ID: 908573903

View in Genome Browser
Species Human (GRCh38)
Location 1:65439084-65439106
Sequence TGCCCAGCAGTACCCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908573903_908573905 5 Left 908573903 1:65439084-65439106 CCATTTCAGGGTACTGCTGGGCA No data
Right 908573905 1:65439112-65439134 ACATGAGTTCCCATTGCTTGTGG No data
908573903_908573906 6 Left 908573903 1:65439084-65439106 CCATTTCAGGGTACTGCTGGGCA No data
Right 908573906 1:65439113-65439135 CATGAGTTCCCATTGCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908573903 Original CRISPR TGCCCAGCAGTACCCTGAAA TGG (reversed) Intronic
No off target data available for this crispr