ID: 908561326

View in Genome Browser
Species Human (GRCh38)
Location 1:65309557-65309579
Sequence GCGAGGCGAAGCCGCCGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908561326_908561332 0 Left 908561326 1:65309557-65309579 CCAGGGCGGCGGCTTCGCCTCGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 908561332 1:65309580-65309602 CCGGCGAAGCTTCTCTCCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
908561326_908561329 -3 Left 908561326 1:65309557-65309579 CCAGGGCGGCGGCTTCGCCTCGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 908561329 1:65309577-65309599 CGCCCGGCGAAGCTTCTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908561326 Original CRISPR GCGAGGCGAAGCCGCCGCCC TGG (reversed) Exonic
900003488 1:29100-29122 GCGAGCCCAAGACGCCTCCCGGG + Intergenic
900023208 1:199616-199638 GCGAGCCCAAGACGCCTCCCGGG + Intergenic
900208073 1:1439969-1439991 GCCAGGCGAGGCCCCAGCCCTGG - Exonic
900314507 1:2050306-2050328 GCGAGGCGGGGCCGCCACCTGGG - Intergenic
900349526 1:2228118-2228140 GAGAGGCGCCTCCGCCGCCCCGG + Intergenic
900369237 1:2324028-2324050 GAGAGGCGAGGCCGCAGCCCAGG - Intronic
900513060 1:3069429-3069451 GGGAGGCGGAGCAGCCCCCCGGG - Intronic
901045372 1:6393000-6393022 CCGTGGCGCGGCCGCCGCCCTGG + Intronic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
910935527 1:92483006-92483028 GCGGGGCGAAGGCGGAGCCCCGG - Exonic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
919103491 1:193121924-193121946 GCGAGGCACATCCGCCGCCAGGG - Intergenic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
920915172 1:210252985-210253007 GCGAGGCGAAGCCCAGGCGCGGG - Intergenic
921023669 1:211259124-211259146 CCGAGGCGTGGCCGCCGCTCGGG - Intronic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
1075079154 10:119371195-119371217 GCGGGGAGAAGCTGCAGCCCGGG - Intronic
1075630802 10:123999774-123999796 GTGAGGCGAAGGTGCCGGCCTGG + Intergenic
1075630855 10:123999958-123999980 GTGAGGCGAAGGTGCCGGCCTGG + Intergenic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1079297008 11:19242370-19242392 CCGAGGCAGCGCCGCCGCCCCGG - Intergenic
1084791468 11:71477744-71477766 CAGAGGCGGAGCCGCAGCCCCGG - Intronic
1091376907 12:31154-31176 GCGAGCCCAAGACGCCTCCCGGG + Intergenic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1101592956 12:106139376-106139398 GCCAGCCGCAACCGCCGCCCCGG - Exonic
1103308905 12:119989265-119989287 GCGATGTGGAGCCGCCGCCTCGG + Intergenic
1103828710 12:123762146-123762168 GCGAGCCGCAGCCCACGCCCCGG - Intergenic
1104568276 12:129903875-129903897 CCGAGGCGCAGCGGCCGGCCTGG - Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1112489067 13:99845717-99845739 GCGAAGAGAAGCCACCTCCCGGG + Intronic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1119306625 14:73612917-73612939 GCCAGGCACAGCAGCCGCCCGGG - Intronic
1131186037 15:90275046-90275068 GCGACTCCCAGCCGCCGCCCGGG + Exonic
1132398504 15:101490438-101490460 GCGAGGCTAAGCGGACGGCCTGG - Intronic
1132450013 15:101961840-101961862 GCGAGCCCAAGACGCCTCCCGGG - Intergenic
1132841625 16:1980890-1980912 GCGTGGGGAAGCCGCCACCGCGG + Exonic
1132988077 16:2778187-2778209 GAGAGGCGAAGGAGCAGCCCTGG + Intergenic
1133286552 16:4693472-4693494 CGGAGGCGGGGCCGCCGCCCAGG + Intergenic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1135686889 16:24504989-24505011 GCAAAGCGAAGTCCCCGCCCTGG + Intergenic
1140274522 16:73496824-73496846 GCGAGGGGAAGCCTCCTACCTGG - Intergenic
1142980665 17:3669203-3669225 GCGGGGCAACGCCGCCGTCCTGG + Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148549748 17:48543424-48543446 GCGAGGCGGAGGGGCCGCCCGGG + Exonic
1149430740 17:56594186-56594208 GCGGGACGAAGCAGCAGCCCCGG + Exonic
1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG + Exonic
1160635241 19:70708-70730 GCGAGCCCAAGACGCCTCCCGGG + Intergenic
1160838639 19:1136506-1136528 GGGAGGAGGAGCCTCCGCCCAGG - Intronic
1160853513 19:1205954-1205976 GCGAGGGGGACGCGCCGCCCGGG + Intronic
1161290752 19:3492274-3492296 GGGAGGCGAGGAGGCCGCCCTGG - Exonic
1161791253 19:6361626-6361648 GCGAGGCGAGGCCCCAGCGCGGG - Exonic
1162809175 19:13153973-13153995 GTGGAGAGAAGCCGCCGCCCGGG + Exonic
1163158106 19:15449800-15449822 GGGAGGCGGCGCCGCCGGCCAGG + Exonic
1163579858 19:18131904-18131926 GCGTGGCGCAGTCGCCGCCTGGG - Exonic
1164834724 19:31349760-31349782 GGGACGCGCAGCCGCCGCCGCGG + Intergenic
1165075889 19:33279706-33279728 GCGAGGGGAAGCCCCGGTCCCGG - Intergenic
1168154013 19:54463353-54463375 GCGAGGCGCAGCCGGAGGCCGGG - Exonic
926035359 2:9631360-9631382 GGGAGACGCAGCCGCCGCCTAGG - Intergenic
926101661 2:10122274-10122296 GGGAGGCGGGGCCGCGGCCCGGG + Intergenic
927256379 2:21043968-21043990 CCGAGGCCAGGCCGCAGCCCAGG - Exonic
931710910 2:64988878-64988900 GCGGGGCGAAAGCGCCACCCGGG + Intronic
936566239 2:113584335-113584357 GCGAGCCCAAGACGCCTCCCGGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
943333858 2:186590351-186590373 CCGAGGCGCAGCCGTCGCCGCGG - Exonic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946386878 2:219388581-219388603 GCGACCCGCAGCCGCCGCCAGGG + Intronic
946921382 2:224585024-224585046 GCGACCTGAAGCCGCCGCCGGGG - Exonic
947257220 2:228180579-228180601 GCCACGCTAAGCCGCTGCCCAGG + Intronic
1169088292 20:2840661-2840683 ACGTGGCGAGGCCGCCGCCGCGG - Exonic
1170918394 20:20651086-20651108 GGGAGGAGAAGGCGCTGCCCAGG + Intronic
1171473708 20:25391143-25391165 GCGAGGCAGAGCCGCAGCGCTGG + Intergenic
1172284735 20:33732392-33732414 GCGCCGCCAAGCCGCCTCCCTGG - Intronic
1172421924 20:34825376-34825398 GCGGGGAGGAGGCGCCGCCCGGG - Intronic
1172487033 20:35304499-35304521 GAGAGGGGAAGCTGCCACCCTGG - Intronic
1172764962 20:37346298-37346320 GCGCGGGGGAGCCCCCGCCCCGG + Intronic
1173837067 20:46132827-46132849 GGGAGCCCAAGCCGCCGCCAGGG - Intergenic
1174436459 20:50510499-50510521 AGGAGGCGCAGCAGCCGCCCTGG + Exonic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1175225292 20:57440890-57440912 CCGAGGGGAACCCGCCCCCCCGG - Intergenic
1178402517 21:32298924-32298946 TCGAGGCGAGGCTGCCGGCCCGG + Intronic
1179902815 21:44402706-44402728 GCGAGGCCAAGCTGCCCCCCAGG + Intronic
1180170626 21:46056455-46056477 GCGAAGGGAAGCTGCCTCCCTGG - Intergenic
1182578981 22:31292399-31292421 GGGAGGCAGAGCCGCCGCCAAGG - Exonic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1183586469 22:38755800-38755822 CCGAGGCCAGGCCGCCGCCGGGG + Exonic
1184208923 22:43023822-43023844 GTGAGGTGAAGCCACCCCCCAGG - Intergenic
949522369 3:4868660-4868682 ACGCGGCGAAGCCGGCGCCCCGG - Intronic
950345361 3:12287941-12287963 CCGAGCCGCAGCCGCCGCCTGGG + Intronic
952416820 3:33097118-33097140 GTGACGCGAAGCGGCCGGCCTGG - Exonic
952491739 3:33880467-33880489 GCGAGGCCAGGCAGCAGCCCAGG + Intergenic
953561185 3:43995149-43995171 GCGAGGCGTAGCGGCCGCGGAGG + Intergenic
954796143 3:53162034-53162056 GCGAGGAGGAGGCGCCGCGCGGG - Intronic
961688307 3:128650608-128650630 GGGACGTGGAGCCGCCGCCCAGG + Exonic
969379193 4:6783035-6783057 GGGAGGCCGAGCCGCCGCCGAGG + Intronic
969737348 4:9000616-9000638 GCGAGGCGCAGGCCCCGGCCCGG + Intergenic
971244051 4:24912799-24912821 GCGAGGTGAGGCCGCGGCGCCGG - Exonic
998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG + Intronic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1007553531 6:42747239-42747261 CCGAGACGCAGCCGCTGCCCGGG + Intronic
1007682626 6:43645042-43645064 GCTAGGAGAAGCCGCCTCCATGG - Exonic
1011506300 6:88047861-88047883 CCGAGGCGCAGTCGCCGCCGCGG - Exonic
1011516948 6:88165917-88165939 GGGAGCCGAGGCCCCCGCCCGGG + Exonic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019076714 6:169393897-169393919 GTGAGCCGCAGCTGCCGCCCAGG - Intergenic
1019594011 7:1850148-1850170 TCCAGGGGAAGCCGCTGCCCCGG - Intronic
1022714919 7:32891192-32891214 CCGAGGCCAAGGCGCCGCCCGGG + Intronic
1032119354 7:129145105-129145127 GCGGGGGGACCCCGCCGCCCAGG - Intronic
1032279938 7:130492115-130492137 GCGAGGCGCAGCTGCCGCAGAGG - Exonic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1034469860 7:151249248-151249270 GCAGGGCCACGCCGCCGCCCGGG - Intronic
1035052119 7:156005009-156005031 GCGAGGCCAAGCCTGCGCCCCGG - Intergenic
1035752065 8:2002950-2002972 GCGCCTCGAAGCCGCCGCCCTGG - Exonic
1036295911 8:7537074-7537096 GGGAGGAGGAGGCGCCGCCCTGG + Intergenic
1036326655 8:7783945-7783967 GGGAGGAGGAGGCGCCGCCCTGG - Intergenic
1038176386 8:25184890-25184912 GCGGGGCGAGGTCGCCGCCATGG + Exonic
1038781971 8:30575717-30575739 GCGAGGCGGAGCAGCCCTCCTGG - Intergenic
1039542485 8:38382916-38382938 GCGAGCCGGCGCCGCCGGCCGGG - Intergenic
1039591942 8:38757043-38757065 GCGAGGAGGCGCCGCTGCCCGGG + Intronic
1043527448 8:81112077-81112099 CCGAGGCGGAGCAGCCGCGCGGG + Intergenic
1044971455 8:97624466-97624488 TCGAGGCGATGCCAGCGCCCCGG + Intergenic
1044999754 8:97869212-97869234 GCGAGGCGAAGAGGCCGACGAGG + Exonic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049409014 8:142464201-142464223 GAGGGGCCAGGCCGCCGCCCCGG + Exonic
1049411453 8:142475651-142475673 GCGGGGCGGAGCCGGAGCCCTGG + Intronic
1049777562 8:144413647-144413669 GGGAGGCGGAGCCGCAGGCCTGG + Intronic
1049814502 8:144591848-144591870 ACGAGGCGACGCCGCCATCCAGG - Intronic
1050151494 9:2622532-2622554 ACGAGGCGAAGCAGCGGCTCTGG - Intronic
1050537833 9:6645574-6645596 GCCGGGCGCAGCCGCCACCCGGG - Exonic
1051445447 9:17135064-17135086 GGGAGGCGAACGCGCCGCCATGG - Exonic
1057208204 9:93185405-93185427 CCGAGGCGAAGCCTGAGCCCGGG + Exonic
1058058783 9:100474018-100474040 GCGAGGCTGAGCGGCCGGCCGGG + Intronic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1059390987 9:113999365-113999387 GCGAGGCGCAGGCGGGGCCCTGG + Intronic
1061349515 9:130053639-130053661 GCGAGGCGGAGGTGCGGCCCGGG + Exonic
1062276697 9:135734787-135734809 GCGAGCCGCATCCGCAGCCCAGG + Intronic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic