ID: 908570991

View in Genome Browser
Species Human (GRCh38)
Location 1:65409992-65410014
Sequence GCGGATTAGCTGGGAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908570984_908570991 20 Left 908570984 1:65409949-65409971 CCACATAACTTCATAGATGAAGA No data
Right 908570991 1:65409992-65410014 GCGGATTAGCTGGGAAACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908570991 Original CRISPR GCGGATTAGCTGGGAAACAG AGG Intronic
908331852 1:63078898-63078920 ACAGATTAGCTGGGAGATAGTGG + Intergenic
908570991 1:65409992-65410014 GCGGATTAGCTGGGAAACAGAGG + Intronic
908961997 1:69709279-69709301 GCAGCTTACCAGGGAAACAGAGG + Intronic
915251664 1:154594005-154594027 CCGGAGTAGCTGGCATACAGGGG + Intronic
915685206 1:157625513-157625535 ACGGACCAGCTGGGAAACAGGGG + Intergenic
917054589 1:170966386-170966408 AAGGATGAGTTGGGAAACAGAGG - Intronic
917927536 1:179801543-179801565 GAGGATTACCTGGGAAAATGGGG - Intronic
921021456 1:211239295-211239317 TCGGAATAGCTGAGAACCAGGGG - Intergenic
923000193 1:230000707-230000729 GTGGATTAGCTGGAAGGCAGCGG + Intergenic
1066502511 10:36007840-36007862 GGGCATTAGCTGGGACACCGAGG + Intergenic
1069799128 10:71071383-71071405 GTGCATGAGCTGGGAAAGAGGGG + Intergenic
1071747292 10:88436427-88436449 GTGGATTTGCTGTGGAACAGGGG - Intronic
1072732652 10:97857997-97858019 GCAGATTAGATAAGAAACAGTGG - Intronic
1077315174 11:1916506-1916528 GCGGATCAGGTGGGAAACAAGGG - Intergenic
1077400676 11:2355331-2355353 GGGCATTGGCTGGGAAACAGAGG + Intergenic
1080631001 11:34075591-34075613 GCGGATTATTTGGGACAAAGGGG + Intronic
1082690623 11:56299246-56299268 GAGGGTTATCTGGGAAACAGTGG - Intergenic
1082691356 11:56308369-56308391 CAGGAAAAGCTGGGAAACAGGGG + Intergenic
1083334925 11:61916944-61916966 GCAGTGTAGCTGGGAAAGAGGGG - Intronic
1084342856 11:68519525-68519547 GCAGATTAGCAGGAATACAGTGG - Exonic
1091969855 12:4777714-4777736 GGGGAATAGCTGGGACTCAGGGG - Intronic
1104198055 12:126560443-126560465 TCGGATGATCTGGGAAAAAGCGG - Intergenic
1112313790 13:98343203-98343225 GAGGAATAGCTGGAACACAGAGG + Intronic
1113557923 13:111253560-111253582 GCGCATGGGCTGGCAAACAGTGG + Intronic
1117102736 14:52366941-52366963 GTGGATTAGATGGGATATAGGGG + Intergenic
1117836762 14:59815878-59815900 GCAGATTAACTGGGCAACTGGGG - Intronic
1118679522 14:68225701-68225723 TGGGATTAGCTTGGAAAGAGAGG + Intronic
1123826038 15:24083066-24083088 GAGTATTATATGGGAAACAGCGG - Intergenic
1124468133 15:29958766-29958788 GTGGAGTTGCTGGGAAAGAGGGG - Intronic
1125730971 15:41892746-41892768 GAGGAGTGGCTGGGACACAGAGG - Intronic
1131118439 15:89808582-89808604 GGGGACAAGCTGGGAGACAGAGG - Intronic
1132053279 15:98629538-98629560 GTGGAATAGCTGGGTCACAGGGG - Intergenic
1133029521 16:3003837-3003859 GCGGATTCGCTGCGACACCGAGG - Intergenic
1137404431 16:48178638-48178660 CCGGATTGGCTTGGAGACAGAGG - Exonic
1139147000 16:64337406-64337428 GAGGATGAGCTGGGAATCAATGG + Intergenic
1139396792 16:66646264-66646286 TAGGATTAGGTGGGGAACAGGGG + Intronic
1140054520 16:71514132-71514154 GCAGATCAGCTTGGAAAGAGAGG - Intronic
1145981750 17:29016800-29016822 GAGCATCAGCTGGGAAAGAGGGG - Intronic
1146248367 17:31312154-31312176 GGGAATTAGCTGGAAAACACAGG + Intronic
1149604018 17:57912265-57912287 GTGGCTTAGCTGGGGAACAATGG - Intronic
1152317187 17:79587959-79587981 CCTGAATAGCTGGGACACAGAGG + Intergenic
1152737384 17:82004195-82004217 GCCGCTGAGCTGGGAAACCGAGG - Intronic
1152871324 17:82754744-82754766 GCAGTTTTGCTGGGAAGCAGTGG + Intronic
1153438790 18:5094282-5094304 CCAGATCAGCTGGGAAACAAGGG - Intergenic
1158193184 18:54854456-54854478 GCAGAGTAGCTGGTAAAAAGAGG - Intronic
1158385174 18:56981242-56981264 GCTGAATAGATGGGAAACATTGG + Intronic
1160030666 18:75256363-75256385 GCAGATCAGCTGGGTCACAGAGG + Intronic
1161446700 19:4322808-4322830 GGGGAATAGCTGGGAACCTGAGG + Intronic
1166230581 19:41424015-41424037 GAGGATTAGGTGGCAAACCGTGG + Intronic
1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG + Intergenic
1167639071 19:50670429-50670451 GGGGATGAGCTGGGAAGCCGGGG - Intronic
1202648741 1_KI270706v1_random:162269-162291 GCAGAGTAGCTGGGACACACAGG + Intergenic
928000269 2:27517678-27517700 GCACATTAGCAGGGAAACTGGGG - Intronic
930364302 2:50419898-50419920 AAGCATTAGCTGGGATACAGTGG - Intronic
933216241 2:79633684-79633706 TTTGACTAGCTGGGAAACAGAGG - Intronic
934490429 2:94758808-94758830 GACGATAAGCTGGGAATCAGAGG + Intergenic
934745305 2:96755839-96755861 GGGGATTACCTGGGAGGCAGAGG - Intergenic
941848794 2:170158671-170158693 GGGTATAAGCTGGCAAACAGTGG - Intergenic
941934221 2:170970740-170970762 GAGGGATAGCTGGGAAACTGAGG + Intergenic
946153143 2:217789648-217789670 GCAGATGAGATGGGAAACGGAGG + Intergenic
947822149 2:233079547-233079569 GTGGCTTAGCTGGTAAACTGGGG + Intronic
1169252953 20:4074190-4074212 GAGGATGAGATGGGAAAGAGAGG + Intronic
1172331568 20:34079348-34079370 GCAGAGTAGATGGTAAACAGTGG - Intronic
1175187021 20:57185521-57185543 GAGCATAAGCTGGGAAATAGAGG + Intronic
1176611835 21:8990935-8990957 GGAGAGTAGCTGGGAGACAGAGG - Intergenic
1177742145 21:25167711-25167733 GTGGAGTGGCTGGGACACAGCGG - Intergenic
1179100163 21:38349383-38349405 GCGAATTACCTGGGGAACACGGG + Intergenic
1181937491 22:26449246-26449268 GGGGATAAGCTGGGCAACAGTGG - Intronic
1183699802 22:39444822-39444844 GCAGAGGCGCTGGGAAACAGGGG - Intergenic
1185132400 22:49046627-49046649 GGAGATTAGGTGGGGAACAGGGG + Intergenic
950947116 3:16960505-16960527 GCTGAGTAGGTGGGAGACAGAGG - Intronic
951206825 3:19934223-19934245 TCAGGTTACCTGGGAAACAGGGG + Intronic
957845994 3:85736454-85736476 GAGCATTAACTGGGCAACAGAGG + Intronic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
963110933 3:141687255-141687277 GAGGAGTAGATGGGAAAGAGAGG + Intergenic
969931391 4:10634358-10634380 GCTGGGAAGCTGGGAAACAGTGG - Intronic
971261332 4:25059502-25059524 GCAGATTAGCTGGGAAAGGAGGG + Intergenic
973378634 4:49304708-49304730 GGAGAGTAGCTGGGAAACACAGG + Intergenic
973379584 4:49310946-49310968 GGAGAGTAGCTGGGAAACACAGG - Intergenic
976573014 4:86635238-86635260 GCATATTACCTGGGAAACAAAGG - Exonic
982715559 4:158803674-158803696 GCTTATTAGTTGGGTAACAGAGG + Intronic
986688944 5:10297972-10297994 GAGGATAAGCAGGAAAACAGGGG + Intronic
987682824 5:21160031-21160053 GCAGATAAGCTGAGAACCAGTGG - Intergenic
991010821 5:61881487-61881509 GGGGATAAGCTAGGAATCAGAGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992908468 5:81371558-81371580 GAATTTTAGCTGGGAAACAGTGG + Intronic
993018875 5:82566532-82566554 GCGGATAAGCTGGATAAAAGAGG + Intergenic
996973458 5:129401222-129401244 ATGGATTAGCTGGGGCACAGTGG + Intergenic
1015401969 6:132797471-132797493 CCCGAGTAGCTGGGATACAGGGG - Intronic
1015832906 6:137388917-137388939 CCTGATTAGCTGGGAACCACAGG - Intergenic
1017339870 6:153308579-153308601 GAACATTAGCGGGGAAACAGAGG + Intergenic
1017485136 6:154895661-154895683 GTGGCTTGGCTGGGAGACAGAGG - Intronic
1026361334 7:69603223-69603245 GAGCAATAGCTGGCAAACAGTGG + Intronic
1026444070 7:70468883-70468905 GTGGATTCGGTGGGAAACTGTGG + Intronic
1026855250 7:73749247-73749269 GCAGATTAGAGGGGAAGCAGAGG + Intergenic
1027153481 7:75749886-75749908 CCCGAGTAGCTGGGATACAGGGG - Intergenic
1027986351 7:85295898-85295920 GAGGATAAGATTGGAAACAGGGG + Intergenic
1032255517 7:130294180-130294202 GCCACTTAGCTGGGAAGCAGGGG + Intronic
1033044561 7:137949858-137949880 GCCGAGTTGCTGGGAAACAAAGG + Intronic
1034279141 7:149839289-149839311 GCACATTAGCTTGGAGACAGTGG + Intronic
1036674594 8:10819408-10819430 CCAGATTAGCTGAGTAACAGTGG + Intronic
1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG + Intergenic
1042829338 8:73009314-73009336 GCCGATTAGCTGGGAGTCCGAGG + Intronic
1191184803 X:57598474-57598496 GTGGATTAGATGGGAAAGACCGG + Intergenic
1197635349 X:128908633-128908655 GCAGATTAGTTGGGCAGCAGTGG - Intergenic