ID: 908560138

View in Genome Browser
Species Human (GRCh38)
Location 1:65298036-65298058
Sequence GACACTAGGGTTTTTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908560138_908560142 -9 Left 908560138 1:65298036-65298058 CCTTTAAAAAAAACCCTAGTGTC No data
Right 908560142 1:65298050-65298072 CCTAGTGTCTGAATTTTCCAGGG 0: 1
1: 0
2: 3
3: 19
4: 185
908560138_908560140 -10 Left 908560138 1:65298036-65298058 CCTTTAAAAAAAACCCTAGTGTC No data
Right 908560140 1:65298049-65298071 CCCTAGTGTCTGAATTTTCCAGG 0: 1
1: 2
2: 7
3: 57
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908560138 Original CRISPR GACACTAGGGTTTTTTTTAA AGG (reversed) Intronic
No off target data available for this crispr