ID: 908559064

View in Genome Browser
Species Human (GRCh38)
Location 1:65286633-65286655
Sequence AAAAGATGGTAGGAGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908559059_908559064 30 Left 908559059 1:65286580-65286602 CCTACAGATCACTTTTTAGGGTT No data
Right 908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG No data
908559061_908559064 0 Left 908559061 1:65286610-65286632 CCATGTGCAGAAGACTACAACAG No data
Right 908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG No data
908559060_908559064 1 Left 908559060 1:65286609-65286631 CCCATGTGCAGAAGACTACAACA 0: 1
1: 0
2: 0
3: 14
4: 161
Right 908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908559064 Original CRISPR AAAAGATGGTAGGAGTGTGT TGG Intronic
No off target data available for this crispr