ID: 908569926

View in Genome Browser
Species Human (GRCh38)
Location 1:65398744-65398766
Sequence CTGTGTGAACTCAGAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908569922_908569926 10 Left 908569922 1:65398711-65398733 CCATGCAGGCTTCAGGGATGGAA 0: 1
1: 0
2: 2
3: 41
4: 297
Right 908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG 0: 1
1: 0
2: 3
3: 28
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908569926 Original CRISPR CTGTGTGAACTCAGAAAAGT GGG Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
902458916 1:16556252-16556274 CTGTGTGACTACAGAAATGTTGG + Intergenic
902493240 1:16851664-16851686 CTGTGTGACTACAGAAATGTTGG - Intronic
903152100 1:21417009-21417031 CTGTGTGACTACAGAAATGTTGG + Intergenic
904595103 1:31639245-31639267 CAGTGTGAACCCAGAAAGGCAGG + Intronic
905474818 1:38218581-38218603 CTGTGTCAACTTAGCAAAGCTGG - Intergenic
907217825 1:52880867-52880889 CTGTGAGATCTCAGAGAAGAGGG + Intronic
907529528 1:55080223-55080245 TTGTCTGAACTCACAAAATTAGG + Intronic
908090332 1:60678753-60678775 CTGTGTGTACTGAGCAAAGGGGG - Intergenic
908437814 1:64123485-64123507 CTGTGTGATCTTGGGAAAGTTGG + Intronic
908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG + Intronic
908705678 1:66951778-66951800 CTGTGAGAAATAAGGAAAGTGGG - Intronic
909153768 1:72043176-72043198 AGGTGTGAACTCAGGAAAGCTGG - Intronic
909210977 1:72822952-72822974 CACAGTGAACTCAGAATAGTGGG + Intergenic
910685069 1:89907638-89907660 CTTTGTAAACTGAGAAAAGAAGG - Intronic
910919883 1:92332935-92332957 CTCTGAGAACTGAAAAAAGTTGG - Intronic
911098886 1:94078315-94078337 TTGAGTGAATTCATAAAAGTAGG + Intronic
911547675 1:99239418-99239440 CTATGAGTACTCAGAACAGTAGG - Intergenic
913196680 1:116462574-116462596 CTGTGTGAAATCTGAAAGGATGG + Intergenic
916480917 1:165213583-165213605 CTGAGTGCACACAGAGAAGTGGG + Intronic
918298808 1:183183629-183183651 AGGTGGGAACTGAGAAAAGTTGG + Intergenic
918991900 1:191707669-191707691 CTGTGTGCAGTCAGAACAGTTGG - Intergenic
920223335 1:204420471-204420493 CTCTTTGAACTCAGAAATCTGGG + Intergenic
920375686 1:205506619-205506641 CTGTGTGACCTTGGAAAAGTTGG - Intronic
922233483 1:223705889-223705911 CCGTGTGAACTATGCAAAGTAGG + Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924777694 1:247121329-247121351 ATGTGTCAATTCATAAAAGTGGG + Intergenic
924931300 1:248734888-248734910 CTAAATGAACTCAGTAAAGTTGG - Intronic
1063115942 10:3071925-3071947 CTCTGTGAACTCAGGGAAGGTGG - Intronic
1063158891 10:3404841-3404863 CTCTGTGTGCTGAGAAAAGTGGG - Intergenic
1064064351 10:12168336-12168358 ATGTGTGAAAACAGCAAAGTTGG + Intronic
1064725702 10:18277375-18277397 TTGTGGCAACTCAGAAAAGCTGG - Intronic
1068939035 10:62662810-62662832 CTGTGTCAACTTAGCTAAGTTGG - Intronic
1069946107 10:71986889-71986911 CTGTGTGAGCTCCGAAAATTGGG - Intronic
1072688410 10:97553096-97553118 CTGTATGGAGTCAAAAAAGTTGG - Intronic
1072963957 10:99955445-99955467 CTGTGAGACCTTAGAAAAGGAGG - Exonic
1074498070 10:113997314-113997336 CTGTGTCCACTCAGCAAAGCTGG + Intergenic
1076821010 10:132939582-132939604 CTGAGTAAACTCAGAGGAGTGGG - Intronic
1077018780 11:408265-408287 CTGGGTGAACCCAGACAGGTGGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078104311 11:8349136-8349158 CTGTGTGACCTTAGACATGTTGG + Intergenic
1078284746 11:9940730-9940752 CATTGTGAACTCAGAAAATTTGG + Intronic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1079264533 11:18917933-18917955 CTGTGTGAAATAAGTAAAGGTGG + Intergenic
1079266699 11:18940162-18940184 CTGTGTGAAATAAGTAAAGGTGG + Intergenic
1080459636 11:32442130-32442152 TGGTGTGAATTCAGAAAAGGTGG + Intergenic
1081273978 11:41123655-41123677 TTGAGTGAACTCAGAGAAGCTGG - Intronic
1081795461 11:45816193-45816215 CTTTGTACACTCAGAAAATTGGG + Intergenic
1083144443 11:60748355-60748377 ATGTGTGAACTCAGTAGAGTTGG + Intergenic
1085570450 11:77553756-77553778 CTGTGTGTAATGAAAAAAGTTGG - Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1086904474 11:92403284-92403306 GTGTGGGAACTTAGAAGAGTGGG - Intronic
1087305451 11:96484444-96484466 GTGTGAGAGCTCAGTAAAGTAGG - Intronic
1089048891 11:115528678-115528700 CTCACTGGACTCAGAAAAGTTGG + Intergenic
1089784196 11:120896285-120896307 CTCTGTGACCTCAGGCAAGTTGG + Intronic
1090889931 11:130914891-130914913 ATGTGTGAAGAAAGAAAAGTAGG - Exonic
1090991112 11:131817726-131817748 ATGTGTCAGCTCAGAAAGGTAGG - Intronic
1091630664 12:2158249-2158271 TTGTGACATCTCAGAAAAGTAGG + Intronic
1092960990 12:13596956-13596978 TTGTGTGGACACAGGAAAGTAGG - Intronic
1095635602 12:44429583-44429605 CTGGGTGAACTCTGAAATTTAGG + Intergenic
1096011867 12:48224581-48224603 CTGTGTGAATTCAGAAGAAGTGG + Intergenic
1099540030 12:83896278-83896300 GTATGTGGACTCAGAAAATTTGG + Intergenic
1099846746 12:88036409-88036431 TTGTTTGAAATCAGCAAAGTTGG - Intronic
1100490962 12:95077462-95077484 CTGTGTGAACAAAGAAAGGTTGG + Exonic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1101166774 12:102044882-102044904 CAGGATGAACTCAGAAAAGAAGG - Intronic
1102096924 12:110248259-110248281 CTGTGAGAATTCAAACAAGTTGG + Intergenic
1102216924 12:111168225-111168247 ATGTGTGAACACAGCAGAGTTGG - Intronic
1102797262 12:115699526-115699548 CTGCATGAACTCAGATAAGATGG + Intergenic
1102890115 12:116552226-116552248 CAGTGTGAAATGAAAAAAGTAGG + Intergenic
1106070046 13:26401853-26401875 CTGTGTGACCTTGGACAAGTAGG + Intronic
1106514363 13:30440274-30440296 TGGTGTGAAGTCACAAAAGTGGG - Intergenic
1108047542 13:46397515-46397537 ATCTGTGAACTCAGTAAAGTAGG + Intronic
1109125145 13:58507376-58507398 CTTTGTGAAATCAGACATGTTGG + Intergenic
1110794130 13:79617893-79617915 GTGTGTGCACTCAGTAAAGTGGG + Intergenic
1112072948 13:95874854-95874876 CTATGTAAAATCAAAAAAGTAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112635228 13:101209881-101209903 CTGTGAGAACTCTGCAAAGTTGG - Intronic
1112755084 13:102623684-102623706 CTGTGTGATTTCAAAAAAGTTGG + Intronic
1114191472 14:20442518-20442540 CTGGGTGTACTGGGAAAAGTGGG - Intergenic
1114354603 14:21893449-21893471 CTGTGTTAACTCAGAAAATTGGG - Intergenic
1114361080 14:21973529-21973551 CTACGTGAACTCAGTAAAGCTGG - Intergenic
1115871563 14:37809971-37809993 GTGTGTGAACACAGAACAGCGGG - Intronic
1116150092 14:41129817-41129839 CTCACTGAACTCAGAGAAGTTGG - Intergenic
1116366614 14:44075105-44075127 CTGTATGACCTTAGAAGAGTTGG - Intergenic
1121240719 14:92428111-92428133 CTGAATGAACTGAGACAAGTGGG + Intronic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1123785536 15:23667819-23667841 CTGGGTTAACTCTAAAAAGTTGG - Intergenic
1124070678 15:26390396-26390418 CTGTTTGATCTTAGACAAGTAGG + Intergenic
1124121028 15:26888781-26888803 CTGTGTGTTCTCACATAAGTTGG - Intronic
1127311992 15:57760648-57760670 CTGTGAGAACTCTGAACAGCAGG + Intronic
1129144817 15:73637047-73637069 CAGTGTGAGCTCAGAAGTGTTGG - Intergenic
1129653719 15:77508975-77508997 CTTTGTTAACTCAGCAAAGATGG + Intergenic
1130573962 15:85074044-85074066 CAGAGTGAACACAGAAAAGCAGG + Intronic
1132022573 15:98375622-98375644 CCTTGTCAAGTCAGAAAAGTGGG - Intergenic
1132440149 15:101854479-101854501 CTGTGTGATCTCAGAAAAGCAGG - Intergenic
1133280192 16:4660767-4660789 CTGTGTGGACTCAGTGGAGTGGG + Intronic
1133698991 16:8291527-8291549 CTGTAAGAACTTAGAAAAGAAGG + Intergenic
1135197865 16:20409422-20409444 CTGTGAGTACTGAGAAAACTTGG + Intergenic
1138941870 16:61801435-61801457 CGGTGTGAATTCAGTAAAATTGG + Intronic
1139834771 16:69829487-69829509 CTGGGTGCATTCAGGAAAGTGGG - Intronic
1141402915 16:83766483-83766505 CTGTGTGAACAATGAAATGTAGG - Intronic
1141417262 16:83885518-83885540 CTGTGGGAGCTCAGCATAGTAGG - Intergenic
1142373050 16:89693582-89693604 CTGTGCACACTCAGAAACGTTGG + Intronic
1144398072 17:14865241-14865263 CTGTGTGAATTCAAAATAATAGG + Intergenic
1148324843 17:46777254-46777276 CTGTGTGACCTCGCACAAGTTGG - Intronic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1148455451 17:47808757-47808779 CTGAGTGGCCTCAGAGAAGTGGG - Intronic
1149900376 17:60471557-60471579 CTGTGTCAACTGAGATAACTGGG + Intronic
1150017342 17:61571657-61571679 CTCTGTGAATTCAGATAAGTGGG + Intergenic
1150921559 17:69489333-69489355 CTATGTGATCACAGAAATGTGGG - Intronic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1152894101 17:82900662-82900684 CTGCGTGTACTCAGGAAAGCCGG - Exonic
1156372364 18:36483007-36483029 CTGTGTGGGCTCAGAATAGTGGG + Intronic
1157900393 18:51509451-51509473 TTGTGTGACTTCAGATAAGTCGG + Intergenic
1158279479 18:55805804-55805826 CTTTCAGAATTCAGAAAAGTAGG - Intergenic
1158614342 18:58972324-58972346 GTGTGTATATTCAGAAAAGTGGG + Intronic
1160754928 19:752099-752121 CTGTGTGACCTCAGATGAGCAGG + Intronic
1165257808 19:34590161-34590183 CTGTGTAATGTGAGAAAAGTGGG - Intergenic
1165356198 19:35305652-35305674 CTGTGAGAACTAAGAGAATTAGG + Intronic
1166560929 19:43731854-43731876 CTGGGTGAGCTAAGAAAAGTTGG - Intronic
927202721 2:20588584-20588606 CTGTGTAACCCCAGAAAAATCGG - Intronic
928906237 2:36371011-36371033 CTTTGAGAGCTCAGAAAATTAGG + Intronic
929342586 2:40839653-40839675 CTATGTGTACATAGAAAAGTTGG + Intergenic
929984746 2:46716985-46717007 CTGTGTGAACTCTAAATCGTTGG + Intronic
930358839 2:50352595-50352617 CAGTTCAAACTCAGAAAAGTAGG - Intronic
934909079 2:98234189-98234211 CTGTGGGAACTGTGAAAAGCAGG + Intronic
935058393 2:99587577-99587599 CAGTGGGAACTCAGACCAGTTGG - Intronic
935741771 2:106155069-106155091 TTGTGTGAACTCATTACAGTGGG + Intronic
936796506 2:116212373-116212395 CTGGGTGATATCAGAAAAGTTGG - Intergenic
939783683 2:146481566-146481588 CTGTGTTAAATTTGAAAAGTAGG + Intergenic
940770124 2:157830473-157830495 TTGTATGAAATCAGAAACGTTGG - Intronic
941140858 2:161779466-161779488 CTGGGTGAAATGAGAAAAGCAGG - Intronic
942214815 2:173708441-173708463 CTGTGTGACCTTAGACAATTTGG - Intergenic
944176465 2:196833749-196833771 CTGTGAGTACACAGAAATGTGGG + Exonic
944410514 2:199437503-199437525 CTGTGAGAACTGAGACATGTGGG + Intronic
947811454 2:233006826-233006848 CTGTGTGACCTCGGATGAGTCGG - Intronic
948320872 2:237068137-237068159 CTCTGTGGAGTCAGAAAAGCTGG - Intergenic
1169860682 20:10148309-10148331 CTGTGAGAACTCACAAAAGAAGG - Intergenic
1170917176 20:20638559-20638581 TTGTGTGACCTCAGATAAGGCGG - Intronic
1174683301 20:52429236-52429258 CTTAGTTAACTGAGAAAAGTTGG - Intergenic
1177594989 21:23227018-23227040 CTGTGTGTAGTCATAAACGTAGG + Intergenic
1178760536 21:35397791-35397813 CTGTGAGTACTCAGAATATTTGG - Intronic
951186427 3:19719168-19719190 GGGTGTGAACTCAGACAAGCTGG - Intergenic
952723998 3:36562717-36562739 CTTTTTGAACTCAGTAAATTTGG + Intergenic
953817529 3:46172029-46172051 TTGTGTGAACTCAGGAATTTGGG - Intronic
955153908 3:56396900-56396922 CTGTGGGAGATGAGAAAAGTGGG - Intronic
956171338 3:66436014-66436036 CTGTGTGATTTCTGAAATGTAGG + Intronic
956262209 3:67356460-67356482 CTGTGTGATCTTAGGAAAGCTGG + Intergenic
959986152 3:112573569-112573591 CTTTGAGAACTTTGAAAAGTAGG + Intronic
960145332 3:114194640-114194662 TTGTGTAAGATCAGAAAAGTCGG - Intronic
961135620 3:124507633-124507655 GGGTGTGAACTCAGAAGACTGGG - Intronic
962164373 3:133033809-133033831 CTGTGTAAACCCAGACAATTTGG - Intergenic
963413085 3:144956797-144956819 CTGTATTATCTCAGAAAAGCTGG - Intergenic
963521084 3:146360650-146360672 CTGTGAGGCCTCAGAAAACTTGG - Intergenic
964036307 3:152202450-152202472 CTGTTAGAACACAGAAATGTAGG - Intergenic
964817159 3:160729420-160729442 CTGTGCAAGCTCAGAAGAGTTGG + Intergenic
965297145 3:166962448-166962470 CTGTGAAAACACAGAGAAGTTGG - Intergenic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
966615734 3:181910672-181910694 CTACGTGAACTCTGCAAAGTAGG + Intergenic
967394658 3:188993727-188993749 CTGTTTGAATTCAGCAAATTGGG + Intronic
967709524 3:192688584-192688606 CTGTCTGATCTCAGAAGAATTGG + Intronic
971705664 4:30039297-30039319 CAATATGAAGTCAGAAAAGTCGG - Intergenic
977614053 4:99067741-99067763 GTGTGTGAACTGAAAAAAATTGG + Intergenic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
980498675 4:133619188-133619210 CTTGGTGACCTCAGAAGAGTTGG - Intergenic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
983837343 4:172406684-172406706 CCTAGTAAACTCAGAAAAGTGGG - Intronic
988049349 5:26004754-26004776 TTGTGTGAACTAATAAAACTTGG + Intergenic
988637721 5:33005045-33005067 CAGTGTGATCTCTGAAAGGTGGG - Intergenic
988824921 5:34926638-34926660 CAGTGTGAAGTCAAAAAAGCAGG - Intergenic
989283624 5:39673544-39673566 CTGTGTTTAGTCAGAAAAGCAGG + Intergenic
990564937 5:57019354-57019376 CTGTGTGTAATGAAAAAAGTTGG + Intergenic
990815852 5:59784085-59784107 CTTTGTGAGCTCAGACAAGTTGG - Intronic
990902009 5:60761714-60761736 CTGTTTGAATTCATAAAAATAGG + Intronic
991285062 5:64964056-64964078 CTGTTTGAGGTCAGAAAAGCTGG - Intronic
991726711 5:69542743-69542765 CTGTGTGTAATCAGAAAAGAAGG - Intronic
991868246 5:71085131-71085153 CTGTGTGTAATCAGAAAAGAAGG + Intergenic
992541144 5:77765431-77765453 CTCTGGGAACACAGAAAAGGGGG + Intronic
992696655 5:79295621-79295643 CTTTGTGAACCCTGAAATGTTGG - Intronic
993293601 5:86106937-86106959 CTGTTTCAACTCAGAAAACCTGG + Intergenic
993622461 5:90185316-90185338 CTGTGTCAACTCACAATACTGGG - Intergenic
995477844 5:112565607-112565629 CAAAGGGAACTCAGAAAAGTAGG + Intergenic
995835674 5:116397218-116397240 CTGTGGGAGCTGAGCAAAGTGGG - Intronic
996960265 5:129238309-129238331 CTTTGTGAACTCAGCAAATTTGG - Intergenic
997975132 5:138437361-138437383 GTGTGTGGCCTCAGCAAAGTTGG + Intergenic
999199402 5:149805192-149805214 CTGTGAGAATCCAGCAAAGTGGG - Intronic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
1001756511 5:174174494-174174516 CTGTGTGTTCTGAGAACAGTAGG - Intronic
1002642525 5:180636981-180637003 CTGTGTGCACCCAGGAAAATGGG - Intronic
1003551576 6:7106766-7106788 CTGTTTCAACTCTGAAAAGCAGG - Intergenic
1005342381 6:24855288-24855310 GTGTGTATACACAGAAAAGTTGG + Intronic
1010698718 6:79013088-79013110 CTGTGTGAACTCAGTAAATTGGG + Intronic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1011851962 6:91640072-91640094 CTTTGTAAAATTAGAAAAGTTGG - Intergenic
1013842021 6:114407798-114407820 CTGAGAGTATTCAGAAAAGTGGG + Intergenic
1013954950 6:115831128-115831150 CTGTGTCAACTGAGATAAGCTGG + Intergenic
1014485966 6:121999538-121999560 CTGTGTGGACTCATAAATTTTGG + Intergenic
1015374181 6:132491375-132491397 CTGAAGGAACTCAGAAAAGAAGG + Intronic
1016780109 6:147948377-147948399 CTGTGTCAGCTCAAAAAAGTGGG - Intergenic
1020124687 7:5526876-5526898 CTGGGTGAACCCAGAAAAACTGG + Intergenic
1020933731 7:14433104-14433126 GTGTGTGACCTCAGACAAGGAGG - Intronic
1021627937 7:22613039-22613061 ATGTGTGAAGACTGAAAAGTGGG + Intronic
1021760957 7:23902957-23902979 CTGTGTGAAGCCAGCAGAGTGGG - Intergenic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1024093710 7:45968086-45968108 CTGTGTCATCTCAGCAAAGGGGG + Intergenic
1025228893 7:57186054-57186076 CTGTTTGAATTCATAAAAATAGG - Intergenic
1025731418 7:64111884-64111906 CTGTTTGAATTCATAAAAATAGG + Intronic
1027194588 7:76020917-76020939 CTTTGTGAAATCAGCAAAGAAGG + Intronic
1027507117 7:79030229-79030251 CTATGTGAACACAGAAATCTTGG - Intronic
1029504349 7:100953313-100953335 CTGAGTGTACTTACAAAAGTTGG - Exonic
1030201015 7:106904059-106904081 AAGTATGAAATCAGAAAAGTGGG - Intronic
1030209270 7:106980368-106980390 CTGTTAGAAAACAGAAAAGTTGG + Intergenic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031224328 7:119015647-119015669 CTGTGTCAACTCATATAAATTGG + Intergenic
1031403782 7:121357938-121357960 GTTTGTCAAGTCAGAAAAGTGGG + Intronic
1033357036 7:140608303-140608325 CTTTGTGAATTCAGAAATGCTGG - Intronic
1033487319 7:141803823-141803845 CTGTTTGAATTCATAAAAGCAGG + Intergenic
1033570583 7:142624675-142624697 CTGTGAGTTCTCAGAAAATTTGG + Intergenic
1034021743 7:147651754-147651776 CTGTGTTGTTTCAGAAAAGTTGG + Intronic
1034076980 7:148241525-148241547 CTGTGGGAGCACAGAAAAGTAGG + Intronic
1034079377 7:148262177-148262199 CTGGGTGCTCTCAGAAAAGCAGG + Intronic
1035055333 7:156031479-156031501 CTCAGTGGACTCAGGAAAGTAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035383253 7:158453607-158453629 CTGGGTGAGCTCAGGAAAGAGGG + Intronic
1036168591 8:6460897-6460919 CTGTGAGCCCTCAGAAAAGCTGG - Intronic
1039596603 8:38795819-38795841 TTGTTTGAACTCATAAAATTAGG - Intronic
1040936360 8:52785957-52785979 CTTTGTGAAATCAGAAAGCTTGG + Intergenic
1042066945 8:64888073-64888095 CAGTGAGAACTCAAAAAATTGGG + Intergenic
1042363726 8:67912083-67912105 CAGTGTGAACCCAGAGGAGTGGG - Intergenic
1043632722 8:82356695-82356717 CTTTGTAAACACAGCAAAGTAGG + Intergenic
1043969397 8:86513605-86513627 TTGTGTGACTTCAGAAAAGTAGG + Intronic
1045002151 8:97887971-97887993 CTGTTTGAACTCTGAAAAGGCGG + Intronic
1047765812 8:127988912-127988934 CTGTGTGACTTCAGAAATGGGGG + Intergenic
1048133596 8:131724007-131724029 CTGTATGAACTAACAAGAGTGGG - Intergenic
1055167400 9:73213515-73213537 CTGAGTGAAATCTGAAACGTTGG + Intergenic
1055492050 9:76815281-76815303 CTGTATGGACTCAGACAAGCAGG - Intronic
1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG + Intergenic
1060399933 9:123342609-123342631 CTCTGTGAGCCCAGACAAGTGGG + Intergenic
1061243165 9:129386167-129386189 CTGTGTGGCCTCAGGAAAGCAGG + Intergenic
1186779644 X:12899856-12899878 CTGTCAGACCTGAGAAAAGTGGG + Intergenic
1188448639 X:30285296-30285318 CAGTCTGAGCTAAGAAAAGTAGG + Intergenic
1188547307 X:31322588-31322610 TTTTGTTAACTCAGAAAAATGGG - Intronic
1191718390 X:64208653-64208675 TTGGGTCAAGTCAGAAAAGTAGG + Intergenic
1192217944 X:69177081-69177103 CTGTGGGAAGTCAGGACAGTGGG - Intergenic
1201013034 Y:9568361-9568383 CTGTGGGCTCTCTGAAAAGTTGG - Intergenic