ID: 908577861

View in Genome Browser
Species Human (GRCh38)
Location 1:65480138-65480160
Sequence GTTTTCAATAGGTAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908577861_908577866 -7 Left 908577861 1:65480138-65480160 CCATCCACCTACCTATTGAAAAC 0: 1
1: 0
2: 0
3: 7
4: 158
Right 908577866 1:65480154-65480176 TGAAAACCTGGAGCTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908577861 Original CRISPR GTTTTCAATAGGTAGGTGGA TGG (reversed) Intronic
902365574 1:15971273-15971295 GTTTTGGGTAGGTAGGTGGGTGG + Intronic
902480465 1:16708761-16708783 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
907960304 1:59273482-59273504 ATTTACATTAGGTAGGGGGAGGG - Intergenic
908577861 1:65480138-65480160 GTTTTCAATAGGTAGGTGGATGG - Intronic
908874651 1:68658322-68658344 ATTTTCAATATTTAGGTGAAAGG - Intergenic
911440963 1:97925290-97925312 GTTTTGAATGGGTTGGGGGATGG - Intergenic
912223498 1:107704294-107704316 GTCTTCAAGAGGGAGTTGGATGG - Intronic
912838423 1:113017417-113017439 GTTCTCTATAGGAAGGAGGAAGG - Intergenic
916696689 1:167244692-167244714 GCTTTCAGTAGGTAGGTGATAGG - Intronic
917216378 1:172682372-172682394 GTTTTCAATGGGGGGGTTGATGG + Intergenic
917581261 1:176380313-176380335 GTTTTAAATTGGCAGGTGGTGGG + Intergenic
917687945 1:177437107-177437129 GATTACTATAGGTAGGGGGATGG - Intergenic
918338333 1:183544840-183544862 TTTTTTAACAGGTAGGTAGAGGG - Intronic
920131927 1:203738754-203738776 TTTCTCAATAGGCAGGAGGAAGG + Intronic
920164789 1:204028251-204028273 CTTTTCCATAGGGAGGTAGAGGG + Intergenic
920399210 1:205666729-205666751 GTCTCCAAAAGGAAGGTGGAAGG + Intronic
920959533 1:210652133-210652155 GTATTAAATGGGTGGGTGGATGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
924009557 1:239649754-239649776 GTTTTCCCTGGGTAGGTGCAGGG + Intronic
924428470 1:243975388-243975410 GGTTTCAATAGATAGGGGGAAGG - Intergenic
924669681 1:246110843-246110865 CTTTTAAATTGGTAGGTGTAAGG - Intronic
1065565105 10:27000321-27000343 TTTTTCAATAAGTATGTAGATGG - Intronic
1072246414 10:93547729-93547751 GGGTTCAATAGGTAGATGAATGG + Intergenic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1077159456 11:1106107-1106129 GTGATGACTAGGTAGGTGGAAGG - Intergenic
1079719670 11:23793798-23793820 GTTTGCAATAGGTGTGGGGAAGG + Intergenic
1090508092 11:127341156-127341178 TTTTTCAAGGGGTAGGTGGTAGG + Intergenic
1090563639 11:127962173-127962195 GTTTGCAATAGGTCTGTGAAAGG + Intergenic
1090568069 11:128017545-128017567 GTTATCAGTATGTAGGTGTAAGG + Intergenic
1093554360 12:20453066-20453088 GTTTTGAATCTGTAGGTGCAAGG + Intronic
1095659500 12:44714089-44714111 TTTTTCAATTAGTAGGTCGAGGG + Intronic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1098958219 12:76709746-76709768 GATTTAAATAGCTGGGTGGATGG - Intergenic
1099213809 12:79829145-79829167 GTTGTCAATATGTAGTTAGAAGG - Intronic
1100259933 12:92923406-92923428 GTTTGCAACAGGTAGCTTGAAGG - Intronic
1101886127 12:108664315-108664337 GTTTTCAATTGCTTAGTGGAAGG + Intronic
1102507051 12:113390298-113390320 GTGACAAATAGGTAGGTGGATGG - Exonic
1102699798 12:114829285-114829307 GTTTTCAATGGATGGATGGATGG - Intergenic
1102699806 12:114829330-114829352 GTTTTCAATGGATGGATGGATGG - Intergenic
1102699815 12:114829379-114829401 GTTTTCAATGGATGGATGGATGG - Intergenic
1102699838 12:114829512-114829534 GTTTTCAATTGGTGGATGAATGG - Intergenic
1106121867 13:26866615-26866637 CTTGACAAAAGGTAGGTGGAGGG - Intergenic
1108886202 13:55185415-55185437 GTATTCAAGTGGTAGTTGGAGGG + Intergenic
1109526879 13:63586987-63587009 TTTTTAAATAGGCAGGAGGAAGG - Intergenic
1112011682 13:95298934-95298956 ATTTTCAAAATGTAGGTGGCAGG - Intronic
1114847729 14:26344007-26344029 GGTTTGAAGAGGGAGGTGGAAGG + Intergenic
1116643397 14:47495258-47495280 GACTTCAAAAGGTAGGTGGGTGG + Intronic
1117487812 14:56215444-56215466 TTCCTCAATAGGTAGGTAGAAGG + Intronic
1117951732 14:61089650-61089672 TTTCTCAATCAGTAGGTGGAAGG + Intergenic
1117953782 14:61107422-61107444 TTTTTCAATATGTAGTTGCATGG + Intergenic
1118062331 14:62153494-62153516 GTTTTCATTAGGTAAGTACATGG + Intergenic
1120298103 14:82670796-82670818 ATTTTCAACTGGTAGGTGGGGGG + Intergenic
1124055777 15:26239731-26239753 GTTTCCAATAGCTAGAAGGAGGG - Intergenic
1125133097 15:36307517-36307539 GTTTTCAATGGGAAGGTTGAGGG + Intergenic
1126961153 15:53995912-53995934 CTTTTCAAGAGTTAGGTGGGAGG + Intergenic
1127280002 15:57480878-57480900 GGTTTCAAGAGGAAGGGGGATGG - Intronic
1131263993 15:90904986-90905008 GTTGAGAATAGGTAGGTGAAAGG + Intronic
1131317988 15:91357504-91357526 GTTGTCAATAGCTCTGTGGATGG + Intergenic
1132613761 16:830430-830452 GTTTTTAATCCGTAGGTGGACGG - Intergenic
1133514558 16:6495812-6495834 GTCTTCAATAGGTGGGAAGAAGG - Intronic
1134512393 16:14859010-14859032 CTCTTCAATAGGTACTTGGATGG + Intronic
1134700029 16:16257510-16257532 CTCTTCAATAGGTACTTGGATGG + Intronic
1134769236 16:16791824-16791846 GTTATCAATATGTAAGTTGAAGG + Intergenic
1134971795 16:18537149-18537171 CTCTTCAATAGGTACTTGGATGG - Intronic
1135787456 16:25362930-25362952 GAATCCAAAAGGTAGGTGGATGG - Intergenic
1139480982 16:67230589-67230611 GTCTGCAATAGGTAGGGGCATGG - Exonic
1141782936 16:86176567-86176589 GGCTTGAATAGGTAGATGGATGG - Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1144278586 17:13701126-13701148 GTTTTCATTAAGTAAGGGGAAGG - Intergenic
1151244810 17:72786211-72786233 GTTTTCCATATGTTTGTGGATGG - Intronic
1153324960 18:3809159-3809181 GTTCTCAATGGGTAGGGTGATGG + Intronic
1156765509 18:40649885-40649907 GTTTTAATGAGGGAGGTGGAAGG + Intergenic
1156950522 18:42891319-42891341 GTTTTAAATATGGAGATGGAAGG - Intronic
1158439864 18:57466140-57466162 GTTCTTAATTGGCAGGTGGAAGG + Intronic
1159527983 18:69618315-69618337 GCTTCCAACAGGTAGGTGCATGG + Intronic
1165003033 19:32780572-32780594 GATTTCAAGAGGGAGGAGGAAGG - Intronic
1166244973 19:41518862-41518884 GTTTTCAATATCCAGGGGGAAGG - Intergenic
1202644721 1_KI270706v1_random:129676-129698 GTTTCTAATATGTAGGGGGAAGG + Intergenic
1202714507 1_KI270714v1_random:34669-34691 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
926103956 2:10138599-10138621 TTTTTCAAAAGGGAGGTGAAAGG - Intergenic
927405607 2:22762944-22762966 GTATTCAAAATATAGGTGGAGGG - Intergenic
929767918 2:44865454-44865476 GTTTCCAAGAGTTAGGAGGAGGG + Intergenic
930671741 2:54158868-54158890 GTTTTCAAACGGTAGGTTTATGG - Intronic
933113850 2:78441091-78441113 GTACTCAAAAGGTAGGTGGCAGG + Intergenic
933947573 2:87300035-87300057 GTGTTGAAGAGGTAGCTGGAAGG - Intergenic
936332623 2:111561542-111561564 GTGTTGAAGAGGTAGCTGGAAGG + Intergenic
937054874 2:118926123-118926145 GTTTTTAAGAGCTGGGTGGAGGG - Intergenic
939612456 2:144327727-144327749 CTTATCCATAGGTAGGTGGTTGG - Intronic
939730010 2:145772267-145772289 GTGACCAATAGGTAGATGGAGGG - Intergenic
1169915530 20:10678836-10678858 GTTATCTATAGGTTGGTGGTGGG - Intergenic
1170059250 20:12242309-12242331 GTTTTAAATAGGAAGGTAGATGG - Intergenic
1176607157 21:8842979-8843001 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1177180722 21:17742069-17742091 GTTTTACATAGAAAGGTGGAGGG + Intergenic
1178754894 21:35339447-35339469 GATTCCAAAAGGTAGGCGGAAGG + Intronic
1180357240 22:11852767-11852789 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1180381025 22:12139564-12139586 GTTTCTAATATGTAGGGGGAAGG + Intergenic
1184701427 22:46176134-46176156 GTCATTCATAGGTAGGTGGATGG + Intronic
950450825 3:13064361-13064383 GTTTTAAATATGTGTGTGGATGG - Intronic
950889543 3:16391160-16391182 GTTTTGAAAAGGTAGCTGGGGGG - Intronic
952425642 3:33171707-33171729 GTTTTCAGTGTGTATGTGGAGGG - Intronic
952523071 3:34181772-34181794 GTTTTCAACAGGTTGGATGAAGG + Intergenic
953176628 3:40559381-40559403 GTGTGTAATAGGTAGGTAGAAGG - Intronic
953507751 3:43502911-43502933 GTTTCCAGGAGCTAGGTGGAGGG + Intronic
954097161 3:48337889-48337911 GTTTACAATAAGTAAGTAGACGG + Intergenic
954438796 3:50510345-50510367 GTTACCAACAGGAAGGTGGATGG - Intergenic
955819976 3:62886588-62886610 GTCTTCAATAGATAGGATGAGGG - Intergenic
959880620 3:111440778-111440800 CTTTTCAATCTGTAGTTGGAAGG - Intronic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
961211762 3:125131035-125131057 GTTTTCAATTTGTGTGTGGAAGG + Intronic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
964358208 3:155869925-155869947 GTTGCCAAGGGGTAGGTGGAGGG + Intergenic
966543024 3:181113247-181113269 GTTTCCAATAGCTAGAAGGAGGG - Intergenic
968707196 4:2085140-2085162 CTTCCAAATAGGTAGGTGGAAGG + Intronic
970552175 4:17193295-17193317 TTTTACAACAGGTAGATGGATGG + Intergenic
972727521 4:41758194-41758216 GTTTTCAGCAGGTAGGAGGAAGG - Intergenic
973370962 4:49248235-49248257 GTTTCTAATATGTAGGGGGAAGG + Intergenic
975228264 4:71900441-71900463 CTTTTCAAAAGGTAAGGGGAAGG - Intergenic
976437632 4:85036169-85036191 GTTTGCAGTAGGTATGAGGAGGG - Intergenic
982974730 4:162041004-162041026 GAATTCAATAGTCAGGTGGAGGG + Intronic
986868133 5:12014313-12014335 GATTTCAAAGTGTAGGTGGAGGG - Intergenic
987467156 5:18285637-18285659 GTTTTTTAAAGGTAGATGGATGG + Intergenic
988124161 5:27007334-27007356 GATGGCAATGGGTAGGTGGATGG + Intronic
990388158 5:55288836-55288858 GTTTTCAAGAGTAAGGTGGCTGG + Intronic
990694684 5:58402467-58402489 GTTTTCAATAGTTATGTTGCAGG - Intergenic
990868290 5:60403437-60403459 TTGTTGAATAGATAGGTGGATGG - Intronic
991181211 5:63753126-63753148 GGTTTCAATATATAGATGGAGGG + Intergenic
992437143 5:76765761-76765783 CTTTTCAACTGGTAGTTGGATGG - Intergenic
992550101 5:77851834-77851856 GTTTTCATTAATTGGGTGGAGGG - Intronic
994014888 5:94954395-94954417 GATTCCAAAAGGTAGGAGGATGG + Intronic
995008807 5:107234232-107234254 TTATTCAATAGGTAGTTGCAAGG - Intergenic
995524130 5:113037278-113037300 GTTTTCTACAGTTGGGTGGATGG + Intronic
995714292 5:115067085-115067107 GTTTTGAATATGTCAGTGGATGG - Intergenic
998065090 5:139151601-139151623 GCTTTCATTAGGTAGGTACAAGG + Intronic
998971379 5:147596219-147596241 GTTATCAATAGATTGGTTGAAGG + Intronic
1007803032 6:44413893-44413915 GTTTTTATTAGGAATGTGGAAGG + Intronic
1009898452 6:69782020-69782042 TTTGCCAATAGGTAGGTGAAAGG - Intronic
1011444348 6:87422021-87422043 GTGTTTAAAAGGTAGGGGGAAGG + Intronic
1015645160 6:135379595-135379617 TTTTTAAATAGGTAGGTAGATGG - Intronic
1018387849 6:163321413-163321435 GTTGTCACTAAGCAGGTGGACGG - Intergenic
1018736053 6:166688059-166688081 GTATTCAAAAGGCAGGAGGAGGG + Intronic
1020002577 7:4764244-4764266 GTTTTCTCTATCTAGGTGGAAGG - Exonic
1020855072 7:13409973-13409995 GTTTTCTATAGATGGGTAGATGG + Intergenic
1028065917 7:86383732-86383754 AGTTTGAATAGGTGGGTGGAAGG - Intergenic
1029954703 7:104625692-104625714 GTTTGCAATTTGGAGGTGGAGGG - Intronic
1030934769 7:115571750-115571772 GTGTTCAATAATTAGGGGGATGG - Intergenic
1032544308 7:132728891-132728913 ATTTTGAACAGGTAGGTTGAGGG - Intergenic
1040102703 8:43519470-43519492 GTTTTCAGTAGGGTGGTGGGAGG + Intergenic
1041667569 8:60460637-60460659 GTATTTACTAGGTAAGTGGATGG - Intergenic
1044463308 8:92473441-92473463 ATGTTCAATAGATAAGTGGAAGG - Intergenic
1045196662 8:99938947-99938969 GTTTTCATTAAGTAGATGAAAGG - Intergenic
1054812672 9:69447218-69447240 GGTTTCAATATGTATTTGGAGGG + Intronic
1055478719 9:76688942-76688964 GATTTCAATAGGTTGGGAGAAGG - Intronic
1055499806 9:76891715-76891737 GTTTTCAAAAGATAGTTTGAAGG - Intronic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1060423599 9:123486785-123486807 GTGGTCAATAGGAGGGTGGAGGG - Intronic
1061743642 9:132724463-132724485 GTCTTCATTAGGTAGGTGCTTGG - Intergenic
1203695367 Un_GL000214v1:93034-93056 GTTTCTAATATGTAGGGGGAAGG + Intergenic
1203702493 Un_KI270742v1:7870-7892 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1203554473 Un_KI270743v1:193926-193948 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1203640906 Un_KI270751v1:11029-11051 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1185495193 X:549422-549444 GTTCTCAGTAGGTGGATGGATGG - Intergenic
1185859957 X:3568609-3568631 ATATTCAATAGGTAGATGGATGG - Intergenic
1191055612 X:56236940-56236962 GTTTTCTATAGATAGATAGATGG + Intronic
1191669429 X:63735344-63735366 GTTTCCAGAAGGTAGGAGGAGGG + Intronic
1193715926 X:84934702-84934724 GGTTTGAATAGGTAGTCGGAGGG - Intergenic
1193881222 X:86923890-86923912 GTTTTGACTATGTAGGTGGGAGG + Intergenic