 GTGATATGGCTGCCAAAGACAGG - Intronic
1059437576 9:114285759-114285781 CTGCCAGGGCTGGCACAGAAGGG + Intronic
1188743904 X:33817874-33817896 CTGCATGGGCTGCCACACACTGG - Intergenic
1189075527 X:37910118-37910140 TTGCTAGGGCTGCCATTCAAAGG + Intronic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1190152031 X:47957022-47957044 GTGCTATTGCTGCCACTGACAGG - Intronic
1190160629 X:48029127-48029149 GTGCTATTGCTGCCACTGACAGG + Intronic
1192810313 X:74541523-74541545 CTGAGAGGACTGCCACAGACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195068866 X:101260879-101260901 TTGCCTGGGCTGCAACAGAAAGG - Exonic
1199425325 X:147693816-147693838 TGGCTAGGGCTGATACAGATAGG - Intergenic