ID: 908572177

View in Genome Browser
Species Human (GRCh38)
Location 1:65421005-65421027
Sequence GGAGGGCGCCGCTCTCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908572177_908572182 2 Left 908572177 1:65421005-65421027 CCTCGGCGAGAGCGGCGCCCTCC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 908572182 1:65421030-65421052 CTCTCCTGAGTTTTTAAACAAGG 0: 1
1: 1
2: 2
3: 19
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908572177 Original CRISPR GGAGGGCGCCGCTCTCGCCG AGG (reversed) Intronic
901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG + Intronic
902033488 1:13439562-13439584 GCAGGGGGCCGCGCTCGTCGGGG - Intergenic
902391461 1:16109541-16109563 GGAGGGCCCCACTCTCCCCAAGG - Intergenic
903115699 1:21176773-21176795 GAAGGGCGCCGCTTCCTCCGGGG - Exonic
903700819 1:25247123-25247145 GGCGGTCGCCGCCCGCGCCGTGG - Intronic
905505603 1:38476629-38476651 AGGGGGCGCCGCTTTCGCTGCGG - Intergenic
905717090 1:40161417-40161439 AGACGCCGCCGCTGTCGCCGGGG + Exonic
905734357 1:40315636-40315658 GGGGGGCCCCGCTCTCCCGGTGG + Exonic
906551346 1:46668488-46668510 GGGGCGCGCCGCTCTGGCCCCGG + Intronic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
910657458 1:89633162-89633184 GGAAGGCGCCGCCGTGGCCGCGG + Exonic
917329732 1:173868622-173868644 GGAGGGGGCCGCCCTTCCCGGGG - Intronic
919386917 1:196934025-196934047 GCAGGGGGCCGCTCTCGCCAGGG - Intronic
1066464874 10:35642244-35642266 TAAGGGCGCTGCTCCCGCCGAGG - Exonic
1073486201 10:103820555-103820577 GGAGGGGGCCGCCCTCCCCAGGG - Intronic
1075871359 10:125774266-125774288 CAAGGGCGCCGCCCTGGCCGAGG - Exonic
1076180686 10:128405102-128405124 GGAGGGCGCCGTTCACACTGTGG - Intergenic
1077027960 11:450110-450132 GGATGGCGCGGGTCTCGCCAAGG - Intronic
1077142577 11:1030985-1031007 GGAAGGTGCAGATCTCGCCGGGG + Exonic
1077204810 11:1337085-1337107 GGAGGGCGCGTCTCCCACCGCGG - Intergenic
1077332921 11:1991219-1991241 GGAAGGGGCTGCTCTCGCAGAGG - Intergenic
1077891230 11:6419299-6419321 GGACGGCGCCGCGCTAGGCGGGG - Intronic
1083158793 11:60842061-60842083 GGAAGGCGCCGGTTTCGGCGGGG + Exonic
1083681551 11:64354047-64354069 GGGGGGCCCCCCTCCCGCCGGGG - Exonic
1090261293 11:125322539-125322561 GGATGGCGCTGCTCTCGTGGGGG + Intronic
1090782765 11:130021944-130021966 GCAGGGGGCGGCTCTCGTCGGGG - Intergenic
1202815904 11_KI270721v1_random:46395-46417 GGAAGGGGCTGCTCTCGCAGAGG - Intergenic
1092209658 12:6638110-6638132 GGAGGGCGCAGCTCCCACCGTGG + Exonic
1096693793 12:53336236-53336258 GGAGGGATCCGCTCTCTCCCAGG + Exonic
1103509792 12:121466808-121466830 GGAGGGCGCGGCGCGCCCCGCGG + Intronic
1104977535 12:132558946-132558968 GGAGGGCGCAGCTCTGGACCCGG - Intronic
1105851298 13:24338972-24338994 GGCGGGCCCCGCACTCACCGCGG + Intergenic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1108227314 13:48303379-48303401 GGAGAGTGGCGCTCCCGCCGAGG + Intergenic
1108362345 13:49678683-49678705 AAAGGGAGCCGCTCTGGCCGCGG + Intronic
1109854319 13:68108002-68108024 GGAGGGCCCCGCACTCGGAGAGG - Intergenic
1110119607 13:71865789-71865811 GGAGAGGGCCGCGCTCGCCGGGG + Intronic
1110630107 13:77697882-77697904 CGAGGGCGCCGCGGCCGCCGGGG - Intronic
1113625813 13:111845658-111845680 GGAGGTGCCCGCTCTCGCCGCGG + Intergenic
1123024914 14:105419983-105420005 GGCGGGCGCGGCGCTCGGCGCGG - Exonic
1126392862 15:48178131-48178153 GCGGGGTGCGGCTCTCGCCGCGG + Exonic
1126570062 15:50141174-50141196 GGAGGTCGCCGCTCTTTCTGTGG - Intronic
1128344140 15:66842850-66842872 GGAGGGCGCGGCTCCGGGCGCGG + Intergenic
1129703542 15:77781855-77781877 GGAGGCAGCAGCTCTGGCCGGGG - Intronic
1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG + Exonic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1132111434 15:99104997-99105019 GGAGGCCGCGGCCCTCGCCCAGG + Intronic
1132642046 16:982418-982440 GGAGGGCGCAGAGCTCGCGGAGG + Intronic
1132843581 16:1990105-1990127 GGAGGGCGCCTCCTTCGGCGCGG + Exonic
1133009896 16:2905151-2905173 GGAGGGCGCCGCTCCTCCCTGGG - Intergenic
1137280561 16:46973320-46973342 GGAGTGCGCGGCTCGCGGCGAGG + Intronic
1137945733 16:52731723-52731745 GCAGGGGGCGGCTCTCGTCGGGG - Intergenic
1142226759 16:88881336-88881358 GAAGGGCCCCGCTCCCGCCGCGG - Exonic
1143038876 17:4017601-4017623 GGAGGGCGGCGCTCTTGCTACGG + Exonic
1143670464 17:8392764-8392786 GGAGGCCGCCGGGCTAGCCGTGG - Exonic
1144062736 17:11598513-11598535 GGAGCGGGCCGCGCTCGCGGCGG + Exonic
1153805482 18:8705905-8705927 GCAAAGCGCCGCCCTCGCCGGGG + Intronic
1155199354 18:23503596-23503618 GGCGGGCGCCGCGCCCGCGGCGG - Exonic
1157338271 18:46756844-46756866 GGAGGCGGCCCCTCCCGCCGAGG + Exonic
1160967914 19:1754574-1754596 GGCCGCCGCCGCTCCCGCCGGGG - Exonic
1161266725 19:3367575-3367597 GGAGGGGGCGGCTCCCCCCGGGG + Intronic
1161326516 19:3666971-3666993 GGAGAGAGCAGCTCTCGCCGGGG - Intronic
1165160217 19:33811587-33811609 GGAGGGCTCCGCGGACGCCGGGG - Intronic
1166876560 19:45901458-45901480 GCAGGGCGCCGGGCCCGCCGCGG - Exonic
925880164 2:8345654-8345676 GGAGGGCACCTCTTTAGCCGAGG - Intergenic
926152279 2:10431993-10432015 GGAGGGCGCCCCTCAGGCAGTGG - Intergenic
930872806 2:56184876-56184898 TGAGGCCGCGGATCTCGCCGAGG - Exonic
932352526 2:71043768-71043790 GGCGGGCGCCGCCCGCGCTGCGG + Intergenic
933876135 2:86623403-86623425 GGAGGGCGCGGCGCTCGGCCGGG + Exonic
945401429 2:209387650-209387672 GCAGGGGGCCACTCTCGTCGGGG - Intergenic
947860564 2:233354699-233354721 GGCGCGCGCCCCTCACGCCGCGG + Intronic
948216715 2:236237816-236237838 GCAGGGCGCCGCGGCCGCCGGGG + Exonic
948661109 2:239507016-239507038 GGAGGAGGCCGCTCTGACCGTGG - Intergenic
1170760992 20:19251564-19251586 CGAGGGCCCAGCTCTAGCCGGGG + Intronic
1175429059 20:58889999-58890021 CGAGAGAGCCGCTCGCGCCGCGG + Intronic
1176429678 21:6568011-6568033 GCAGGGCGCAGCTCTGGCCATGG + Intergenic
1179705072 21:43175473-43175495 GCAGGGCGCAGCTCTGGCCATGG + Intergenic
1179810193 21:43865211-43865233 GGCGGGCGCCGCACTCGCTGAGG + Intronic
1181057789 22:20268138-20268160 GGCGGGCGCCCGTCTCCCCGCGG + Exonic
1183476510 22:38038826-38038848 GGAGGGCGCCGCGGCCGCCACGG - Intronic
1183990398 22:41593834-41593856 GCAGGGGGCGGCGCTCGCCGGGG - Intergenic
1185409515 22:50674602-50674624 GGCCGGGGCCGCTCGCGCCGGGG - Intergenic
1185418050 22:50720725-50720747 GGAGCGCGCGGCCCTGGCCGTGG + Intergenic
951574650 3:24101347-24101369 GGAGGGCTCACCTCTCGCCCAGG + Intergenic
954763910 3:52897354-52897376 TGAGCGCGCCGCTCTCGCAGCGG + Exonic
964607042 3:158571187-158571209 GGACGACGCCTCACTCGCCGCGG - Intronic
966794149 3:183698028-183698050 GGAGCGCGCCCCGCTCTCCGGGG + Intronic
976704662 4:88007933-88007955 GGAGGCCGCGGCTCCGGCCGGGG - Exonic
984901788 4:184592182-184592204 GCAGGGGGCGGCTCTCGTCGGGG - Intergenic
984928465 4:184826343-184826365 GGAGGGCGCCGCCCGCCCCTCGG - Intronic
990210733 5:53480010-53480032 GGAGCGCGCCGGCCTCGCGGCGG - Intergenic
992249889 5:74866290-74866312 GGAGGCAGCCGCACTCGCCCTGG - Intronic
998152655 5:139765915-139765937 AGAGGACGCCGCTCTGGCCCGGG + Intergenic
998176230 5:139903880-139903902 CGAGGGCTCCGATCTCTCCGAGG + Intronic
1002027060 5:176402822-176402844 GGAGGGCACCATTCTCGCCTGGG + Intronic
1002556499 5:180045998-180046020 GCAGGGGGCAGCGCTCGCCGGGG + Intronic
1002594635 5:180313902-180313924 GGACCGCGGCGCTCTCACCGTGG - Exonic
1003176905 6:3758434-3758456 GCAGGGCGCGGCGCTCGTCGGGG - Intergenic
1006321806 6:33323517-33323539 GGAGCGCGCCGCCCTTGCAGGGG - Intronic
1017672073 6:156778051-156778073 GGATGCCGCCGCTGCCGCCGCGG - Exonic
1017793662 6:157823147-157823169 GGCGGGCGTCGCGCGCGCCGCGG + Intronic
1020073156 7:5240618-5240640 GGAGGGCGCCTCTCCCTCCGGGG + Intergenic
1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG + Intronic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1032787312 7:135211280-135211302 TGACAGCGCCGCTCTCGCCCCGG + Intronic
1034228133 7:149498109-149498131 CGAGGGGGCCGCCCTGGCCGCGG - Intergenic
1034276962 7:149828097-149828119 GCAGGGCTCCGCTCTCCCCCTGG + Intergenic
1034351857 7:150421214-150421236 AGAGGGCGCCGCTCTCCTCCCGG - Intergenic
1035553198 8:545163-545185 GAAGGGCGAGGGTCTCGCCGGGG - Intronic
1045815158 8:106270293-106270315 CGAGTGCGCCCCTCTCGGCGGGG - Intronic
1047376396 8:124301335-124301357 GGTGGGCGCCGGTCTGGGCGTGG + Intergenic
1049441687 8:142612555-142612577 GGAGGGGGCCGCGCTGCCCGAGG + Exonic
1054765029 9:69036014-69036036 GGGAGGCGCCGCGCACGCCGGGG + Intronic
1056135037 9:83623082-83623104 GGGCGGAGCCGCTCTCGCCCCGG - Intronic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1062062333 9:134503128-134503150 GGAGGGGGCTGCACTCGCAGTGG + Intergenic
1186282099 X:8003556-8003578 GGCGGGCCCCGCTCTCGGAGCGG - Intergenic
1187154772 X:16712488-16712510 GGAGGGCGCCGCGCACCCCGAGG - Intronic
1189821629 X:44874028-44874050 GGCCGGCGCCGCGCTCGCCCCGG + Intronic
1197754592 X:129984566-129984588 GGAGGGGGCCCTCCTCGCCGGGG + Intronic
1200146340 X:153928179-153928201 GGAGGGCGCCGCGGGCGCCGTGG + Intronic
1200173646 X:154097301-154097323 CGCGGGCGCCCCTGTCGCCGGGG - Intronic