ID: 908562470

View in Genome Browser
Species Human (GRCh38)
Location 1:65320470-65320492
Sequence TCATTTACAAGCTGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908562469_908562470 -1 Left 908562469 1:65320448-65320470 CCAAATCTAAGCTCTGACTTTGT 0: 1
1: 0
2: 1
3: 16
4: 222
Right 908562470 1:65320470-65320492 TCATTTACAAGCTGTGACCTTGG 0: 1
1: 0
2: 8
3: 36
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908562470 Original CRISPR TCATTTACAAGCTGTGACCT TGG Intronic
900895539 1:5480485-5480507 CCATTTGCCAGCTGTGTCCTCGG + Intergenic
901463418 1:9405284-9405306 ACATTTATAAGCTGTGATCTTGG - Intergenic
901863197 1:12087815-12087837 CCACTTAAAAGCTGTGACTTAGG + Intronic
903186120 1:21630135-21630157 TCATTTACTGTGTGTGACCTTGG - Intronic
903848867 1:26294478-26294500 CCATTTCCTGGCTGTGACCTTGG + Intronic
904216987 1:28929180-28929202 ACTTATACATGCTGTGACCTTGG + Intronic
904859706 1:33526617-33526639 TCACTGACCAGCTGTGTCCTTGG - Intronic
905008736 1:34732153-34732175 CCTTTTACTAGCTGTGACTTTGG + Intronic
905394530 1:37658346-37658368 TCACTTACTGGGTGTGACCTCGG + Intergenic
905770428 1:40634535-40634557 CCACTTAATAGCTGTGACCTTGG + Intronic
906523687 1:46481675-46481697 CTACTTACTAGCTGTGACCTTGG - Intergenic
908562470 1:65320470-65320492 TCATTTACAAGCTGTGACCTTGG + Intronic
908992009 1:70102832-70102854 CCATTTACAATTGGTGACCTTGG - Intronic
909793910 1:79709039-79709061 TCATTTTTAACCTGTGAGCTAGG - Intergenic
912123241 1:106500474-106500496 ACACTTACTAGCTATGACCTTGG + Intergenic
912648737 1:111419598-111419620 TCAGTTACAAGGTGAGACCCTGG - Exonic
913586250 1:120278178-120278200 ACCTTAACAACCTGTGACCTTGG + Intergenic
913621936 1:120620191-120620213 ACCTTAACAACCTGTGACCTTGG - Intergenic
914568259 1:148890036-148890058 ACCTTAACAACCTGTGACCTTGG + Intronic
914604566 1:149240213-149240235 ACCTTAACAACCTGTGACCTTGG - Intergenic
915223979 1:154398092-154398114 CCATTGACCAGCTGGGACCTTGG - Intergenic
916156157 1:161850921-161850943 TCATATCCAAGGTGTGACGTAGG - Intronic
920501053 1:206485725-206485747 TCATTTACTGGCTGTGACTCAGG - Intronic
920593747 1:207248219-207248241 TCATATACATGCTGAGCCCTGGG + Intergenic
921911039 1:220549205-220549227 GCATTTATTAGATGTGACCTTGG + Intronic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
1063619288 10:7631003-7631025 CCATTTCCAAGCTGCCACCTGGG - Intronic
1063625613 10:7686939-7686961 TTATTTATTAGCTATGACCTTGG - Intergenic
1065242881 10:23725454-23725476 TCCTTTACAGGCTGTGATGTGGG + Intronic
1066591326 10:36997901-36997923 TCATTTAAGAGTTGTGATCTTGG + Intergenic
1067570404 10:47367467-47367489 TCACATACTAGCTGTGACCCTGG - Exonic
1068710490 10:60128314-60128336 CCACTTACAAGCTGTGTCCCCGG + Intronic
1069099640 10:64303746-64303768 CCATTTGCAAGCTGTGAGCCTGG + Intergenic
1071150433 10:82628045-82628067 CCATTTACTAGCTGTGACCTTGG - Intronic
1072965113 10:99965269-99965291 CCACTTAATAGCTGTGACCTTGG - Intronic
1073203245 10:101753264-101753286 TTACTAACCAGCTGTGACCTTGG - Intergenic
1073392933 10:103193743-103193765 CCACTTACAAACTGTAACCTCGG + Intergenic
1073809434 10:107136549-107136571 TCACTTACCAGTTGTGACTTTGG - Intronic
1073992417 10:109277342-109277364 CCACTTACCAGCTGTGAGCTTGG - Intergenic
1074141344 10:110675749-110675771 CCACTTACCAGCTGTGACCTTGG + Intronic
1074346426 10:112690633-112690655 CCATTTATAAGCTGTCACTTTGG + Intronic
1075138425 10:119808455-119808477 TTCTTAACTAGCTGTGACCTTGG + Intronic
1075646163 10:124098048-124098070 ACATTTACAGGCTCTGAGCTAGG - Intergenic
1076579511 10:131497246-131497268 TCATTCAGAAACTTTGACCTGGG + Intergenic
1077385097 11:2265645-2265667 TCATTTTCAAGCTGAGTCCAAGG + Intergenic
1077963048 11:7095858-7095880 TCATTCACTAACTGTGATCTTGG - Intergenic
1077980347 11:7293706-7293728 TCATTTATATTTTGTGACCTTGG - Intronic
1078281579 11:9907415-9907437 TCATTTACATGCTTTCTCCTTGG + Intronic
1078746975 11:14125122-14125144 ACAAGTACAAGCTGTGTCCTGGG + Intronic
1078952873 11:16154928-16154950 TCATTTACAAGTCGTGAACCTGG + Intronic
1079396203 11:20065982-20066004 CCACTTACCAGCTGTGACCCTGG + Intronic
1079801305 11:24872873-24872895 CCATTTACAAGCTGTCACCATGG - Intronic
1079854528 11:25585405-25585427 TCTTTTACAAGCAGGGAACTAGG + Intergenic
1080658165 11:34274326-34274348 TGGCTTACTAGCTGTGACCTTGG - Intronic
1081651504 11:44827133-44827155 TCATGTGTAAGCAGTGACCTTGG - Intronic
1083503517 11:63133453-63133475 TTATTTAAAAATTGTGACCTGGG - Intronic
1084452080 11:69245174-69245196 TCATTTTACAGCTGTGACCCAGG + Intergenic
1085896964 11:80651368-80651390 TCATTTAGGAGTTGTGACCTTGG - Intergenic
1086122916 11:83318892-83318914 CCACTCACAAGCTGTCACCTTGG - Intergenic
1087054341 11:93918863-93918885 TCATTTACAGCTGGTGACCTTGG + Intergenic
1088440798 11:109867828-109867850 TCATGTAGCAGCTGTGACCAAGG - Intergenic
1089290059 11:117432168-117432190 AGATTTACTAACTGTGACCTTGG - Intronic
1089794183 11:120967152-120967174 GCATTCACAACCTGTGTCCTGGG + Intronic
1089880578 11:121769460-121769482 TCATTTACAAACAGTGAGCAGGG + Intergenic
1091172198 11:133529143-133529165 TCACTTAAAACCTGTGACCATGG - Intronic
1091231909 11:133993541-133993563 TCACTAACCAGCTGTGACCAAGG + Intergenic
1091889526 12:4042184-4042206 CCAATTACTAACTGTGACCTTGG + Intergenic
1092082172 12:5725366-5725388 TCATTTACAAGTGGGGTCCTTGG - Intronic
1092926242 12:13275096-13275118 CCATTTTTTAGCTGTGACCTTGG - Intergenic
1095882852 12:47156840-47156862 TTACTTACTAGCTGTGATCTTGG + Intronic
1096328312 12:50686150-50686172 CCATTTATTAGCTGTGACTTTGG - Intronic
1096518667 12:52172044-52172066 TCACTTACAAACTGGGACCTTGG - Intronic
1097932377 12:65203112-65203134 TCATTTATAAGCTTCCACCTTGG - Intronic
1098065458 12:66610722-66610744 TCTTTTACAAGCTGTGAACCTGG - Intronic
1098121557 12:67245826-67245848 CCATTTACAAACTATGATCTTGG - Intergenic
1100279156 12:93101638-93101660 CCACTAACCAGCTGTGACCTCGG - Intergenic
1100851034 12:98711667-98711689 TCATCTAAAACATGTGACCTGGG - Intronic
1101469662 12:104984647-104984669 TCATTTAGTAGCTGTGACTTTGG - Intergenic
1101739621 12:107490840-107490862 TCATTTAAAAGCTCTGAGCCAGG - Intronic
1102081884 12:110104910-110104932 ACATTAACCAGCTGTGTCCTTGG + Intergenic
1103201144 12:119088998-119089020 CCATTTTCAAGCTGTGATCCCGG - Intronic
1103201295 12:119090147-119090169 CCATTTTCAAGCAGTGATCTTGG + Intronic
1103278908 12:119738110-119738132 TTATTTACTAGCAGTGACCTTGG - Intronic
1103630048 12:122252709-122252731 TCACTTACTAGCTGTGCCCTGGG + Intronic
1103965162 12:124634123-124634145 TCATTTACAGTCTGACACCTGGG + Intergenic
1104213272 12:126711048-126711070 TCTTTTACCAACTGTGACTTGGG - Intergenic
1106527392 13:30553402-30553424 TCATTCACTAGCCATGACCTTGG + Intronic
1107877789 13:44805833-44805855 TCATTTCCAATCCCTGACCTTGG - Intergenic
1107887680 13:44887523-44887545 CCATTAACTAGCTGTGTCCTTGG - Intergenic
1109130711 13:58581812-58581834 TTATTTACAAACTATCACCTTGG + Intergenic
1110292103 13:73819175-73819197 TCATTTGCAACATCTGACCTTGG + Intronic
1110935186 13:81278959-81278981 GCACTTTAAAGCTGTGACCTGGG - Intergenic
1112824130 13:103372392-103372414 TCACTTAGATGCTGTAACCTTGG + Intergenic
1116414451 14:44663638-44663660 TCATTTACAAGCTGTCAGAGAGG + Intergenic
1117374615 14:55109148-55109170 TCGTTTACTAACTGTGAACTTGG + Intergenic
1117709566 14:58511444-58511466 GCATTTTCTAGCTTTGACCTTGG - Intronic
1117717438 14:58595436-58595458 TCATTTACTTACTGTGATCTTGG + Intergenic
1118117263 14:62794469-62794491 TTACTTACTAGCTGTGACCCAGG + Intronic
1118845175 14:69542615-69542637 CCAATTACAAGCTATGACTTTGG + Intergenic
1120199846 14:81524926-81524948 TCATTTCTAAGCTAAGACCTAGG - Intronic
1120254989 14:82107218-82107240 TCATTTACTAGGTGTGGACTTGG - Intergenic
1120917179 14:89720398-89720420 TCCTTTACCAGATGTGACCTTGG - Intergenic
1121270703 14:92636016-92636038 TCACTTACAAGCTGTGGGATGGG + Intronic
1121375314 14:93404273-93404295 TCATTTAAAAAATGTGACCCTGG + Intronic
1121777357 14:96599351-96599373 TCATTTTACAGGTGTGACCTGGG - Intergenic
1122037450 14:98959015-98959037 CAATTTACTAACTGTGACCTGGG - Intergenic
1122245792 14:100402550-100402572 TCATTTTCCAGCTGAGCCCTCGG + Intronic
1126806847 15:52359033-52359055 CCATTTATAAGCTGTGAACCTGG + Intronic
1128691973 15:69731545-69731567 GCATTTAGGAGATGTGACCTTGG - Intergenic
1129352446 15:74964232-74964254 CCACTTACCAGCTGTGCCCTTGG + Intronic
1130338812 15:82981198-82981220 TCATTTATCAGCTGTGCCCCTGG + Intronic
1131597284 15:93811382-93811404 TCTTTTTCAAGCTCTGAACTTGG - Intergenic
1133853959 16:9532251-9532273 CCACTTAATAGCTGTGACCTTGG + Intergenic
1134063862 16:11214368-11214390 TCATATACTAGCTGTGCGCTAGG - Intergenic
1135044539 16:19144405-19144427 CCATTAATTAGCTGTGACCTTGG + Intronic
1139162626 16:64529558-64529580 TCATGGGGAAGCTGTGACCTTGG + Intergenic
1140125414 16:72113876-72113898 TTATTAATAAGCTGTGACCTTGG + Intronic
1143823632 17:9586161-9586183 TCAGTCACAAGCTGCAACCTCGG - Intronic
1146489293 17:33268822-33268844 TCATTTAGTAGATGTGAACTAGG - Intronic
1147500368 17:40957435-40957457 GCATTTCCCAGCTGTGACCTTGG - Intergenic
1147604054 17:41763942-41763964 CCATTTACTACCTGTGACCATGG + Intronic
1148344012 17:46891369-46891391 TCATCTTCCATCTGTGACCTTGG - Intergenic
1148459501 17:47830832-47830854 CCAATTACTAGCTGTGACCTTGG + Intronic
1149393435 17:56215269-56215291 TCGCTTACCAGCTGTGACTTTGG + Intronic
1149537475 17:57443720-57443742 TCACTCACTAGCTGTGTCCTTGG + Intronic
1150310745 17:64127806-64127828 TCACTTGCTAGCTGTGCCCTAGG - Intronic
1150625087 17:66836275-66836297 TCACATACAAGCTGTCACCGAGG + Intronic
1150872852 17:68932654-68932676 TCATTGACCTGCTGGGACCTCGG + Intronic
1153499998 18:5739025-5739047 GCATTTGAAAACTGTGACCTTGG + Intergenic
1155507010 18:26543781-26543803 GCATTTGCAAGCTGTGACAAAGG - Intronic
1156285456 18:35690314-35690336 TCATGTACAAGCCGTGACGCAGG + Intronic
1156992574 18:43426899-43426921 ACATTTAGTAGGTGTGACCTTGG + Intergenic
1159097137 18:63916592-63916614 TCATTAACAAGTTGTGAACAAGG - Intronic
1162883650 19:13679729-13679751 TCATTTTCAAACAGTGACTTTGG + Intergenic
1164570082 19:29367939-29367961 TCATTTTCAAGCTGTAAACGGGG - Intergenic
925657811 2:6168124-6168146 TCCTTTCCAAACTGTGAGCTTGG + Intergenic
926011824 2:9414703-9414725 CCATTTACTAGATGTGACCTTGG - Intronic
926355239 2:12035474-12035496 TCCTTTACATGATGTCACCTTGG + Intergenic
926621642 2:15051469-15051491 CCATTCACCAGCTATGACCTTGG + Intergenic
927415259 2:22872679-22872701 ACTTTAACAAGCTGTGACTTGGG - Intergenic
927939860 2:27096707-27096729 TCTTTTCCATCCTGTGACCTAGG + Exonic
928248521 2:29653439-29653461 TCACTGAGAAACTGTGACCTAGG + Intronic
928453444 2:31398835-31398857 CCATTTACCAACTGTGACCTTGG + Intronic
929077589 2:38091238-38091260 TTATTTATAAGCTGTAACCTTGG + Intronic
930680195 2:54249494-54249516 TCATTTACATGCTCTGGCCATGG + Intronic
931673949 2:64674430-64674452 TCATTTACAATCTGTGGTTTGGG - Intronic
931974848 2:67631906-67631928 TCACTGACAAGCTGTGACAGAGG - Intergenic
932165343 2:69500484-69500506 TCATTCTCCAGCTGTGCCCTTGG + Intronic
932700950 2:73991235-73991257 TCATTTAGAATCTGTGGCCGTGG - Intronic
933752254 2:85610489-85610511 CCATTTACTAGCTGAGATCTTGG + Intronic
937937761 2:127259689-127259711 TCATTTAGATGCTGTGTGCTGGG - Intronic
938590832 2:132734749-132734771 TCATTTACAGCATATGACCTTGG - Intronic
939477512 2:142705557-142705579 ACATGTACAAGCTGTGAGGTAGG - Intergenic
939904164 2:147890056-147890078 TGTTTCACAAACTGTGACCTTGG - Intronic
941034311 2:160551073-160551095 TCATTCACAAGCTGTGGCCTTGG + Intergenic
941035339 2:160561716-160561738 TCATTTGCTAGCTGTGACCTGGG + Intergenic
941039614 2:160606007-160606029 TCACTTGCAAACTGTGACTTTGG - Intergenic
942361606 2:175178813-175178835 ACATTTACTAGCTATGACCTGGG + Intronic
943053849 2:182950773-182950795 TCACTTACAAGCTTTGATTTCGG - Intronic
943517205 2:188903958-188903980 TCATTTAGTAGCAGTGATCTTGG - Intergenic
943671747 2:190669466-190669488 TCATTTACCAGCTGTGACTCTGG - Intronic
944302944 2:198145446-198145468 CGATTAACCAGCTGTGACCTTGG + Intronic
944306994 2:198189766-198189788 TCATTTACTAACTGTGACTTTGG + Intronic
1169872212 20:10259954-10259976 TCATTTATAAGATGGGACGTTGG - Intronic
1171367785 20:24637971-24637993 CCATTAACTAGCTGTGGCCTTGG - Intronic
1173246707 20:41342230-41342252 CCATTTGCTAGCTGTGACCATGG - Intronic
1174001859 20:47380544-47380566 GCATTTTCCAGGTGTGACCTTGG + Intergenic
1174125354 20:48300436-48300458 GCATTTAAAAGCTCTGACATTGG + Intergenic
1175098225 20:56558976-56558998 TCATTCACCAGCTGTGAGCAGGG - Intergenic
1175980605 20:62736696-62736718 TCATTTTCCATCTGTGACCAGGG + Intronic
1176012604 20:62907448-62907470 TCATTTTGAAACTGTGGCCTTGG - Intronic
1178966828 21:37128074-37128096 TGATTTCCATTCTGTGACCTTGG - Intronic
1180593033 22:16956701-16956723 TCTTTTACCAGCAGTGGCCTAGG + Intergenic
1181892966 22:26080634-26080656 GCATATGCCAGCTGTGACCTGGG + Intergenic
1182029849 22:27149843-27149865 TCATTTGCATACTGTGTCCTGGG - Intergenic
1182136400 22:27907796-27907818 TCACTTATTAGCTGTGACCTTGG + Intronic
1182727354 22:32458656-32458678 TCTTTCACAAGCTGTGAATTGGG + Intronic
1184692408 22:46123252-46123274 TCATCTGCTAGGTGTGACCTCGG - Intergenic
1184969390 22:48004369-48004391 TCATGCGCAGGCTGTGACCTGGG + Intergenic
1185168695 22:49278385-49278407 TCATGAGCAAGCTGTGTCCTTGG + Intergenic
950311287 3:11960376-11960398 ACACTTACTAGCTGTGATCTTGG - Intergenic
950718577 3:14866696-14866718 TCAATCAAAAGCTCTGACCTTGG - Intronic
950824266 3:15800132-15800154 TCATTTCCTAGCTGTGTCCTTGG + Intronic
951281570 3:20756469-20756491 TCATCTATGAGCTCTGACCTTGG - Intergenic
952415377 3:33085529-33085551 TCATTTCCAAACTGTGTCTTTGG - Intronic
952750006 3:36817388-36817410 TCACTCAAAAGCTGTGCCCTTGG + Intergenic
952931368 3:38363589-38363611 CCATTTACAGGCAGTGACCTGGG + Intronic
953550935 3:43902163-43902185 ATATTTACTAGCTGTGGCCTTGG - Intergenic
953794031 3:45969377-45969399 TCACCTACCAGCTGTGACCAAGG - Intronic
955066412 3:55537059-55537081 TCAATTAAAGGCTGTGACTTGGG - Intronic
956612090 3:71134630-71134652 TCATTTACAAGGTGTATCTTTGG - Intronic
959893934 3:111585972-111585994 TCTCTTGCGAGCTGTGACCTTGG + Intronic
960919516 3:122732184-122732206 TCTTTGACATGCTGAGACCTGGG - Intergenic
962915194 3:139894853-139894875 CCTCTTACAAACTGTGACCTTGG + Intergenic
966181542 3:177193213-177193235 TCCTTTACTAGCTGTGATGTTGG - Intronic
967069946 3:185953779-185953801 CCACCTACAGGCTGTGACCTTGG - Intergenic
967253263 3:187564594-187564616 TCAAAGACAAGCTGTGAACTGGG + Intergenic
967311587 3:188111186-188111208 CCATTTACCAGCTATGACCTTGG + Intergenic
967490039 3:190079818-190079840 TCATTTACTAACTGTGACCTAGG + Intronic
969183532 4:5459428-5459450 TCATTTAACAGCTGTGACCTTGG - Intronic
969622755 4:8286929-8286951 TCTTTTCCAAGCCGTGACCCTGG - Intronic
969916533 4:10497097-10497119 CCGTTTACTAGCTGTGACTTTGG + Intronic
970799777 4:19958794-19958816 TCACTTACCAACTTTGACCTTGG - Intergenic
970872802 4:20835388-20835410 CCACTTCCTAGCTGTGACCTCGG + Intronic
972586455 4:40441518-40441540 GTAGTTACAATCTGTGACCTAGG + Intronic
976049857 4:80998780-80998802 TGATTTAGAAGGTCTGACCTAGG - Intergenic
976132949 4:81904357-81904379 TCAATTATTAGCTGTTACCTTGG + Intronic
977059041 4:92233635-92233657 GAATTGACAAGATGTGACCTGGG - Intergenic
978638132 4:110835822-110835844 GCATTTTCAAGTTGTGAACTTGG + Intergenic
979405732 4:120308819-120308841 CCATTTACAAACTGCGACCCTGG + Intergenic
982277541 4:153651878-153651900 TCACTTACAAGCTGTGACATAGG - Intergenic
982662075 4:158219179-158219201 TCACTTATTAGCTGTGACTTTGG - Intronic
983236441 4:165185507-165185529 TCATTAGCAAGCTGTGAATTTGG + Intronic
983699165 4:170570146-170570168 TCATTCCCAAGGTGTGACATTGG - Intergenic
987700455 5:21391401-21391423 TAAATTACATGCTGTAACCTGGG - Intergenic
988730139 5:33964208-33964230 GCATTTACTTGCTGTGATCTTGG + Intronic
991575091 5:68094471-68094493 TCATTTACTAACTCTGACCTTGG + Intergenic
992618727 5:78571541-78571563 ACATTTACAAACTGTGGCTTGGG + Intronic
993057707 5:83001387-83001409 GTATTTATCAGCTGTGACCTTGG + Intergenic
993303470 5:86243929-86243951 TTATCTTCAAGCTGTGACTTGGG - Intergenic
993495340 5:88602623-88602645 TTATTTACAAACTCTGAACTGGG - Intergenic
996847219 5:127913134-127913156 TAATTTTTCAGCTGTGACCTGGG + Intergenic
1001242969 5:170084060-170084082 TCATTTACAGGCTGGGTCCCTGG + Intergenic
1001554907 5:172630654-172630676 GCACTTACCAGGTGTGACCTTGG - Intergenic
1003110267 6:3247362-3247384 TCCTTTAGATGCTGTGAACTGGG + Intronic
1004827049 6:19434138-19434160 TCATTAGCAAGCTGTGATTTGGG + Intergenic
1005305926 6:24514175-24514197 TCTGTTACTAGCTGTGGCCTTGG + Intronic
1005687689 6:28271040-28271062 TCACTTACATGTTGTGACCTGGG - Intronic
1006594116 6:35180176-35180198 TGATTTAGATGCTGTGACCTGGG - Intergenic
1006751090 6:36377576-36377598 TCATTGCCAAGGTGTGGCCTTGG - Intronic
1006853717 6:37118037-37118059 GCATTTAAAAGCTTTGAGCTGGG + Intergenic
1011981393 6:93383453-93383475 CCACTTACCAGCTGTGACCTTGG - Intronic
1012530700 6:100232219-100232241 TCATTTACTGACTGTGACCTTGG + Intergenic
1012531407 6:100242012-100242034 TCAATTACAAGCTGTGTCATAGG + Intergenic
1013241967 6:108254522-108254544 CCATTTAATAGCTGTGACCCTGG + Intronic
1014446949 6:121539482-121539504 TCATTGACAAGCTCAGGCCTTGG - Intergenic
1014596169 6:123342651-123342673 CAATTTACTAGCTGTAACCTTGG - Intronic
1015748672 6:136538180-136538202 CCATTTACAAGGTGTATCCTGGG - Intronic
1019767642 7:2863415-2863437 CCATTTGCTGGCTGTGACCTTGG + Intergenic
1021554888 7:21909254-21909276 TCACATCCAAGCTGTCACCTAGG - Intronic
1021786871 7:24160932-24160954 CCATTTAGCAGCTGTGACTTTGG + Intergenic
1022666627 7:32416888-32416910 ACAGTAAAAAGCTGTGACCTTGG + Intergenic
1022797077 7:33740398-33740420 CCATTTACTATGTGTGACCTTGG + Intergenic
1022901322 7:34813387-34813409 GCACTTACTAGCTGTGACCTTGG - Intronic
1026262710 7:68769611-68769633 TCAGAAACAAGCTGTCACCTAGG + Intergenic
1027847966 7:83408660-83408682 TCACTTACTAGGTGTGAACTTGG + Intronic
1030127365 7:106167242-106167264 TCTTTTAGATGCTGGGACCTAGG + Intergenic
1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG + Intronic
1030806371 7:113924862-113924884 TTATTAAGAAACTGTGACCTTGG + Intronic
1031121822 7:117730568-117730590 TCAAATACAAGCTGAGAACTAGG + Intronic
1031436055 7:121733198-121733220 TGAATTATAAGCTATGACCTGGG - Intergenic
1031593759 7:123624558-123624580 TCATTTTCAAGCTGTGAAAAAGG + Exonic
1032761667 7:134948982-134949004 TCACTAACAAGCTGGGGCCTTGG + Intronic
1032960282 7:137025733-137025755 ATATTTACATGCTGTGTCCTTGG + Intergenic
1036473968 8:9076448-9076470 TCATTTACATGTTGGCACCTTGG - Intronic
1037449060 8:18998385-18998407 TCATTTAAAAGATGGGTCCTGGG + Intronic
1038026241 8:23593263-23593285 TCATGTACCTGCTGTGATCTTGG + Intergenic
1038489052 8:27956603-27956625 TCATTTATGAGCTGTGATCTGGG - Intronic
1038763667 8:30407803-30407825 TTATTTATTAGCTGTGACCCAGG - Intronic
1039001671 8:32988106-32988128 TCATTTCCATGCTGTGATTTGGG + Intergenic
1039149396 8:34486653-34486675 TCATCTACAGTGTGTGACCTTGG + Intergenic
1039903414 8:41768557-41768579 CCATTTACTAGTGGTGACCTTGG - Intronic
1040138548 8:43883703-43883725 TAATTTAAAAGCTGTGATCATGG - Intergenic
1041341597 8:56851977-56851999 TCATTTACAGGCTGAAAGCTTGG - Intergenic
1041701320 8:60792126-60792148 TCATTTATAGGCTGGGACCATGG - Intronic
1041722072 8:60984834-60984856 TCACTTCCTAGCTGTGACCTAGG - Intergenic
1042117310 8:65446243-65446265 TCATTTACTAGCTGTGACCCTGG + Intergenic
1042352207 8:67788871-67788893 CCACTTACTAGCTGTGACTTTGG - Intergenic
1042461162 8:69070658-69070680 TCCTTTACAAAATGAGACCTGGG - Intergenic
1043595701 8:81882277-81882299 TCTTTTAAAAGCTGCAACCTGGG + Intergenic
1045833460 8:106492170-106492192 TCATTCCCAAACTGTGACCCAGG - Intronic
1047154792 8:122304620-122304642 GCACTTACTAGCTCTGACCTTGG + Intergenic
1047466140 8:125116244-125116266 CCATTTGTTAGCTGTGACCTTGG - Intronic
1050537252 9:6641558-6641580 TCACTTACCAGCTATGACCTTGG + Intronic
1050609993 9:7342211-7342233 TCTTTTACACTCTGAGACCTGGG + Intergenic
1051111595 9:13644364-13644386 ACATTTACAAGTTGAGACTTTGG + Intergenic
1051787448 9:20760870-20760892 TCATTAACAACCTGTCACCCAGG - Intronic
1055598954 9:77895371-77895393 CCACTTACTAGCTGTGATCTTGG - Intronic
1057460010 9:95252668-95252690 TCACTTACAAGCTGTCTCCCAGG - Intronic
1058147502 9:101428304-101428326 CCATTTAACAACTGTGACCTTGG - Intronic
1058401132 9:104620738-104620760 CCAGTTACTAGCTGTGACCATGG + Intergenic
1058600373 9:106662984-106663006 TGATTTACAAACTCTGACATAGG + Intergenic
1058860243 9:109110383-109110405 TCATTTATTGGCTGTGGCCTTGG - Intronic
1059136761 9:111814534-111814556 TCCTTTACTAGCTGTGGCTTTGG - Intergenic
1059735936 9:117099698-117099720 CTACTTACAAGCTGTGACCCTGG - Intronic
1060263852 9:122098402-122098424 GCCTTTACTAGCTGTGACTTGGG - Intergenic
1060521971 9:124299088-124299110 TCACTCACCAGCTGAGACCTTGG - Intronic
1060595889 9:124848679-124848701 TCACCTACCACCTGTGACCTCGG - Intergenic
1061686145 9:132280884-132280906 TCAATTACAAGCTCTGACTTTGG - Intronic
1187140701 X:16590695-16590717 TCATGGACAAGCTGTCATCTTGG - Intronic
1188283867 X:28304309-28304331 TCAAGTATTAGCTGTGACCTTGG - Intergenic
1189016249 X:37099042-37099064 TTATTTATTAGCTGTGACCCAGG - Intergenic
1189397843 X:40639590-40639612 CCATTTGCCAGCTGTGACCTTGG + Intronic
1192247066 X:69382223-69382245 TCATTTACTAGGTGTTACTTTGG + Intergenic
1193838879 X:86383668-86383690 TCATTTACATGCTGTTTCTTTGG + Intronic
1194532104 X:95062755-95062777 CCATTTAGTAGCTGTGATCTTGG - Intergenic
1195970371 X:110466590-110466612 CACTTTACCAGCTGTGACCTTGG - Intergenic
1199091338 X:143696593-143696615 TCACTTACTAGCTGTGACCTTGG - Intergenic
1201682483 Y:16663047-16663069 TCATTTTCCAGCTGTGACCGGGG - Intergenic