ID: 908568721

View in Genome Browser
Species Human (GRCh38)
Location 1:65386313-65386335
Sequence GTGCCAGTGGGTGGTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908568715_908568721 -7 Left 908568715 1:65386297-65386319 CCATAATAAAGAGCAGGTGCCAG 0: 1
1: 0
2: 2
3: 7
4: 142
Right 908568721 1:65386313-65386335 GTGCCAGTGGGTGGTCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908568721 Original CRISPR GTGCCAGTGGGTGGTCATAG GGG Intronic
No off target data available for this crispr