ID: 908568912

View in Genome Browser
Species Human (GRCh38)
Location 1:65388174-65388196
Sequence AAGCTGAGCCTATTCTAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908568907_908568912 14 Left 908568907 1:65388137-65388159 CCAAGGCAGAGTTCAAGTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908568912 Original CRISPR AAGCTGAGCCTATTCTAACT GGG Intronic
906673997 1:47679992-47680014 AGGCTGGGCCTATGCTAGCTGGG + Intergenic
906916753 1:50020525-50020547 AAACTAAGCATATTCTAACAAGG - Intronic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
909743961 1:79069257-79069279 AAGCTGAGCCAATTCCAAATAGG + Intergenic
910303077 1:85729394-85729416 TGGCTGAGCCTATTTTAAATGGG + Exonic
911211541 1:95144007-95144029 AAGCTGAGACTATTGAAACCTGG - Exonic
914997648 1:152558987-152559009 ATGCTGAGTCTTTTCTAACTGGG + Intronic
915326490 1:155083546-155083568 AGGCTGTGCCAATTCTTACTGGG + Intronic
917138227 1:171808473-171808495 AAGCTGAGCACATTCTTCCTAGG + Intronic
917423815 1:174892523-174892545 AAGCTAAGACTATTGAAACTTGG - Intronic
922901144 1:229137612-229137634 AAGGTGTACCTATTCTAGCTGGG - Intergenic
1062783598 10:240646-240668 AAGCTGAGGCTGGTCTGACTGGG - Intronic
1065683637 10:28262651-28262673 AAGCTGCACCTATTCTAAACAGG + Intronic
1065915708 10:30353512-30353534 AAGCTGTCCCTATTCCAACAAGG + Intronic
1070696271 10:78565773-78565795 AAGCAGAGTCTACTCAAACTTGG - Intergenic
1071030595 10:81175569-81175591 AAGCTGAGCATAAACTGACTTGG + Intergenic
1074044283 10:109822363-109822385 AATCTGAGCCTATGCAAACTAGG + Intergenic
1075246391 10:120825747-120825769 AACCTGAGTCGATTCTACCTCGG + Intergenic
1075993646 10:126859332-126859354 GAACTGAGCCTTTTATAACTTGG + Intergenic
1078653084 11:13213916-13213938 AAGCTGAGTCTATAATAACATGG + Intergenic
1080942637 11:36937057-36937079 AAGCTGAGCCTAGCCCAACCTGG + Intergenic
1081083086 11:38767784-38767806 AAGGTCTGCCTAATCTAACTGGG - Intergenic
1083319494 11:61837056-61837078 CTGCTGTGCCTTTTCTAACTTGG + Intronic
1091133095 11:133163207-133163229 AAGCTGAGCATTCTCTAATTTGG + Intronic
1093678436 12:21971485-21971507 AACCGGAGCCTATGCTAAGTGGG - Intergenic
1095791210 12:46169448-46169470 AAGCTTAATCGATTCTAACTGGG + Intergenic
1096048618 12:48586557-48586579 AAGCTGACCCTATCCTTTCTAGG - Intergenic
1101064487 12:101005223-101005245 GAGCTTAGCTTATTCTAAATTGG + Intronic
1109397419 13:61778432-61778454 AAGCTGGGCCTCTACTACCTTGG - Intergenic
1113923823 13:113929433-113929455 AAGCTGAGCCTGTCCTTGCTGGG - Intergenic
1115372267 14:32630281-32630303 AAGCTGCTTATATTCTAACTGGG - Intronic
1117219685 14:53590570-53590592 AAGATTATCCTATTCTAATTAGG + Intergenic
1117501195 14:56353321-56353343 AAGGTAAGCCTATTGTAATTGGG + Intergenic
1120327506 14:83049811-83049833 CAGCTGAGCCTATCCAAGCTGGG + Intergenic
1202904998 14_GL000194v1_random:65594-65616 AAGCAGTGCCATTTCTAACTAGG + Intergenic
1123474241 15:20578040-20578062 AAGCTGTGACTGTTCTAAATCGG + Intergenic
1123643770 15:22422313-22422335 AAGCTGTGACTGTTCTAAATCGG - Intergenic
1123734542 15:23173052-23173074 AAGCTGTGACTGTTCTAAATCGG + Intergenic
1124285048 15:28394360-28394382 AAGCTGTGACTGTTCTAAATCGG + Intergenic
1124297649 15:28517254-28517276 AAGCTGTGACTGTTCTAAATCGG - Intergenic
1129226581 15:74173978-74174000 AAGCGGAGCCTCTTCTAAGGTGG - Exonic
1132648710 16:1010771-1010793 AAGCTGAGGCTGTTCCCACTCGG + Intergenic
1134321042 16:13163216-13163238 AACCTGGGCCTATTCTAGGTAGG - Intronic
1134858214 16:17538106-17538128 GAGATGAGCGTATTCTAGCTGGG + Intergenic
1140435445 16:74943204-74943226 CAGCTGAGGCTGTTCTAATTAGG - Intronic
1145957351 17:28863755-28863777 AAGCTGAGCCTAATGTAATATGG + Intergenic
1148188289 17:45660485-45660507 AAGCTGATCCAAAGCTAACTTGG - Intergenic
1155080162 18:22401420-22401442 AAGCTCAGTCAATTCTACCTGGG + Intergenic
1158302747 18:56070460-56070482 AGGCTGAGCATATTATAATTAGG - Intergenic
1163749155 19:19065007-19065029 AGGCAGAGCCTATTCTACCCTGG + Intronic
1164014013 19:21235896-21235918 GAGCTGCTCCTATTCTCACTAGG - Intronic
925938518 2:8791364-8791386 TCTCTGAGCCTATTCTGACTTGG + Intronic
929524056 2:42683175-42683197 AAGCTGACCAGATTTTAACTTGG - Intronic
934501645 2:94864872-94864894 AAGCAGTGCCATTTCTAACTAGG - Intergenic
934525013 2:95046385-95046407 AGGCTGAGCTGATTCTTACTGGG + Intronic
936653765 2:114460475-114460497 TAGATGTGCCTATTATAACTGGG + Intronic
938190578 2:129276354-129276376 AAGCTGGGCCTAAGCTAATTTGG - Intergenic
943264045 2:185704052-185704074 ATGCTGAAACTTTTCTAACTTGG + Intergenic
944085661 2:195845058-195845080 AAGCTGTGACAATTCGAACTTGG - Exonic
1169531972 20:6495066-6495088 AATCTGAGCCTATTCTGATTAGG + Intergenic
1170380479 20:15754640-15754662 AAAAAGAGCCTAGTCTAACTTGG + Intronic
1175011903 20:55745965-55745987 AAGTTGAGCCTAAGCTATCTGGG - Intergenic
1176969500 21:15249288-15249310 AAACTGAAACTATTCTAGCTAGG - Intergenic
1178672853 21:34607142-34607164 AAGCTAAACCTTTTATAACTTGG - Intronic
1178927989 21:36791886-36791908 AAGATAACCCCATTCTAACTTGG - Intronic
1182684920 22:32114665-32114687 TAGCTCAGTCTATTCTAACGGGG + Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
956378304 3:68639105-68639127 AAGATGAAACTATGCTAACTAGG - Intergenic
959090651 3:101899283-101899305 CAACTGAACCTATTCTTACTTGG - Intergenic
959412857 3:106046868-106046890 TAGCAGAGCCTACTCTACCTGGG + Intergenic
959867469 3:111287391-111287413 AAACTGAGTTTATTCTCACTGGG - Intergenic
960374434 3:116881096-116881118 AAGCTGAGCATATTTTAGCGTGG + Intronic
963502093 3:146140222-146140244 AAGCTGAGCCAATGCTATATGGG + Intronic
963682868 3:148402447-148402469 AAGCTGAGCATGTTCAATCTGGG - Intergenic
963848521 3:150183765-150183787 AAGCCGAGACTATTCTCATTAGG + Intergenic
966458926 3:180152830-180152852 AAGCTGTGCCTATTGTTATTGGG + Intergenic
966535885 3:181033194-181033216 AAGCTGTGCTTGTTCTTACTAGG + Intergenic
968588745 4:1447098-1447120 ATGCTGGGCCTCTTCTAACCAGG + Intergenic
968862752 4:3185581-3185603 AAGCTTAGACTATTTTAGCTTGG + Intronic
972214257 4:36877329-36877351 AAATCGAGCCTATTCTAAATTGG - Intergenic
972652248 4:41029419-41029441 AACCTCAGAATATTCTAACTAGG + Intronic
972916219 4:43883309-43883331 AAGCTGTGCCTCTACTACCTTGG - Intergenic
975625343 4:76340405-76340427 AAGCTGATCCTCTTCTAGCATGG - Intronic
977715185 4:100174250-100174272 AAGGTCAGCCCATTCTATCTAGG - Intergenic
982444305 4:155472063-155472085 AGGCTGAGGCTATTCTTGCTAGG + Intergenic
982515473 4:156342529-156342551 TAGCTGTGTCTATACTAACTTGG + Intergenic
990715281 5:58629539-58629561 TAGCTAAGCCTATTCTCATTTGG - Intronic
991181931 5:63762449-63762471 AAGCAGAGACCATTCTAAATTGG + Intergenic
992193305 5:74315459-74315481 AGGCTGAGCAGATTCTAACCTGG - Intergenic
993276774 5:85870090-85870112 AAGTTTAGGCTTTTCTAACTGGG - Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
996514016 5:124349925-124349947 CAGCTGAGCCTAGTTCAACTTGG - Intergenic
998025703 5:138814226-138814248 ACACTGAGCCTACACTAACTTGG - Intronic
999964798 5:156797975-156797997 AAGCTGAGTTTCTTCTTACTAGG + Intergenic
1003956016 6:11165569-11165591 AGGCTGATCATATTCTAATTTGG + Intergenic
1008723503 6:54388085-54388107 ACACTGAGCCTATTCTCATTTGG - Intronic
1009545525 6:65014880-65014902 AAGCTTATCCTATTTTATCTGGG + Intronic
1011208433 6:84927656-84927678 AAGCTGTCCCTATTATAAATAGG - Intergenic
1014326120 6:119996288-119996310 AAGATGAGTTTATTCTAACAAGG + Intergenic
1014961904 6:127696455-127696477 AAGCTAAGCTTTTTCTAACATGG + Intergenic
1015808913 6:137141823-137141845 CAGATGAGCCTATTTTACCTGGG - Intergenic
1021332140 7:19351538-19351560 AAGCTGGGTCTATGATAACTAGG + Intergenic
1021528484 7:21616774-21616796 GAACTGAGCCTATTGTAATTTGG + Intronic
1028447500 7:90941959-90941981 AAGCTGACCCTTTTCTTAGTCGG + Intronic
1034632599 7:152542369-152542391 AAACTGAGCCTATACAAAGTAGG - Intergenic
1041194235 8:55384617-55384639 AAGCTAAGTTTATTCTGACTGGG + Intronic
1042108963 8:65358737-65358759 AAGAAGAACCTATACTAACTTGG + Intergenic
1055106832 9:72522076-72522098 AAACTGGGACTATCCTAACTGGG - Intronic
1057132689 9:92665216-92665238 AAGCTAAGACTATTTCAACTAGG + Intronic
1203747538 Un_GL000218v1:50783-50805 AAGCAGTGCCATTTCTAACTAGG + Intergenic
1203562186 Un_KI270744v1:66968-66990 AAGCAGTGCCATTTCTAACTAGG - Intergenic
1185575319 X:1167816-1167838 AAGGTGAGACAATTCAAACTGGG - Intergenic
1186504669 X:10081718-10081740 AAGCTGTGCTAATACTAACTAGG - Intronic
1187645970 X:21347923-21347945 AAGCTAAGCATACTCTAAATAGG - Intergenic
1188812132 X:34663584-34663606 AAACTTAGACTATTCTCACTGGG + Intergenic
1194369540 X:93055455-93055477 TACCAGAGCCTAATCTAACTGGG - Intergenic
1195475318 X:105278495-105278517 AAGCTGAGAATATTCTATCAAGG + Intronic
1197149295 X:123202760-123202782 AAACTGGGCCTATTGTATCTGGG + Intronic
1197801062 X:130349460-130349482 AAAGTGAGCTTGTTCTAACTTGG + Intronic
1200677732 Y:6171667-6171689 TACCAGAGCCTAATCTAACTGGG - Intergenic
1201160868 Y:11165768-11165790 AAGCAGTGCCATTTCTAACTAGG + Intergenic