ID: 908555852

View in Genome Browser
Species Human (GRCh38)
Location 1:65255502-65255524
Sequence AAGGGGAAAGAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908555844_908555852 -2 Left 908555844 1:65255481-65255503 CCCAGAGTGCCTGAATTGAGCAA 0: 1
1: 0
2: 0
3: 19
4: 140
Right 908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG No data
908555845_908555852 -3 Left 908555845 1:65255482-65255504 CCAGAGTGCCTGAATTGAGCAAG No data
Right 908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG No data
908555841_908555852 30 Left 908555841 1:65255449-65255471 CCGAGTAATAGAGAATAGCAAGT No data
Right 908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908555852 Original CRISPR AAGGGGAAAGAGAGGGATGC AGG Intronic
No off target data available for this crispr