ID: 908573404

View in Genome Browser
Species Human (GRCh38)
Location 1:65433554-65433576
Sequence TAATTAGCAGGTATGATGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908573401_908573404 -2 Left 908573401 1:65433533-65433555 CCTTGAGGCTTGTGATCTGAGTA 0: 1
1: 0
2: 1
3: 7
4: 118
Right 908573404 1:65433554-65433576 TAATTAGCAGGTATGATGCTGGG 0: 1
1: 1
2: 0
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908573404 Original CRISPR TAATTAGCAGGTATGATGCT GGG Exonic
905088487 1:35406679-35406701 TATATACCAGGTATGAAGCTAGG + Intronic
905549323 1:38823532-38823554 TATGTACCAGGTATGAAGCTGGG + Intergenic
907715650 1:56923581-56923603 TATGTACCAAGTATGATGCTAGG - Intergenic
907870646 1:58439589-58439611 TAAATAGCATGTAAAATGCTGGG - Intronic
908242798 1:62202003-62202025 TAATTAAGAGGGATGAGGCTGGG + Intronic
908573404 1:65433554-65433576 TAATTAGCAGGTATGATGCTGGG + Exonic
911621939 1:100074725-100074747 AAATTAGCAGGCATGGTGGTGGG + Intronic
912837762 1:113011206-113011228 AAATTAGCTGGTGTGATGGTGGG + Intergenic
917658232 1:177149992-177150014 TAAGTAGCAGTCATGATACTAGG - Intronic
918834113 1:189437928-189437950 TAAATAGAAGGTAAGATCCTAGG - Intergenic
920412565 1:205773996-205774018 TAATTAGAAGGTATTTAGCTAGG - Intronic
920581803 1:207116338-207116360 TAGTTAGCATGTCTGATGCCTGG + Intronic
920607894 1:207407894-207407916 TCATTGGCAGATATGATCCTGGG + Intergenic
1064235141 10:13566877-13566899 TATTTAGCATTTACGATGCTAGG - Intergenic
1064824197 10:19376702-19376724 AAATTAGCAGGTGTGGTGTTGGG - Intronic
1070614689 10:77960529-77960551 AAATTAGCAGGTGTGATGGCGGG - Intergenic
1075333606 10:121593353-121593375 TAAGCAGTAGGAATGATGCTGGG + Intronic
1075925020 10:126244627-126244649 TAATTCACAGGTGTGGTGCTGGG + Intronic
1079210398 11:18455875-18455897 TGCTTGGCAGGTGTGATGCTTGG - Exonic
1079210400 11:18455891-18455913 TGCTTGGCAGGTGTGATGCTTGG - Exonic
1079210402 11:18455907-18455929 TGCTTGGCAGGTGTGATGCTTGG - Exonic
1080240649 11:30123552-30123574 TACATAGCAGGTATCATGCTAGG + Intergenic
1080709454 11:34733055-34733077 GACTTAGCAGGGATTATGCTAGG + Intergenic
1081355813 11:42111957-42111979 TTATTTGTAGATATGATGCTTGG - Intergenic
1082039552 11:47673640-47673662 AAATTAGCAGGCATGGTGGTGGG + Intronic
1086135206 11:83437768-83437790 AAATTACCAGGCATGATGGTGGG + Intergenic
1086236441 11:84636928-84636950 AAATTAGCAGGTGTGGTGGTGGG - Intronic
1086839916 11:91672378-91672400 AAATTTACAGGTTTGATGCTAGG + Intergenic
1088953494 11:114594518-114594540 TGATTATCAGGTATGTTGTTTGG + Intronic
1092757324 12:11776007-11776029 CAATTAGCAGGCTTGATGCCTGG - Intronic
1093078714 12:14784879-14784901 TAATTAGCAGTTCTGATTCTGGG - Exonic
1093200225 12:16177613-16177635 TTATTAGTAGGTATTGTGCTTGG + Intergenic
1093485072 12:19643286-19643308 AAATTAGCAGGCATGGTGGTGGG - Intronic
1093855569 12:24098106-24098128 TAGGTAGTAGGTGTGATGCTTGG + Intergenic
1096816132 12:54203064-54203086 AAATTAGCAGGTGTGGTGGTGGG + Intergenic
1097632815 12:62084626-62084648 TAATTAGAAGGCCTTATGCTTGG + Intronic
1100029532 12:90168967-90168989 GAATTACCAGGTACAATGCTGGG + Intergenic
1104471015 12:129029604-129029626 AAATTAGCAGGTGTGGTGGTGGG + Intergenic
1106052727 13:26206770-26206792 TATGTACCAGGTATCATGCTAGG + Intronic
1106870498 13:34013731-34013753 TATTTAGGAGGTACGATGCCAGG + Intergenic
1109773608 13:67009995-67010017 TAATTAGCAGATATGTAGTTTGG - Intronic
1111404440 13:87784205-87784227 TTATTAGCAGATATGATGAGAGG - Intergenic
1111554900 13:89867915-89867937 TAATTAGCAAGTATAAGACTGGG - Intergenic
1111874913 13:93881026-93881048 AAAATAGCAGGAAGGATGCTGGG - Intronic
1112820496 13:103329005-103329027 GAATTAGCAGATATGATTGTGGG + Intergenic
1114358047 14:21936693-21936715 AAATAAGCTGGAATGATGCTGGG - Intergenic
1116382427 14:44287389-44287411 AAATTATCAGGTATGATCCTGGG + Intergenic
1116659022 14:47683763-47683785 TAATTAGCAGGTTTGGTGGCCGG + Intergenic
1117045686 14:51810951-51810973 TAATTAGCAGACATGATATTTGG + Intergenic
1117490056 14:56237650-56237672 TAACCAGCAATTATGATGCTTGG - Intronic
1119298817 14:73554165-73554187 AAATTAGCAGGCATGGTGGTGGG + Intronic
1120360527 14:83495300-83495322 TAGATAGCAGGTATGACACTAGG + Intergenic
1121234453 14:92382029-92382051 TAAATAGCAGGAAAGATGGTGGG - Intronic
1121934889 14:98009225-98009247 AAATTAGCAGGCATGGTGGTGGG - Intergenic
1122358509 14:101140317-101140339 AAATTAGAAGGTATGTTGATAGG - Intergenic
1123002674 14:105304337-105304359 AAATTAGCAGGTGTGATGGTGGG + Exonic
1125630185 15:41140945-41140967 TTATTAGAAAGTATGAGGCTGGG - Intergenic
1125812212 15:42551135-42551157 AAATTAGCAGGTGTGATGGCAGG - Intronic
1125857907 15:42968518-42968540 TAATAATCAGTTATGAAGCTAGG - Intronic
1128207071 15:65862417-65862439 CAATTAGCAGGCATGGTGGTGGG - Intronic
1132627860 16:900656-900678 AAATTAGCAGGTATGCTGGCGGG - Intronic
1134343536 16:13367635-13367657 TAAATAGCAAGTAGGATGCGGGG + Intergenic
1136177040 16:28524256-28524278 TTAATAGAAGGTATGAGGCTGGG + Intergenic
1138267080 16:55667313-55667335 CAACTAGCAAGTATGAAGCTTGG - Intronic
1138292864 16:55862796-55862818 TATATACCAGGTATTATGCTGGG + Intronic
1142896677 17:2984197-2984219 AAATTAGCCGGTGTGATGGTGGG + Intronic
1144487497 17:15679213-15679235 TAATTAGCAACTATGAGGCCAGG + Intronic
1146239849 17:31209799-31209821 AAATTAGCTGGCATGATGGTGGG - Intronic
1146252307 17:31358603-31358625 TACTTTGCAGGTAAGATGTTTGG - Exonic
1146566894 17:33921331-33921353 TAAATAACAGGTATCATGGTAGG - Intronic
1146933543 17:36795102-36795124 AAATTAGCAGGCATGGTGGTGGG - Intergenic
1157660404 18:49436633-49436655 TAATTAGCAGTTAGGATTGTAGG + Intronic
1160307865 18:77757819-77757841 TAACAAGCAGGCATGATGCTAGG + Intergenic
1161813091 19:6481856-6481878 TAATTAGCAGGCAGGATGCCTGG - Intronic
1162272313 19:9626280-9626302 AAATTAGCAGGTATGGTGCCAGG + Intronic
1162766222 19:12921474-12921496 AAATTAGCAGGCATGATGGCAGG - Intergenic
1163918121 19:20260648-20260670 TAATTTGCAAGAATGATACTTGG - Intergenic
1166594956 19:44038185-44038207 TAATTAGGAGCTCTGATGTTTGG - Intergenic
1167188605 19:47966454-47966476 TATTTAGAAGGTGTGATGCCTGG + Intergenic
926017937 2:9470814-9470836 TATTCAGCAGGCATCATGCTAGG - Intronic
926790453 2:16565898-16565920 TAATAAGCTGCTAGGATGCTAGG + Intronic
927979665 2:27366785-27366807 GAATCAGCAGGTAGGAGGCTGGG + Exonic
929877287 2:45807376-45807398 AAATTAGCAGCCATGATTCTGGG - Intronic
931661410 2:64567310-64567332 AAAGTAGCAGGTATATTGCTTGG + Intronic
931743425 2:65269677-65269699 TAATTTGCAAGAATGATACTTGG - Exonic
932346968 2:71001823-71001845 TAGTTGGCAGGTGTGTTGCTTGG + Intergenic
933108116 2:78359592-78359614 AAATTAGCTGGCATGATGGTGGG - Intergenic
934589396 2:95532419-95532441 AAATTAGCTGGCATGATGGTGGG + Intergenic
936630776 2:114200555-114200577 TACTTAGCAGGTAAGCTGCAAGG + Intergenic
940029779 2:149249645-149249667 TAATTACCACTTATGATCCTTGG - Intergenic
940778842 2:157911909-157911931 TAATTAGGAGAGATGATGCTTGG - Intronic
943629481 2:190234699-190234721 AAATTAGCAGGTATGGTGGCGGG + Intronic
944240694 2:197482499-197482521 TAATAAGCAGGAGTGTTGCTAGG - Intergenic
945061727 2:205915142-205915164 TAATAAGCATATCTGATGCTTGG + Intergenic
946256541 2:218446381-218446403 AAATTAGCAGGCATGATGGTGGG - Intronic
946710572 2:222500807-222500829 GAATTACCAGTTAAGATGCTTGG - Intronic
947563743 2:231180299-231180321 AAATAAGCAGCTATGATGCCAGG - Intergenic
947667688 2:231917620-231917642 TGACTAGCAGGTCTGATCCTGGG - Intergenic
1169034975 20:2442588-2442610 AAATTAGCAGGCATGATGGCAGG + Intergenic
1172531552 20:35634443-35634465 AAATTAGCTGGTATGGTGGTGGG + Intronic
1175095151 20:56535233-56535255 AAATTAGCTGGTATGGTGGTGGG + Intronic
1177027392 21:15936349-15936371 TACTTCTCAGGTATCATGCTGGG - Intergenic
1180696619 22:17755231-17755253 AAATTAGCGGGCATGGTGCTGGG - Intronic
1181711040 22:24689028-24689050 TAATTTGCAAGAATGATACTTGG - Intergenic
1182135029 22:27893431-27893453 AAATTAGCCGGTATGGTGGTGGG - Intronic
1183438835 22:37811330-37811352 AAATTAGCTGGCATGATGGTGGG + Intronic
1184083552 22:42243451-42243473 AAATTAGCAGGCATGGTGGTGGG + Intronic
1185253548 22:49818735-49818757 AAATTAGCAGGTGTGGTGGTGGG + Intronic
951118621 3:18895960-18895982 TAATTAGCAGAAAAGATGTTAGG + Intergenic
951743656 3:25952292-25952314 CAAGTAGCATGAATGATGCTAGG + Intergenic
953707916 3:45245161-45245183 TGATTAGCAGGTTTGGAGCTTGG + Intergenic
955273921 3:57528947-57528969 AAATTAGCTGGTATGGTGGTGGG - Intronic
958899698 3:99871381-99871403 CAATTAGTAGGTGTGTTGCTGGG - Intronic
959116129 3:102180780-102180802 TTATTACCAGGTATGCTGCCAGG + Intronic
960291600 3:115892127-115892149 AAATTTACAGGTCTGATGCTTGG - Intronic
960427743 3:117529751-117529773 TAGATAGCAGGTTGGATGCTGGG + Intergenic
960624733 3:119671121-119671143 TGAATAGCAGGGATAATGCTAGG - Intronic
964417285 3:156460630-156460652 TAATCAGCAGATATTATGCCAGG - Intronic
965683043 3:171271799-171271821 TAATTGACATGTAAGATGCTAGG + Intronic
967377230 3:188818205-188818227 TAATTAGAAGTTATGAAACTTGG - Intronic
968638230 4:1694538-1694560 TAATAGCCAGGTATGATGGTGGG - Intronic
969202126 4:5614826-5614848 AAATTAGCAGGTGTGATGGTGGG + Intronic
969980846 4:11152515-11152537 TAAATATCAGGTGTGATGCCAGG + Intergenic
970097052 4:12476124-12476146 TAAGTAGAAGGTATGGTGCAGGG + Intergenic
974647255 4:64711085-64711107 TAATAATCTTGTATGATGCTGGG - Intergenic
978990716 4:115078690-115078712 AAATTAGCAGGCATGGTGGTGGG + Intronic
979827237 4:125253949-125253971 TAATTAGCAGATATTAATCTTGG - Intergenic
981331198 4:143512794-143512816 TAATTTTCATGTTTGATGCTTGG + Intergenic
982120170 4:152135779-152135801 TAAGTGCCAGGTATTATGCTAGG + Intergenic
983424896 4:167571103-167571125 TAATTAGAAGTTATGATTCTTGG - Intergenic
985348309 4:189031089-189031111 TAATTATCACGTATAATGCCTGG - Intergenic
986145113 5:5070872-5070894 TGATTATCTGGGATGATGCTGGG - Intergenic
987209656 5:15667622-15667644 GAATTAGCAGCTATACTGCTGGG - Intronic
987612545 5:20225150-20225172 TCATGAGCATGTATGATACTAGG - Intronic
988792049 5:34617820-34617842 AAATTGGCAGGCATGATGGTGGG + Intergenic
989304400 5:39935703-39935725 TAATTATCAGGTACCATGATTGG - Intergenic
990092315 5:52067889-52067911 TAATTTGCTGGTATTTTGCTGGG - Intronic
990639997 5:57771984-57772006 TAATTAGCTGGTATGATTAAAGG - Intergenic
991376041 5:65968233-65968255 TAAGTAGAAGGTATCATGATGGG + Intronic
995985541 5:118166531-118166553 TCATTAGCAGGTATGAGACTGGG - Intergenic
996492120 5:124110294-124110316 TAATTATCAGGCAGGATTCTTGG + Intergenic
996734967 5:126750046-126750068 CTAATAGCAGGAATGATGCTAGG + Intergenic
997543188 5:134681772-134681794 TAAGTGGTAGGTATGATGTTAGG + Intronic
999878495 5:155835155-155835177 AAATTAGCAGGCATGGTGGTGGG - Intergenic
1000537540 5:162497511-162497533 TATTAAGCAGGTGTTATGCTAGG + Intergenic
1001049461 5:168402777-168402799 GAGTTATCAGGGATGATGCTGGG - Intronic
1003186753 6:3838690-3838712 AAATTAGCAGGCATGGTGTTGGG + Intergenic
1014006855 6:116429182-116429204 GACATATCAGGTATGATGCTGGG + Intronic
1014920570 6:127210788-127210810 AAAATAGCAGGTGTGATGATAGG + Intergenic
1015444010 6:133282826-133282848 GAATTAGCAGTTATGAGGCTTGG - Intronic
1020768633 7:12358223-12358245 AAATTAGCAGGCATGGTGGTGGG + Intronic
1023958204 7:44904894-44904916 TAATTACCTGGGATGAAGCTGGG + Intergenic
1025765692 7:64445673-64445695 AAATTAGCTAGTATGATGGTGGG - Intergenic
1025827221 7:65020275-65020297 AAATTAGCAGGCATGGTGGTGGG + Intergenic
1030252330 7:107461458-107461480 TCATTATTAGGTTTGATGCTAGG - Intronic
1030748354 7:113197482-113197504 TAAGTGCCAGGCATGATGCTAGG + Intergenic
1031929935 7:127674667-127674689 TAATTTTCTGCTATGATGCTAGG - Intronic
1036715059 8:11114508-11114530 GAATTAGCAGGCATGGTGGTGGG - Intronic
1039861511 8:41463027-41463049 AAATTAGCTGGTATGATGGTGGG - Intergenic
1041204385 8:55483203-55483225 TAATAAGAAGTGATGATGCTGGG - Intronic
1043444472 8:80305853-80305875 TAATTAGCTGGTATGGTGGTGGG + Intergenic
1049836179 8:144736949-144736971 AAATTAGCAGGCATGGTGGTGGG - Intronic
1050494173 9:6222389-6222411 TATTTAGCTGGTATGCTGCAAGG - Intronic
1051734465 9:20184398-20184420 AAATTAGCCGGTATGCTGGTGGG + Intergenic
1056101269 9:83302555-83302577 TAATGAGCAGGTATGATGCTAGG - Intronic
1057245015 9:93447969-93447991 TAATTAACAGGGCTGGTGCTAGG + Intronic
1058489082 9:105476183-105476205 TAATTGGCAGTTATGAAGATTGG + Intronic
1061364168 9:130162520-130162542 AAATTAGCCGGTGTGATGCCAGG - Intergenic
1186315266 X:8362823-8362845 TATATAGCAGGTGTGATGCATGG + Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1189112357 X:38305045-38305067 TAAGTAACAGGTATGATACAAGG + Intronic
1189412436 X:40784673-40784695 TAAGTGCCAGGCATGATGCTAGG + Intergenic
1190166269 X:48075267-48075289 TAATTAACAGGTTTGAGGGTGGG + Intergenic
1194417756 X:93634798-93634820 TAATTTGCAAGTAGGATGCCAGG + Intergenic
1195524758 X:105873874-105873896 TATGTACCAGCTATGATGCTAGG + Intronic
1197984743 X:132255665-132255687 AAATTAGCCGGTGTGATGGTGGG - Intergenic
1199067328 X:143434804-143434826 TAATTATCAGGAATGCTGTTTGG - Intergenic
1200747210 Y:6912679-6912701 AAGTTAGCAGGGATGATGCCAGG + Intronic