ID: 908573403

View in Genome Browser
Species Human (GRCh38)
Location 1:65433553-65433575
Sequence GTAATTAGCAGGTATGATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908573401_908573403 -3 Left 908573401 1:65433533-65433555 CCTTGAGGCTTGTGATCTGAGTA 0: 1
1: 0
2: 1
3: 7
4: 118
Right 908573403 1:65433553-65433575 GTAATTAGCAGGTATGATGCTGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908573403 Original CRISPR GTAATTAGCAGGTATGATGC TGG Exonic
905141808 1:35852147-35852169 GGAACAAGCAGGTATGAGGCTGG + Intronic
907759063 1:57340010-57340032 GTAATGAGCATTTCTGATGCTGG + Intronic
908573403 1:65433553-65433575 GTAATTAGCAGGTATGATGCTGG + Exonic
912868366 1:113280048-113280070 TTAATTAGCAGGTAGTATACAGG - Intergenic
912974110 1:114312414-114312436 GTAATCAGAAGGTAACATGCTGG - Intergenic
920607893 1:207407893-207407915 GTCATTGGCAGATATGATCCTGG + Intergenic
924190950 1:241552293-241552315 AGAAGTAGCAGGAATGATGCGGG - Intronic
1068199844 10:53768864-53768886 GTAAATAGCAGGCCTCATGCTGG - Intergenic
1069221658 10:65891087-65891109 GTAATGAGCAGGTGTGAAGTGGG - Intergenic
1070454561 10:76599672-76599694 TTAATTAGCAGTGATGATGATGG - Intergenic
1070614690 10:77960530-77960552 AAAATTAGCAGGTGTGATGGCGG - Intergenic
1071063411 10:81601122-81601144 GTGATTAGCAGGTGGGATGATGG + Intergenic
1071955682 10:90756947-90756969 GTAATTAACAAGTATAATTCAGG - Intronic
1072527441 10:96285847-96285869 GTATATAGCAGGTTTGATGCAGG - Intergenic
1074199290 10:111220077-111220099 TTAATGAGGAGGTATTATGCAGG + Intergenic
1075333605 10:121593352-121593374 GTAAGCAGTAGGAATGATGCTGG + Intronic
1090046900 11:123343701-123343723 GTAATTATGAGGCATTATGCAGG - Intergenic
1093078715 12:14784880-14784902 TTAATTAGCAGTTCTGATTCTGG - Exonic
1099534366 12:83826851-83826873 GTTATTAGCCAGGATGATGCAGG + Intergenic
1102549394 12:113680407-113680429 GCAATGGGCAGGTTTGATGCAGG - Intergenic
1102789267 12:115630857-115630879 TGAATTATCAGGTAAGATGCAGG + Intergenic
1103328267 12:120136169-120136191 GTATGTAGCAGGCATCATGCTGG + Intronic
1110413854 13:75231344-75231366 GTAAATACCATGTCTGATGCTGG - Intergenic
1112820495 13:103329004-103329026 GGAATTAGCAGATATGATTGTGG + Intergenic
1116382426 14:44287388-44287410 TAAATTATCAGGTATGATCCTGG + Intergenic
1116633333 14:47360917-47360939 GTAGTTACCAGGGATGATGGGGG + Intronic
1121999452 14:98634839-98634861 GTAAGTGGCAGGTTTGGTGCTGG - Intergenic
1123002673 14:105304336-105304358 AAAATTAGCAGGTGTGATGGTGG + Exonic
1127541252 15:59941148-59941170 GTGAATAGCCTGTATGATGCTGG - Intergenic
1132627861 16:900657-900679 AAAATTAGCAGGTATGCTGGCGG - Intronic
1134343535 16:13367634-13367656 TTAAATAGCAAGTAGGATGCGGG + Intergenic
1137396448 16:48118764-48118786 GTACATAGCAGTTATGATGAGGG + Intronic
1146927863 17:36757436-36757458 CTAATTAGCAGGGATGAGGCTGG - Intergenic
1157029566 18:43889414-43889436 GTAATTAGCAGTTTCAATGCTGG + Intergenic
1158589128 18:58764928-58764950 GAAATTACCAGGAATGATGAGGG - Intergenic
1159024219 18:63167949-63167971 GGAATTAGCAGGACTGAGGCAGG + Intronic
1167589280 19:50394503-50394525 AAAATTAGCGGGTATGATGGTGG + Intronic
1168387974 19:55981867-55981889 GTAATGATCAGGTATCATCCAGG + Intronic
1168580388 19:57551098-57551120 GAACACAGCAGGTATGATGCAGG + Intronic
925923487 2:8653957-8653979 GAAATAAGCAGGTATGTTGCAGG - Intergenic
926543319 2:14207932-14207954 GTAATTTGCAGCTATGAAGCAGG - Intergenic
927979664 2:27366784-27366806 GGAATCAGCAGGTAGGAGGCTGG + Exonic
929866597 2:45722665-45722687 GTACTAAGCAGGTGTGATTCAGG + Intronic
929877288 2:45807377-45807399 GAAATTAGCAGCCATGATTCTGG - Intronic
933171881 2:79133987-79134009 GTAGTTAGCAGCTAAGATGAAGG - Intergenic
933478933 2:82829593-82829615 CTACCTAGCAGGTATGAAGCGGG - Intergenic
936277779 2:111115626-111115648 ATAACTAACAGGAATGATGCCGG + Intronic
939532926 2:143387634-143387656 TTAATTACCAGGTATGAACCAGG + Intronic
943629480 2:190234698-190234720 AAAATTAGCAGGTATGGTGGCGG + Intronic
944353008 2:198752125-198752147 AGAATTAGCAGATATGACGCTGG + Intergenic
944367435 2:198939752-198939774 GTAATTAGAAGTGATGTTGCTGG - Intergenic
946256542 2:218446382-218446404 AAAATTAGCAGGCATGATGGTGG - Intronic
947667689 2:231917621-231917643 GTGACTAGCAGGTCTGATCCTGG - Intergenic
1169358425 20:4927219-4927241 GTGACTAGCAGCCATGATGCTGG + Intronic
1171967870 20:31543993-31544015 GTCTTTAGCAGGGATGAGGCAGG - Intronic
1175615631 20:60395896-60395918 TTAATTAGCAGGTCTGATTTTGG + Intergenic
1177027393 21:15936350-15936372 GTACTTCTCAGGTATCATGCTGG - Intergenic
1183132157 22:35848642-35848664 ATAATTAGCACCTATGTTGCAGG - Intronic
952302627 3:32117349-32117371 GTAATAAGCAAGTATGAGGAAGG + Intronic
955056566 3:55460627-55460649 GTATTCAGCAGGCATGAGGCAGG - Intergenic
960427742 3:117529750-117529772 GTAGATAGCAGGTTGGATGCTGG + Intergenic
964764051 3:160161265-160161287 GTAATTAATAAGTATCATGCAGG - Intergenic
967573977 3:191068320-191068342 GGAATTAGCTGGTAGGATACAGG + Intergenic
967998999 3:195188687-195188709 GGAGCTAGCAGTTATGATGCAGG - Intronic
968036078 3:195549111-195549133 GGCATTAGCAGCTATAATGCTGG + Intergenic
969202125 4:5614825-5614847 AAAATTAGCAGGTGTGATGGTGG + Intronic
970002305 4:11376021-11376043 GGACTTTGCAGGTATGATGAAGG + Intergenic
970097051 4:12476123-12476145 CTAAGTAGAAGGTATGGTGCAGG + Intergenic
971001023 4:22322668-22322690 GGAAATAGCAGGAATGAGGCAGG - Intergenic
991376040 5:65968232-65968254 GTAAGTAGAAGGTATCATGATGG + Intronic
992119634 5:73578057-73578079 GTAATGTGCAGGGATGAAGCTGG - Intronic
993343666 5:86755853-86755875 GTGAGTAGCAGGCATAATGCAGG - Intergenic
994133215 5:96255154-96255176 GTAAATAGCAGGCATGTTTCAGG + Intergenic
995985542 5:118166532-118166554 GTCATTAGCAGGTATGAGACTGG - Intergenic
1001049462 5:168402778-168402800 GGAGTTATCAGGGATGATGCTGG - Intronic
1001248549 5:170125192-170125214 GGAATTAGCAGGTATTAGGTTGG + Intergenic
1003518136 6:6834758-6834780 GAAATTAGCAGGGATGGTGGGGG - Intergenic
1005525040 6:26638687-26638709 GGAATTAACATATATGATGCTGG - Exonic
1008285801 6:49648374-49648396 CAAATTAGCAGGTATTATCCAGG + Intergenic
1011738530 6:90336334-90336356 CTAATTAGCAGGTAAAATGCAGG - Intergenic
1013053644 6:106561968-106561990 GTTAATAGTAGGAATGATGCAGG - Intronic
1014990631 6:128071077-128071099 ATATTTAACAGGTATCATGCAGG + Intronic
1017314257 6:153012284-153012306 GCAATGAGCAGGTATGCTTCAGG + Intronic
1018582573 6:165319749-165319771 GCAATTAGCAGGGAGGCTGCAGG + Intergenic
1023834109 7:44058470-44058492 GAAATGAGCAGGTAAGATGGGGG + Exonic
1026210325 7:68298439-68298461 GTAATTACCTAGTATGATGTTGG + Intergenic
1026658745 7:72280048-72280070 GGAAATAGCATGTAGGATGCTGG - Intronic
1027693948 7:81385003-81385025 GTACTTAGCAGATATGATTATGG - Intergenic
1036527061 8:9545110-9545132 GTAATTAGGAGCAATGATCCCGG + Intergenic
1036974832 8:13398870-13398892 GCTATTTGCAGGTGTGATGCCGG + Intronic
1039861512 8:41463028-41463050 AAAATTAGCTGGTATGATGGTGG - Intergenic
1042073725 8:64965317-64965339 TTAGATAGCAGGTGTGATGCCGG + Intergenic
1043165273 8:76895530-76895552 GTAATTTGCAGGGATGATCTAGG - Intergenic
1043444471 8:80305852-80305874 ATAATTAGCTGGTATGGTGGTGG + Intergenic
1049320144 8:141991948-141991970 GGGATTCGCAGGTAAGATGCTGG - Intergenic
1051056739 9:12996151-12996173 GTTTCTAGCAGGTATGATGGAGG + Intergenic
1057682231 9:97199645-97199667 GGAATTAACATATATGATGCTGG - Intergenic
1061917865 9:133765264-133765286 GTAATTAGCAAGTAATTTGCAGG - Intronic
1062445024 9:136590016-136590038 GTAACCAGCAGGTGTGCTGCCGG - Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1194086832 X:89538488-89538510 GTAATTAGGAGGAAAGCTGCTGG + Intergenic
1194666236 X:96680690-96680712 GTATTTACCAGGTATTAAGCAGG - Intergenic
1197384561 X:125787230-125787252 GTAATTAAGAGGTTTGATTCTGG + Intergenic
1198894087 X:141431213-141431235 GTAATTAACAGAGATGTTGCAGG - Intergenic
1199241201 X:145549769-145549791 GTAATTACCAGCTAGGAAGCAGG - Intergenic
1202174284 Y:22083502-22083524 GTAATGAGCAGGAAAGATGAGGG + Intronic
1202217076 Y:22502880-22502902 GTAATGAGCAGGAAAGATGAGGG - Intronic
1202326109 Y:23693190-23693212 GTAATGAGCAGGAAAGATGAGGG + Intergenic
1202339087 Y:23841701-23841723 GTAATTAACAGGTTTTATTCTGG - Intergenic
1202531679 Y:25828371-25828393 GTAATTAACAGGTTTTATTCTGG + Intergenic
1202544662 Y:25976864-25976886 GTAATGAGCAGGAAAGATGAGGG - Intergenic