ID: 908572907

View in Genome Browser
Species Human (GRCh38)
Location 1:65427623-65427645
Sequence GTGGAAAAACGTTTGGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908572907_908572912 4 Left 908572907 1:65427623-65427645 CCCTTGACCAAACGTTTTTCCAC No data
Right 908572912 1:65427650-65427672 CCACAACCAACTGTAAATCTAGG 0: 1
1: 0
2: 1
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908572907 Original CRISPR GTGGAAAAACGTTTGGTCAA GGG (reversed) Intronic
No off target data available for this crispr