ID: 908570359

View in Genome Browser
Species Human (GRCh38)
Location 1:65403540-65403562
Sequence GAAACTTGCACTACAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908570359 Original CRISPR GAAACTTGCACTACAGTGGG AGG Intronic
908319769 1:62967819-62967841 GAAGCTTGGAGTCCAGTGGGTGG - Intergenic
908570359 1:65403540-65403562 GAAACTTGCACTACAGTGGGAGG + Intronic
911041444 1:93594122-93594144 GAAACTTACAGTCTAGTGGGAGG - Intronic
911280746 1:95924902-95924924 GAAAGTAACACTAAAGTGGGTGG - Intergenic
911423825 1:97680763-97680785 GATATCTGCACTCCAGTGGGTGG + Intronic
911719708 1:101177607-101177629 GAACCATGCAGCACAGTGGGAGG + Intergenic
913287138 1:117236829-117236851 AGAACTTGAACTACAGTGGTGGG - Intergenic
913689758 1:121268091-121268113 GGAACTTACACTCTAGTGGGAGG + Intronic
914147841 1:145012181-145012203 GGAACTTACACTCTAGTGGGAGG - Intronic
919736806 1:200957758-200957780 GAAACTTACAGTGTAGTGGGAGG + Intergenic
920477079 1:206286565-206286587 GGAACTTACACTCTAGTGGGAGG + Intronic
920977178 1:210797218-210797240 GACATTTGCAGTACAGTGGGAGG - Intronic
922569115 1:226622805-226622827 GTAACCTGCACTCCAGTTGGTGG + Intergenic
1065047301 10:21755734-21755756 GAAGCTTGCACTGCAGAGTGGGG + Intergenic
1066421859 10:35271291-35271313 AAAACTTGAACTGCAGTGGATGG + Intronic
1067730951 10:48811207-48811229 GAAGCTTGCATTGTAGTGGGAGG - Intronic
1071485633 10:86100446-86100468 GAAACTTACACTCCAGTGAGTGG + Intronic
1075483780 10:122803467-122803489 GGAGCTTGCATTCCAGTGGGAGG + Intergenic
1077453687 11:2665447-2665469 GTCACTGGCACGACAGTGGGTGG + Intronic
1077500067 11:2905338-2905360 GCAACTGTCACTCCAGTGGGAGG + Intronic
1080747070 11:35117577-35117599 AAAACTGAAACTACAGTGGGAGG - Intergenic
1083749637 11:64754103-64754125 GAACCTGGCACTGCAGTGGGGGG - Intronic
1084737612 11:71115843-71115865 GGACCTTACACTCCAGTGGGAGG - Intronic
1086262820 11:84961065-84961087 GAACTTTGCACAACAGTGTGGGG + Intronic
1089828788 11:121305880-121305902 AAAACTTCCAAGACAGTGGGAGG + Intronic
1092526919 12:9315109-9315131 GCACCTTGGACTGCAGTGGGCGG + Intergenic
1092540355 12:9416671-9416693 GCACCTTGGACTGCAGTGGGCGG - Intergenic
1094731557 12:33182256-33182278 GAAACTTTCATTCCAGTGAGAGG + Intergenic
1095794468 12:46202796-46202818 GAAACTTGCAGTATTTTGGGGGG - Intronic
1095904908 12:47367913-47367935 GAAACTTGAAAGACACTGGGTGG + Intergenic
1099325193 12:81206209-81206231 CAAAATTGCACTATGGTGGGAGG + Intronic
1100396783 12:94192788-94192810 GAATCTTCCACTAGAGTAGGTGG - Intronic
1101674015 12:106901384-106901406 GAAACTTCAAATACAGTGTGTGG - Intergenic
1102930128 12:116855880-116855902 GAAACTTGCCCAACAGTTCGAGG - Intergenic
1105320955 13:19321533-19321555 GAAACTTTCACTAAAGGCGGAGG - Intergenic
1108243903 13:48496461-48496483 GACACTTACACTTCAGTGTGGGG + Intronic
1108282571 13:48874533-48874555 GAAGCTGGCATTGCAGTGGGTGG - Intergenic
1108610034 13:52076318-52076340 AACACTTGCACTTCAGTGGGTGG + Intronic
1110172518 13:72519065-72519087 GAAATTTATATTACAGTGGGTGG - Intergenic
1110745393 13:79047458-79047480 GGACTTTGCACTTCAGTGGGTGG + Intergenic
1111112620 13:83734178-83734200 GAAAACTGGACTACTGTGGGTGG + Intergenic
1112108793 13:96271620-96271642 GAAACTTACACTACTTTGGAAGG + Intronic
1115170391 14:30498383-30498405 GAAACTTACAGTTGAGTGGGAGG - Intergenic
1121434644 14:93911029-93911051 GACTATTGCACTACAGTGGCCGG - Intergenic
1125550828 15:40543247-40543269 GAAACTTGCAATAAAGTCTGAGG + Intronic
1134456368 16:14398335-14398357 GAAACTGGCAATAGAGGGGGGGG - Intergenic
1134789055 16:16972038-16972060 GAAGGTTGCAATATAGTGGGTGG + Intergenic
1135251559 16:20904592-20904614 GAAATTTGCAAAACAGTGTGTGG + Intronic
1141024819 16:80536341-80536363 TTATCTTGCACTACAGTGTGAGG + Intergenic
1142576987 17:915791-915813 GAAACTTCCCCTAAAATGGGCGG + Intronic
1142576996 17:915834-915856 GAAACTTCCCCTAAAATGGGCGG + Intronic
1146130338 17:30268133-30268155 TAAAGTTGGACTACAGTGGGAGG - Intronic
1146171359 17:30636371-30636393 GAAACCTGCTCTAAAGTGGCAGG - Intergenic
1146222397 17:31035935-31035957 GAAACCTGCTCTAAAGTGGCAGG + Intergenic
1146344819 17:32052395-32052417 GAAACCTGCTCTAAAGTGGCAGG - Intronic
1149500666 17:57149982-57150004 CATGCTAGCACTACAGTGGGAGG - Intergenic
1153361200 18:4198867-4198889 TTAACTTGCATTGCAGTGGGAGG + Intronic
1154968620 18:21384385-21384407 GGATCTTGCACTACAGATGGTGG + Exonic
1156320542 18:36017330-36017352 AAAGCCTGAACTACAGTGGGTGG - Intronic
925916998 2:8614089-8614111 GAGACTTGGCCTACAGTGGGTGG + Intergenic
935940270 2:108230345-108230367 GATACATGCACTCCAGAGGGTGG - Intergenic
942400910 2:175602362-175602384 GAAACTTACACTTCTGGGGGTGG - Intergenic
944429142 2:199614660-199614682 GTAACATGCACTCCAGAGGGTGG - Intergenic
1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG + Exonic
1184361629 22:44022561-44022583 GAAACATGTACTGCACTGGGGGG + Intronic
949118903 3:361731-361753 GAAAATTACGCTACAGTGGTTGG + Exonic
953154252 3:40354512-40354534 GAAGCTTTCATTACAGTGAGAGG - Intergenic
959979221 3:112496313-112496335 GAAACTTGCCCCTCAGTGTGTGG - Intronic
960875699 3:122293025-122293047 GGAACTTGCACTGCAGGGGAGGG + Intergenic
963630246 3:147722737-147722759 GACATTTGCACTCCAGTGGACGG + Intergenic
964496687 3:157298549-157298571 GAAACTAGCACTAGAGTGTGTGG + Intronic
965905454 3:173699852-173699874 GAAAATTGCCCACCAGTGGGAGG + Intronic
967081153 3:186050715-186050737 GGAGCTTACACTCCAGTGGGGGG + Intronic
970077983 4:12246603-12246625 GAAACTAGCAGTTAAGTGGGTGG + Intergenic
971060971 4:22969182-22969204 TGAACATGCATTACAGTGGGTGG - Intergenic
980505382 4:133712365-133712387 GCAAATTGGACTACAGTGGGAGG + Intergenic
982745351 4:159100600-159100622 GAAGCTTACATTACAGTGGAGGG + Intergenic
984935252 4:184883995-184884017 GATACCTGCCCCACAGTGGGGGG + Intergenic
987174323 5:15291916-15291938 GAAACTTGCTCTTCTGGGGGAGG + Intergenic
994159239 5:96537091-96537113 GAAGCTTTCAATACAGTGGCTGG + Intronic
998750598 5:145317588-145317610 GAAACTGGCACAAGACTGGGGGG + Intergenic
999603250 5:153290115-153290137 GAAAATGGCACTATACTGGGAGG + Intergenic
999771590 5:154780138-154780160 GAAAATTCCACAGCAGTGGGAGG - Intronic
1000251278 5:159497937-159497959 GGAACTGGCACTACAGGGGCAGG - Intergenic
1001815709 5:174667731-174667753 GGTGCTTACACTACAGTGGGTGG + Intergenic
1002504784 5:179671779-179671801 GAAACTGGCAAGACACTGGGAGG + Intergenic
1006247438 6:32751120-32751142 AGAACTTACACTCCAGTGGGAGG + Intergenic
1007379133 6:41475591-41475613 GGAGCTGGCACCACAGTGGGGGG + Intergenic
1007788738 6:44297191-44297213 GAAACCGGCAGTGCAGTGGGAGG + Intronic
1010558286 6:77313613-77313635 GACATTTGCATTATAGTGGGAGG + Intergenic
1014887132 6:126795515-126795537 GAAAATAGCATTCCAGTGGGAGG - Intergenic
1016399614 6:143665482-143665504 AAAACTAGCACAACAGTGAGTGG - Intronic
1016995033 6:149955352-149955374 GAAACATCCACTATAGCGGGAGG - Intergenic
1017003576 6:150014083-150014105 GAAACATCCACTATAGTGGGAGG + Intergenic
1017007258 6:150037208-150037230 GAAACATCCACTGCAGAGGGAGG + Intergenic
1028191298 7:87855434-87855456 GAAAGTTGTACTACATTAGGTGG - Intronic
1029643931 7:101839457-101839479 GAAACTCTCACGACTGTGGGTGG - Intronic
1031213478 7:118860356-118860378 GAAATTTGCCATCCAGTGGGGGG + Intergenic
1032258007 7:130312169-130312191 GAAACTTGAAATGGAGTGGGAGG + Intronic
1036557860 8:9875837-9875859 GACACATGCACTCCAGTTGGGGG + Intergenic
1037746858 8:21652418-21652440 GAGACATGTACAACAGTGGGTGG - Intergenic
1044506717 8:93028938-93028960 GAAACTTCTATTAAAGTGGGAGG - Intergenic
1046839780 8:118843322-118843344 GAAACTTGTACTATAGTGTAAGG - Intergenic
1053161341 9:35815285-35815307 GAAACTTCCACTCCATTGGAAGG + Intronic
1056559561 9:87718327-87718349 GACACTTGCACAACCATGGGAGG - Intergenic
1057004353 9:91543738-91543760 GGAACTTGCACTCTAGTGAGGGG - Intergenic
1058729421 9:107835756-107835778 GAAACTTGTACAAGCGTGGGAGG - Intergenic
1059154811 9:111980288-111980310 GGAACTTGCATTTGAGTGGGTGG - Intergenic
1060807079 9:126584575-126584597 GAAACTTCCAGTTCAGTGGGGGG + Intergenic
1061679442 9:132235787-132235809 GCTACTTCCACTACAGAGGGAGG - Intronic
1061745150 9:132734050-132734072 AAAACATGGACTCCAGTGGGTGG - Intronic
1061946538 9:133911595-133911617 GACACTGGCCATACAGTGGGGGG - Intronic
1189295123 X:39912421-39912443 GGAACCTGCACTGCAATGGGCGG + Intergenic
1190113674 X:47611745-47611767 GACACATCCACTACAGAGGGTGG + Intronic
1198369346 X:135974662-135974684 GAAACTGGCACTGCAGAAGGAGG + Intergenic
1199997621 X:153036149-153036171 GACACGTGCACTCCAGAGGGTGG + Intergenic