ID: 908558351

View in Genome Browser
Species Human (GRCh38)
Location 1:65280678-65280700
Sequence CCATTGGCCTGGAAGTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908558351 Original CRISPR CCATTGGCCTGGAAGTTAGG AGG Intronic
900613192 1:3553112-3553134 CCAAGGCCCTGGTAGTTAGGCGG - Intronic
900648745 1:3720797-3720819 CCTTTGCCAAGGAAGTTAGGGGG - Intronic
903994666 1:27298260-27298282 CCATTAGCCTGGAGGTGGGGAGG - Intronic
905540671 1:38757996-38758018 CCAGTGGACTGGCAGTCAGGAGG - Intergenic
906589798 1:47014303-47014325 TCACTGGCCTTGAAGGTAGGAGG - Intergenic
908558351 1:65280678-65280700 CCATTGGCCTGGAAGTTAGGAGG + Intronic
908695680 1:66838665-66838687 ACGTTGGCCTGAAAGTAAGGTGG - Intronic
915946176 1:160153310-160153332 ACGTTGGACTTGAAGTTAGGGGG - Intronic
918240084 1:182613260-182613282 CCTGTGACCTGGAAGGTAGGGGG - Intergenic
918448355 1:184635940-184635962 CCACCAGCCTGGAAATTAGGGGG - Intergenic
918713585 1:187762276-187762298 CACGTGGCCTGGAGGTTAGGAGG - Intergenic
920825136 1:209417871-209417893 CCTGTGGCCTGGGAATTAGGAGG - Intergenic
920849140 1:209616842-209616864 ACATTGTCCTGGGAGTGAGGTGG - Intronic
924638050 1:245807432-245807454 ACATTGGACCGGAAGTTCGGAGG - Intronic
1062855762 10:778799-778821 ACCTTGGCCTGGCAGTTTGGTGG + Intergenic
1062935192 10:1380289-1380311 CCAGTGCCCTGGAACTTAGCAGG - Intronic
1063615888 10:7600257-7600279 CCAGTGGACAGGATGTTAGGGGG + Intronic
1063686261 10:8239807-8239829 CAATTGGCCTAGAACTGAGGAGG + Intergenic
1066021212 10:31304430-31304452 CAAGTGGCCTGGAAATTAAGAGG + Intergenic
1068898616 10:62237832-62237854 GTATTGGCCTGGAATGTAGGAGG + Intronic
1068927642 10:62556675-62556697 CCATTTGACTGGAAGCTAGGAGG - Intronic
1070047629 10:72854720-72854742 GCTTTGGCCTGTAGGTTAGGGGG - Intronic
1070187404 10:74078375-74078397 CCAGTGGTCTGCAAGTAAGGGGG - Intronic
1071081855 10:81822291-81822313 CCACTTGCCTGGAGGTCAGGTGG + Intergenic
1071416452 10:85446173-85446195 CCAGTGCCCTTGCAGTTAGGTGG - Intergenic
1075126240 10:119702081-119702103 CCATTGTCATGGAAGTCAGGTGG - Intergenic
1075567502 10:123515277-123515299 GCAGTGGCCTGGAGGTCAGGAGG + Intergenic
1077930165 11:6722655-6722677 CCATTGGCCTGGAAGTAAGGTGG - Intergenic
1078285671 11:9952198-9952220 TCATTGGCCTGGAAGATACTAGG - Intronic
1078541141 11:12213949-12213971 CCATGGGCCTAGAGGATAGGAGG + Intronic
1078774642 11:14383060-14383082 ACATAGGACTGGAGGTTAGGAGG - Intergenic
1080641986 11:34163644-34163666 CCATGGGCTTGGCAGGTAGGAGG - Intronic
1081741900 11:45446819-45446841 GCATTGGCCTGGAAGTCAGGAGG + Intergenic
1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091240291 11:134047483-134047505 TCACTGCCCTGGCAGTTAGGAGG + Intergenic
1091680729 12:2524812-2524834 CCAGTCCCCTGGAAGTCAGGCGG - Intronic
1093119616 12:15252845-15252867 CCAGAGGCCAGGAAGTTTGGGGG + Intronic
1095516822 12:43015538-43015560 TCATAGGCCTGGAGGCTAGGAGG + Intergenic
1096192464 12:49629001-49629023 CTCTTTGCCTGAAAGTTAGGGGG - Intronic
1097014349 12:55974494-55974516 CCATTTGCCGGGAGGTGAGGAGG + Intronic
1098232071 12:68381626-68381648 CCATTTGCCGGCAAGATAGGAGG + Intergenic
1099573040 12:84348984-84349006 CTCTTGGCCTGGCAGTTAGATGG + Intergenic
1102068533 12:109999136-109999158 CCATTGGCTCTGAAGTCAGGGGG - Intergenic
1105464753 13:20628332-20628354 CCATTGGCCTGGAGGCTCAGCGG + Intronic
1105901335 13:24756935-24756957 CAAGTGGCCTGGAAATTAAGAGG - Intergenic
1106833901 13:33613621-33613643 CCATTGGTCTGGAAGCTTGAGGG + Intergenic
1110392132 13:74986216-74986238 TCTTTGGCCTGGAAGTTGAGAGG - Intergenic
1115854643 14:37617822-37617844 ACATTGGCCTGAAGTTTAGGAGG + Intronic
1117256230 14:53980867-53980889 CATTTGTCCTGGAAGTTGGGTGG + Intergenic
1118159211 14:63272136-63272158 GCATTGTTCTGAAAGTTAGGAGG + Intronic
1119468089 14:74875476-74875498 CACTTGGGCTGGGAGTTAGGAGG + Intergenic
1122366712 14:101198701-101198723 CCACAGGGCTGGAAGTCAGGAGG - Intergenic
1125175675 15:36818730-36818752 ACAGTGGACAGGAAGTTAGGGGG - Intergenic
1129226822 15:74174991-74175013 ACATTGGCCGGGAAGCCAGGCGG - Exonic
1130303700 15:82699248-82699270 CCAGTGGACTGGAACTTAGGTGG - Intronic
1131041958 15:89276952-89276974 GCATTTGCCTGGGAGTTTGGTGG + Intronic
1132552157 16:557970-557992 CCATGGGCCAGAAAGTTGGGGGG + Intergenic
1132678906 16:1131704-1131726 CCCTAGGCCTGGAAGGAAGGTGG - Intergenic
1132817229 16:1836558-1836580 CCTTTGGCCTGGTAGTGAAGAGG + Intronic
1133171617 16:3985650-3985672 CCCTTGGCTTGGAAGGTGGGAGG - Intronic
1135621815 16:23962351-23962373 CAATGGGGCTGGAAATTAGGTGG - Intronic
1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG + Intergenic
1138469489 16:57222004-57222026 CAATTGGCCTGGGTGTTAGAAGG - Intronic
1138520253 16:57567076-57567098 CCACTGGCCTGAAAGCTAGCAGG - Intronic
1140711848 16:77685986-77686008 CCGCTGGACTGTAAGTTAGGTGG + Intergenic
1142311381 16:89316057-89316079 ACACTGGCCAAGAAGTTAGGAGG + Intronic
1142611653 17:1111778-1111800 CCACTGGCCTGGAAGGGAGAAGG - Intronic
1144792159 17:17866558-17866580 CCATGGACCTGGAAGGCAGGTGG - Intronic
1150723820 17:67635705-67635727 GAATTGGCCAGAAAGTTAGGAGG + Intronic
1150901070 17:69277924-69277946 GCATTGGTCTGGCAGTTATGTGG + Intronic
1152781808 17:82230122-82230144 GCACAGGCCTGGAAGTCAGGTGG + Intronic
1152946134 17:83198624-83198646 CGAATTGCCTGGAGGTTAGGGGG - Intergenic
1153443727 18:5149692-5149714 ACATTGGCCAGGAACTTAGCTGG - Intronic
1155217577 18:23657017-23657039 GCAGTGGCCTGGAAGCCAGGTGG - Intronic
1158508237 18:58066221-58066243 CCATTTGTGTAGAAGTTAGGTGG + Intronic
1160139991 18:76312873-76312895 CCTTTGGCCTAGAAGTCTGGGGG - Intergenic
1160675026 19:385733-385755 CCGTTGGACTGGAATTTAGGTGG - Intergenic
1162510510 19:11115201-11115223 CCTCTGGCCTGGCAGTTATGTGG - Intronic
1165962586 19:39547795-39547817 CCATTGGCCTGGAAGACCTGAGG - Intergenic
1166275814 19:41753111-41753133 CCCTCAGCCTGGAAGTCAGGGGG + Intronic
925466311 2:4109613-4109635 CCATTGGCCTGGATGTTAATGGG + Intergenic
926765743 2:16321500-16321522 CCATTGGCCTGGCATTTACTGGG - Intergenic
930411283 2:51028514-51028536 CCTTTGGTCTGGAAGTTCTGTGG - Exonic
932619421 2:73257077-73257099 CCAGAGGCCTGGAAGGGAGGTGG - Exonic
934036940 2:88096085-88096107 CCATTGGACTGAAGGTTAAGAGG + Intronic
936958107 2:118043752-118043774 CTACTGACCTGGAAATTAGGAGG - Intergenic
938173483 2:129103442-129103464 GCATGGGCCTGGTACTTAGGAGG + Intergenic
938216927 2:129525992-129526014 CCAGTGGACTGGAGGTTTGGAGG + Intergenic
940991179 2:160098169-160098191 GCATAGGCCTGGAAGGCAGGTGG + Intergenic
942192499 2:173483936-173483958 CCCCTGGCCTGGCAGTTAGGAGG + Intergenic
942294967 2:174508179-174508201 CCATGGGCCTGGGAGTGAGTGGG + Intergenic
945892200 2:215442041-215442063 CCACTGGGCTGGAAGTTTGCTGG + Intergenic
946477603 2:220023643-220023665 CCATTGGCCAGCAAGTGATGGGG + Intergenic
948844646 2:240677243-240677265 CCAATGACCTGGAAGGCAGGCGG - Intronic
948849214 2:240697636-240697658 CCAATGACCTGGAAGGCAGGCGG + Intronic
1173962744 20:47087831-47087853 GCACAGGCCTGGCAGTTAGGAGG - Intronic
1179479361 21:41667986-41668008 GCATTGGCATGGAAGTGAGGAGG + Intergenic
1181435934 22:22910878-22910900 ACAGTGGCCTGGAAGATAGATGG + Intergenic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
950218932 3:11179658-11179680 ATATCGCCCTGGAAGTTAGGGGG + Intronic
952418124 3:33107960-33107982 CTATTGGCCTCTAAGTTTGGGGG - Intergenic
952820420 3:37481559-37481581 CCTTTGGCCTGGAGGTTGGAGGG - Exonic
954668635 3:52275428-52275450 GGAGTGGCCTGGTAGTTAGGAGG - Intronic
961613858 3:128163375-128163397 CCATTAGCCTGGAAGCTTGATGG + Intronic
962356587 3:134699337-134699359 GCTGTGGCCTGGAAGTTGGGAGG + Intronic
970115811 4:12694830-12694852 CCATTTGCCTGGGGGTTATGGGG - Intergenic
971326835 4:25651399-25651421 TCATAGGCCTGGAACTTAGTAGG - Intergenic
971698729 4:29939299-29939321 CCATTTGCCTTGAGGTTAGGGGG - Intergenic
975814849 4:78206803-78206825 CTATTAGGCTGGAAGTCAGGAGG - Intronic
975856366 4:78629190-78629212 ACATGGGCCTGGAAGTGAAGTGG + Intergenic
976157597 4:82163960-82163982 CCATTCTCATGGAAGTAAGGTGG - Intergenic
977263190 4:94822817-94822839 CCATTGGCTTGGCAGATATGAGG - Intronic
979107737 4:116708798-116708820 CCCTTTGCCTGGAACTTAGCAGG + Intergenic
979206070 4:118039819-118039841 CCACTTGCCTGGAACTTAGAAGG + Intronic
987346187 5:16980861-16980883 ACATGAGCCTGGGAGTTAGGAGG + Intergenic
991254487 5:64599380-64599402 CCACTTGCCTTGAAGTGAGGAGG + Intronic
998718878 5:144919229-144919251 CCATTGGGCTGGAAGGTAGATGG + Intergenic
998766697 5:145496507-145496529 GGATTGGCCAGCAAGTTAGGAGG + Intronic
1001173197 5:169441258-169441280 CCAGTGGCCTGAGAGATAGGAGG + Intergenic
1003259831 6:4506934-4506956 TCATAGGCCAGGAGGTTAGGAGG - Intergenic
1003370415 6:5520088-5520110 CTCTTGGCCTGGAACTAAGGAGG + Intronic
1004338885 6:14789549-14789571 GCACTGGCCTGGGAGTTAGGAGG + Intergenic
1007420324 6:41715277-41715299 AGCTTGGCCTGGAAGTTGGGAGG - Intronic
1009650216 6:66466706-66466728 GCATTGGCTTGGAAGTCAGGTGG - Intergenic
1012917685 6:105188319-105188341 CCATTGGCCTGGTGGTTAAGTGG + Intergenic
1015924321 6:138294148-138294170 CCATATGCCAGGAAGTTAGCAGG + Intronic
1015929897 6:138348821-138348843 CCACTGGCTTTGAACTTAGGAGG - Intergenic
1019463698 7:1174976-1174998 TCAGGGGCCTGGAAGTGAGGTGG - Intergenic
1021624826 7:22582861-22582883 CCATTGGCCTGGAAGATCTGGGG - Intronic
1022273746 7:28836032-28836054 ACATTGGCCTAGAAATCAGGAGG - Intergenic
1023495981 7:40797602-40797624 CCATTGGCCTGTAAGGTACATGG - Intronic
1023742059 7:43289613-43289635 CCATTGGCCTGGCCCATAGGTGG + Intronic
1024248435 7:47488401-47488423 CCATAGTCCTGGAGGCTAGGAGG + Intronic
1024581597 7:50805261-50805283 CCATGGGCCTGGGAGTCAGGAGG - Intergenic
1024845831 7:53641440-53641462 CTATTGGCCTGGAAGATCTGAGG - Intergenic
1032519465 7:132533027-132533049 CCTTCGGTTTGGAAGTTAGGAGG - Intronic
1036425411 8:8641423-8641445 GCATTTGTCTGGGAGTTAGGAGG - Intergenic
1039373171 8:37007608-37007630 TCATTTGCCTTAAAGTTAGGTGG + Intergenic
1039959541 8:42235682-42235704 CCAGAGGCTTGGAGGTTAGGAGG - Intergenic
1040356571 8:46624319-46624341 CCATTGGAATGGAAGGTTGGAGG - Intergenic
1042209988 8:66370333-66370355 CCATTGTCCTGGAATTTGGAAGG - Intergenic
1042607952 8:70565451-70565473 CCAACTGCCTGGGAGTTAGGTGG + Intergenic
1042758307 8:72242779-72242801 ACATTGGCCTGGGGATTAGGGGG - Intergenic
1044624522 8:94223771-94223793 CCAGTGGCCTGGGAGTGAGGGGG + Intergenic
1047078962 8:121438030-121438052 CTATTGGCCTAGAAGTTATCAGG - Intergenic
1047361356 8:124172147-124172169 CCACTGGCCTGGATATAAGGTGG + Intergenic
1047615797 8:126561613-126561635 GCATGGGCCTGGAAGTAAAGTGG - Intergenic
1049545170 8:143227457-143227479 CCTCTGGCCTGGCTGTTAGGTGG - Intergenic
1051519414 9:17968577-17968599 CCATTGGCATTGTAGTTAGGAGG + Intergenic
1055384089 9:75742422-75742444 CCACTAGCCTGGAAGATAAGAGG + Intergenic
1055980954 9:81999879-81999901 CCACTGGGCTGGGAGTGAGGTGG + Intergenic
1057782176 9:98058765-98058787 CCATTGAGCTGGAATCTAGGTGG + Intronic
1062694674 9:137867308-137867330 CAATTGGCCTGGCAGGCAGGTGG + Intronic
1189706002 X:43759556-43759578 TCCTTGGCCTGGTAGTTAGATGG + Intergenic
1191867008 X:65712083-65712105 CCATTGGACTGGAATTTGAGGGG - Intronic
1192333995 X:70202304-70202326 CCATTGGCCTGGTAGGCTGGAGG + Intronic
1193534068 X:82691237-82691259 CCATTGGCCTGAAATTGGGGTGG + Intergenic
1194760906 X:97795001-97795023 ACACTGGCCAGGGAGTTAGGGGG + Intergenic
1195553697 X:106197313-106197335 CCTTTGTCCTGGAAATTAGGGGG + Intronic
1197173632 X:123461906-123461928 CCTTTAGCTTGGAGGTTAGGTGG + Intronic
1197717324 X:129718922-129718944 GCCCTGGGCTGGAAGTTAGGAGG + Intergenic
1198438522 X:136639737-136639759 CTACTGGGCTGGAAGTCAGGAGG + Intergenic
1199852984 X:151738544-151738566 CCATTGGCCTTGATGGCAGGAGG - Exonic
1201727277 Y:17167588-17167610 TCATTGGGCTGGCTGTTAGGGGG + Intergenic