ID: 908578247

View in Genome Browser
Species Human (GRCh38)
Location 1:65484854-65484876
Sequence TTGAAGAAAAGGATGGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 623}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908578244_908578247 20 Left 908578244 1:65484811-65484833 CCTTCAATATGGTTTACTAGAAT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 908578247 1:65484854-65484876 TTGAAGAAAAGGATGGTTAAAGG 0: 1
1: 0
2: 2
3: 43
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908578247 Original CRISPR TTGAAGAAAAGGATGGTTAA AGG Intronic
900771722 1:4550390-4550412 TTCAAGAAAAAGATGGATATTGG + Intergenic
901320463 1:8337087-8337109 ATAAAGAAAAGGAGGTTTAATGG + Intronic
902235089 1:15052220-15052242 TTAAAGAAAGGGAGGCTTAATGG + Intronic
902939739 1:19792110-19792132 ATAAAGAAAAAGATGTTTAATGG - Intronic
903862560 1:26373594-26373616 TTGGAGAATAGGATGGATCAAGG - Intronic
908516973 1:64902787-64902809 TTGAAGAAGAGGAAGGACAATGG - Intronic
908578247 1:65484854-65484876 TTGAAGAAAAGGATGGTTAAAGG + Intronic
908699193 1:66880167-66880189 TGGAAGAAAAAGAGGTTTAATGG - Intronic
909227192 1:73040949-73040971 TTGAACAAAAGGATGTTAAAAGG + Intergenic
909376528 1:74948215-74948237 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
910616846 1:89207540-89207562 TAGAAGAAAAAGATGGATACTGG + Intergenic
914867890 1:151447969-151447991 TTGAAGAAATGGTTGGTTCTAGG - Intronic
915194088 1:154176255-154176277 TTGAAGGAAAGAATGGACAAGGG + Intronic
915194755 1:154181307-154181329 TTTCAGAAAAGGATGGTAATTGG - Intronic
915794537 1:158715011-158715033 TTGAAGAAGAGGATGGACCAGGG - Intergenic
915973421 1:160369759-160369781 TTTAAGAAAAAAATGGGTAAAGG - Intronic
916036017 1:160923055-160923077 ATAAAGAAAAAGATGTTTAATGG - Intergenic
916689062 1:167173276-167173298 ATAAAGAAAAAGATGTTTAATGG - Intergenic
917365533 1:174227981-174228003 TTGCAGAAGAGGAATGTTAAAGG - Intronic
917709606 1:177671024-177671046 TTGCAGAAAAGGATGTCTGAGGG - Intergenic
918107275 1:181425752-181425774 AGGAAGAGAAAGATGGTTAAAGG - Intronic
918211596 1:182356280-182356302 TTGGGGAAAGGGATGGTAAAGGG + Intergenic
918603165 1:186388189-186388211 TTGAAGAAAAGAAAAATTAATGG + Intronic
918877861 1:190072639-190072661 TTCAAGATAAGGATGGTTAAGGG + Intergenic
919188276 1:194182593-194182615 TTGGAAAAAGGGATGGGTAAAGG + Intergenic
919246050 1:194985462-194985484 TGGAAGAAAAAGAGGTTTAATGG - Intergenic
919444747 1:197689141-197689163 ATAAAGAAAAGGAGGTTTAATGG + Intronic
919896991 1:202015182-202015204 GTGAAGAGAAGGATGGTCAGAGG - Intronic
921627931 1:217399114-217399136 TTGCAGAAAAAGATAGTCAAAGG + Intergenic
921827279 1:219687309-219687331 CTTTAGAAAAGGATGGTTAAAGG + Intronic
922256968 1:223900800-223900822 CTGAAGAAAAGGACAGTGAATGG + Intergenic
922638093 1:227196637-227196659 TTTAAGAAAAGTATTGTTTAGGG - Intronic
923100978 1:230817117-230817139 TTGAAGCAAAGGAAGTTTGAAGG - Intergenic
923196198 1:231670206-231670228 TTGAAGAATTGGAGGGTTGAAGG + Intronic
923250698 1:232177273-232177295 ATGAAGAAAAAGAGGTTTAAAGG - Intergenic
923409306 1:233691378-233691400 TTGAAGAAATGGAGGGTGAGAGG - Intergenic
923762325 1:236858168-236858190 ATGAAGAAAAGGAGGTTTAATGG + Intronic
923802626 1:237225347-237225369 ATAAAGAAAAGGAGGTTTAATGG + Intronic
924757553 1:246955189-246955211 TTAAAGAAAAAGAGGTTTAATGG - Intronic
924902886 1:248420335-248420357 TTGAAGAAAAAAATAGTTATAGG + Intergenic
1063095070 10:2902000-2902022 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1063118786 10:3089840-3089862 GTGTAAAGAAGGATGGTTAATGG - Intronic
1063887169 10:10591278-10591300 TTTAATAATGGGATGGTTAAAGG + Intergenic
1064121714 10:12624797-12624819 ATGAAGAAATGGAGGCTTAAAGG - Intronic
1064188596 10:13185660-13185682 ATGAAGGAAAGGATGGAAAATGG + Intronic
1064569351 10:16676242-16676264 ATGAAGAAAAAGAGGCTTAATGG + Intronic
1064629773 10:17297830-17297852 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1065009943 10:21411943-21411965 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
1065089713 10:22219657-22219679 TAGAAGATAAGGCTGGATAAAGG + Intergenic
1065375494 10:25036390-25036412 TTAAAGAAAATGAGGTTTAATGG - Intronic
1065975968 10:30842612-30842634 TTTAAGATAAGGAAGGTTAGTGG - Intronic
1066273162 10:33843491-33843513 GAGAAGAAAAGGAGGTTTAATGG + Intergenic
1066609103 10:37217669-37217691 TTTAAGATAAGTATGTTTAATGG + Intronic
1068103302 10:52582558-52582580 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1069025856 10:63540617-63540639 TTTAAGAAAAGGATTATGAAAGG - Intronic
1069297658 10:66867111-66867133 ATAAAGAAAAAGATGTTTAATGG - Intronic
1071179713 10:82968834-82968856 ATGAAGAAAAAGAGGTTTAATGG + Intronic
1071237372 10:83664870-83664892 TTGAAGAAATTGAAGGATAATGG - Intergenic
1071981154 10:91005330-91005352 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1072306870 10:94116107-94116129 TTGAAGAAAAGGATGGAGAGAGG - Intronic
1072538903 10:96383592-96383614 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1072906575 10:99459455-99459477 TTTAAAAAAATGATGGTAAAAGG + Intergenic
1073665070 10:105522350-105522372 TTGTGGAAAAGCATGGTAAATGG + Intergenic
1073710145 10:106027516-106027538 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1073795674 10:106985434-106985456 TTGAAGAAAAGAATGGAAATAGG + Intronic
1073942526 10:108714541-108714563 TTAAAGAAAAAGATATTTAATGG - Intergenic
1074041540 10:109794234-109794256 GGGAAGAAAAAGATGTTTAATGG + Intergenic
1074287348 10:112110582-112110604 AGGAAGAAAAGGAGGTTTAATGG - Intergenic
1074386363 10:113019675-113019697 TTGGAGAAAAGCATTGTCAAAGG + Intronic
1074594131 10:114844649-114844671 TGGAAGAAAAGAACGGTAAATGG - Intronic
1074874160 10:117601441-117601463 TTGAATATAAGCATGGTTGAAGG - Intergenic
1074936455 10:118186485-118186507 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
1075145326 10:119877703-119877725 TAGGAGAAAAGGATGCTTCAGGG + Intronic
1075227109 10:120639581-120639603 TTCATGAAAATGATGGTAAAAGG + Intergenic
1075565359 10:123499622-123499644 GAGAAGAAAAAGATGTTTAATGG - Intergenic
1076261797 10:129072326-129072348 ATAAAGAAAAGGAGGTTTAAGGG - Intergenic
1077587819 11:3467568-3467590 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
1077649049 11:3953028-3953050 TTGAAGAAAAGAATGCTTAGAGG + Intronic
1078820381 11:14874236-14874258 AAAAATAAAAGGATGGTTAAAGG - Intergenic
1078973838 11:16448421-16448443 TTGAATAAAAGGAGGGTAATGGG - Intronic
1079301042 11:19279042-19279064 TTAAAGAAAAAGAAGTTTAATGG - Intergenic
1079513649 11:21240731-21240753 TTGAAGGAAAGGAATATTAAAGG - Intronic
1079625461 11:22611818-22611840 ATAAAGAAAAGGATGTTTAATGG + Intergenic
1079844218 11:25444082-25444104 GTAAAGAAAAGGAGGTTTAAGGG - Intergenic
1079936076 11:26618088-26618110 TTGGAGAAAATGATGGTACAGGG - Intronic
1080125105 11:28723969-28723991 TTGATGAGAAGGATGGTTTTGGG - Intergenic
1080547901 11:33339477-33339499 ATTAACAAAAGGATGGTTCAGGG - Exonic
1081101249 11:39005951-39005973 ATAAAGAAAAGGAAGTTTAATGG + Intergenic
1081122465 11:39284491-39284513 ATAAAGAAAATGAGGGTTAATGG + Intergenic
1082130712 11:48485827-48485849 GTGAGGAAAAGGATGGAAAAGGG - Intergenic
1082132303 11:48505758-48505780 TGGGAGATAAGGATAGTTAATGG + Intergenic
1082244511 11:49905664-49905686 TGGGAGATAAGGATGGTTAATGG - Intergenic
1082565768 11:54676378-54676400 TGGGAGATAAGGATAGTTAATGG + Intergenic
1082637031 11:55608820-55608842 TTGAAGAAAAAGAAGTTTAATGG - Intergenic
1082651695 11:55801912-55801934 TTGAAGAAAAGGATAATGTAAGG + Intergenic
1082987133 11:59178751-59178773 TTTAAGAAATGGATGGAAAATGG + Intronic
1085001512 11:73040848-73040870 TTGAAGGGAAGATTGGTTAATGG - Intronic
1085092050 11:73725463-73725485 ATAAAGAAAAGGAGGTTTAATGG + Intronic
1085992853 11:81871469-81871491 AAGAAGAAAAGGATGATCAAAGG + Intergenic
1086419054 11:86619710-86619732 ATAAAGAAAAGGAGGCTTAATGG - Intronic
1086790389 11:91030396-91030418 TTGAAGAAATGGATGATTCCAGG - Intergenic
1087511707 11:99102932-99102954 ATGAAGAAAAAGAGGTTTAATGG + Intronic
1087658579 11:100957570-100957592 TCAAAGCAAAGGATGGTCAAAGG + Intronic
1088779774 11:113123084-113123106 GGGAAGAATAGGTTGGTTAATGG + Intronic
1088782901 11:113153355-113153377 TTAAAGGAAAGGATAGTTAGAGG + Intronic
1090179232 11:124680032-124680054 TTACAGAAAAGAAAGGTTAAAGG - Intronic
1090477730 11:127038754-127038776 GTGGAGAAAAGGATAATTAATGG + Intergenic
1090914615 11:131152294-131152316 TTGCAGAAAAGGATTTTTAAAGG + Intergenic
1091065386 11:132505493-132505515 TTCAGGAAAAGGCTGCTTAAGGG + Intronic
1091424755 12:377682-377704 TTCATGAGAAAGATGGTTAATGG - Intronic
1091927187 12:4362615-4362637 TTGAAGAAATGGCTGGTTCTAGG - Intergenic
1092642884 12:10536729-10536751 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1092941085 12:13407856-13407878 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1093224067 12:16459971-16459993 TTGTAGAAACAGAAGGTTAATGG + Intronic
1093670417 12:21867781-21867803 CTGAAGAGGAGGATGGTTGATGG + Intronic
1094194727 12:27736060-27736082 TTGAAGTAAAGAAAGGTTATTGG + Intronic
1094342996 12:29433453-29433475 ATAAAGAAAAAGAGGGTTAATGG - Intronic
1094353166 12:29548647-29548669 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1094483210 12:30901456-30901478 GGGAAGAAAAAGAGGGTTAATGG - Intergenic
1094679210 12:32652708-32652730 TTGAAGAAATGGTTGATTCAAGG + Intergenic
1094798311 12:34001456-34001478 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1094798606 12:34003464-34003486 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1095111076 12:38295547-38295569 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1095111358 12:38297551-38297573 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1095122737 12:38438212-38438234 ATAAAGAAAAAGAGGGTTAATGG + Intergenic
1095340968 12:41087747-41087769 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
1095791897 12:46176549-46176571 TTGAAGAACTGGATGTTTACAGG + Intergenic
1096861690 12:54533387-54533409 AGGAAGAAAGGGATGGTTGAAGG - Intronic
1097960851 12:65530671-65530693 TTAAAGAAAAGGATGGTCCTTGG + Intergenic
1098823368 12:75261462-75261484 GTGCAGAAAAGGATTGTGAAAGG - Intergenic
1098995155 12:77110709-77110731 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1099352458 12:81590817-81590839 GGGAAGAAAAAGATGTTTAAAGG - Intronic
1099616136 12:84938295-84938317 TTTAAGAAAAGGAAAGTTAAAGG + Intergenic
1099696276 12:86024155-86024177 TGGAAAGAAGGGATGGTTAATGG - Intronic
1099826287 12:87781034-87781056 ATGAAGAAAAGGAGGTTTAATGG + Intergenic
1100125425 12:91418992-91419014 TTTAAGAAATTTATGGTTAAGGG - Intergenic
1100702642 12:97164363-97164385 TGAAAGAAAAGCAGGGTTAAAGG + Intergenic
1100710473 12:97250930-97250952 TTCAAGAAGAGGATGGGGAATGG - Intergenic
1101071719 12:101082337-101082359 ATAAAGAAAAAGAGGGTTAATGG - Intronic
1101678052 12:106937675-106937697 TTGATGAAATGGATGATTCAAGG + Intergenic
1101724750 12:107379551-107379573 ATAAAGAAAAGGAGGTTTAATGG - Intronic
1103086649 12:118066620-118066642 CTGAAGAAGAGGATGGTCCATGG - Exonic
1103127955 12:118440842-118440864 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1104119028 12:125780241-125780263 ATGAAGAAAAGGATGCTTAGAGG - Intergenic
1104730066 12:131100251-131100273 TTGAAGGTAAGGTTGGTTGATGG + Intronic
1105576334 13:21656544-21656566 ATAAAGAAAAGGAGGCTTAATGG + Intergenic
1107964060 13:45583834-45583856 ATAAAGAAAAAGATGTTTAATGG - Intronic
1108179167 13:47823839-47823861 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1108252444 13:48580812-48580834 TTAAAAAAAAGGAGGTTTAATGG + Intergenic
1108897350 13:55349036-55349058 TTGGAAAAAATGATGGTCAAAGG + Intergenic
1108932740 13:55849041-55849063 TTGAAGAGAAGGCTGATTCAAGG + Intergenic
1109102237 13:58199773-58199795 ATGAAGAAAAAGAAGTTTAATGG - Intergenic
1109391707 13:61703415-61703437 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1110018371 13:70437715-70437737 ATGAAGAAATGGAAGGCTAAAGG - Intergenic
1110049041 13:70871926-70871948 ATGAAGAAAAAGAGGCTTAATGG + Intergenic
1110176911 13:72568070-72568092 TTAAAGAAAAGAAAGGTTAAGGG - Intergenic
1110335511 13:74325614-74325636 TTGATGAAAAAAATGGTTAAAGG + Intergenic
1111166285 13:84461808-84461830 ATAAAGAAAAGGACGCTTAATGG + Intergenic
1111410769 13:87873779-87873801 TTGAAAAAAATGTTGGTTAGAGG + Intergenic
1111816747 13:93163428-93163450 ATAAAGAAAAGGAAGTTTAATGG + Intergenic
1111854611 13:93621984-93622006 TGGAAAAAGAGGTTGGTTAATGG - Intronic
1112119410 13:96393190-96393212 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1112817731 13:103292599-103292621 TTCAAGGAAAGGATGTTCAAAGG + Intergenic
1113514397 13:110881453-110881475 TAAAAAAAAAGGATGATTAATGG - Intronic
1113901059 13:113798357-113798379 ATGAATAGAAGGATGGATAATGG + Intronic
1114033016 14:18592322-18592344 TGGAAGAATAGTAGGGTTAAGGG + Intergenic
1114077812 14:19171519-19171541 TGGAAGAATAGTAGGGTTAAGGG + Intergenic
1114285153 14:21234769-21234791 TTGAAGAAAATTATACTTAATGG - Intronic
1114941838 14:27622864-27622886 ATAAAGAAAAAGATGCTTAATGG + Intergenic
1115883215 14:37944185-37944207 ATAAAGAAAAGGAGGTTTAATGG + Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116452097 14:45078333-45078355 GTGGAAAAAAGGATGGGTAAAGG - Intergenic
1117871936 14:60210406-60210428 ATGAAGAAAAAGAAGTTTAATGG + Intergenic
1117918699 14:60705350-60705372 TGGGAGAGAAGGATGGATAAGGG - Intergenic
1117964221 14:61190261-61190283 TTTAAGAAAAGTTTGGTTAATGG + Intronic
1118188795 14:63561305-63561327 TTGAAGAAAAGGAAGGTAAGTGG + Intergenic
1118276990 14:64394146-64394168 TTGAAGAAGTGGGTGGCTAAAGG + Intronic
1118520571 14:66578838-66578860 TGAAAGAAAAGGATGGTAATTGG + Intronic
1118642806 14:67807932-67807954 ATGAAGAAAAGGATGGGTGGTGG + Intronic
1120005622 14:79354500-79354522 TTGCACAAAAGGCTGGATAAAGG - Intronic
1120442352 14:84557202-84557224 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1120485987 14:85113632-85113654 ATAAAGAAAAAGAGGGTTAATGG + Intergenic
1121059929 14:90897506-90897528 TTGAAGAAAAGACTGGATACAGG + Intronic
1123501357 15:20884703-20884725 TTGAAGAAAAGCATGTTCGAGGG + Intergenic
1123558610 15:21458408-21458430 TTGAAGAAAAGCATGTTCGAGGG + Intergenic
1123594839 15:21895683-21895705 TTGAAGAAAAGCATGTTCGAGGG + Intergenic
1124017796 15:25892586-25892608 TTGAGGAAGAGGATCGTGAATGG + Intergenic
1125146061 15:36470011-36470033 TTGAAGAAAAAGATTGAAAAGGG - Intergenic
1125335183 15:38619686-38619708 TTTAAGAAAAGGATGGATTGAGG + Intergenic
1126103248 15:45132179-45132201 TTGAAGAAATAGATGGATAATGG + Intronic
1126737662 15:51748290-51748312 ATGAAGAAAATGAGGCTTAAGGG + Intronic
1126933774 15:53684145-53684167 TTGCAGAAAATCATTGTTAAAGG - Intronic
1127007277 15:54584514-54584536 TTAAAGAAAATGATGTTGAAAGG + Intronic
1127200737 15:56647228-56647250 ATGGAGAAAAGGTTGGTTTAGGG + Intronic
1127850725 15:62909785-62909807 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1130759396 15:86802842-86802864 TTGGAGCAAAGAAAGGTTAAGGG - Intronic
1130803107 15:87287517-87287539 GTTAAGAAAGGGATGCTTAAGGG - Intergenic
1130821686 15:87502787-87502809 TTGCAGAAAAGGAGGAATAATGG + Intergenic
1131619759 15:94055114-94055136 ATTAAGAAAAAGATGTTTAATGG - Intergenic
1132014466 15:98303501-98303523 ATGAAGAAAAAGAGGCTTAATGG + Intergenic
1132302193 15:100782858-100782880 TGGAAGATAAGGGTTGTTAAAGG + Intergenic
1202966958 15_KI270727v1_random:185561-185583 TTGAAGAAAAGCATGTTCGAGGG + Intergenic
1133382275 16:5341328-5341350 TTGAAGAATAGGTTGGTGAGAGG + Intergenic
1133580233 16:7137559-7137581 ATAAAGAAAAGGAGGTTTAATGG - Intronic
1133752536 16:8735993-8736015 ATGAAGAAAAAGAGGTTTAATGG + Intronic
1134236798 16:12472766-12472788 TGGAGGTAAAGGAAGGTTAAGGG - Intronic
1135018457 16:18943802-18943824 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1136367422 16:29815167-29815189 TTGGAGAAGAGGATGCTTAAGGG - Intronic
1137686829 16:50392206-50392228 TTAAAGAAAAAGAGGCTTAATGG + Intergenic
1138011112 16:53380973-53380995 TTGAAGAAATGGAAGGAGAAAGG - Intergenic
1138825726 16:60317139-60317161 TTGAATGAAAGCATGGTTGAAGG - Intergenic
1139175568 16:64683193-64683215 GGGAAGAAAAGGAGGTTTAATGG + Intergenic
1139304830 16:65976197-65976219 TTGAGGAACAGAATGGTTAATGG - Intergenic
1139430146 16:66906817-66906839 TTGAAGATCAGGGAGGTTAAGGG - Intergenic
1140157586 16:72448700-72448722 TGGAAGGTGAGGATGGTTAATGG - Intergenic
1140690070 16:77473808-77473830 GTGAAGAAGAGGATGGGTAAAGG + Intergenic
1141314684 16:82950634-82950656 ATAAAGAAAAAGATGTTTAATGG - Intronic
1143401282 17:6645462-6645484 TTGGAGAAAAGGGTGATTCAGGG + Intronic
1143816775 17:9522788-9522810 GGGAAGGAAAGGTTGGTTAAGGG + Intronic
1144392852 17:14812265-14812287 TTGAAGAAAAGAAGGGTCAGGGG - Intergenic
1146130883 17:30274030-30274052 TGGAAGATAAGGTTGGTGAATGG - Exonic
1146452127 17:32982910-32982932 TTAAAGAAAAAGAGGTTTAATGG + Intronic
1149778757 17:59379360-59379382 TTGGAGAAAAGAATGGAAAAAGG + Intronic
1150453535 17:65288946-65288968 AGGAAGAAAAGGATAGTGAAGGG - Intergenic
1150496719 17:65613480-65613502 TTTAAGAAAAGCATGGCTGAAGG + Intronic
1150739125 17:67765404-67765426 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1150928907 17:69563477-69563499 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1151218759 17:72595822-72595844 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1152159689 17:78659813-78659835 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1153134548 18:1899683-1899705 TTTATGAAAAGGATGGCTAAAGG + Intergenic
1153538009 18:6123597-6123619 ATAAAGAAAAGGAGGTTTAATGG - Intronic
1153676309 18:7458692-7458714 TTGATGAAAGGGTTGGTTGAGGG + Intergenic
1153678669 18:7479138-7479160 ATGAGGAAAAGGATAGGTAAGGG - Intergenic
1154482658 18:14850188-14850210 TTTAAGATAAGTATGTTTAATGG + Intronic
1155141250 18:23046674-23046696 TTGAAGAAAATCATGGAAAATGG - Intergenic
1155298227 18:24405015-24405037 TTGAAGAGAAGGACTGTTATTGG - Intergenic
1155812354 18:30253055-30253077 TCTAGGAAAAGGATGGTTCAGGG + Intergenic
1157608838 18:48943351-48943373 TTGAAGAGAAGTCTAGTTAAGGG - Intronic
1158045325 18:53148550-53148572 TTGATGAGAAAGATGATTAAAGG + Intronic
1158554901 18:58466907-58466929 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
1158855575 18:61540402-61540424 ATAAAGAAAAAGAAGGTTAATGG + Intronic
1158904812 18:62001520-62001542 TAGAAGAAAAGAATGGTTTCAGG - Intergenic
1160142087 18:76334294-76334316 CTTAAGAAAAGAATGGATAAAGG + Intergenic
1162274788 19:9644515-9644537 ATGAAGAAAAAGAGGTTTAATGG + Intronic
1162872667 19:13598254-13598276 TTGAGGAAAAGGAAAGTAAAGGG + Intronic
1164419368 19:28075311-28075333 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1164446216 19:28319593-28319615 TTGCAGGAAAGGATTTTTAAAGG + Intergenic
1164892867 19:31839892-31839914 CTGAAGAAAAAGAGGTTTAATGG + Intergenic
1165344757 19:35237865-35237887 CTAAAGAAAAAGATGTTTAATGG - Intergenic
1166657937 19:44625997-44626019 TTAAAAAAAAGGAGGTTTAATGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167223880 19:48223344-48223366 ATGAAGAAAAGGATGGCCCATGG + Intronic
1168587137 19:57602738-57602760 GGGAAGAAAAAGAGGGTTAATGG + Intronic
924966170 2:78296-78318 ATAAAGAAAAAGATGTTTAATGG + Intergenic
925097332 2:1217753-1217775 GTGAAGAAAAGCATTGTTGATGG + Intronic
925100596 2:1241630-1241652 TTGATGATAAGGAGGATTAAGGG - Intronic
925124187 2:1442151-1442173 GAGAAGAAAAGGAGGTTTAATGG - Intronic
925211346 2:2049868-2049890 ATGAAGAAAAAGAGGTTTAATGG - Intronic
926380207 2:12279389-12279411 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
926497798 2:13613532-13613554 TATAAAATAAGGATGGTTAATGG - Intergenic
926929449 2:18022787-18022809 TTGAAGAAAAAGAGGTTTAATGG + Intronic
927063483 2:19446207-19446229 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
927294193 2:21434671-21434693 TGGAAGAAAAAGAGGTTTAATGG - Intergenic
928012807 2:27626760-27626782 TTAAAGAAAAAGCTAGTTAAGGG + Intronic
928081698 2:28317816-28317838 GTGAAGAAAAGGCTGGGAAAAGG - Intronic
928738237 2:34318522-34318544 TGGAAGAACAGGATGGAAAAGGG - Intergenic
928874847 2:36025963-36025985 TAGTTGAAAAGGAAGGTTAATGG + Intergenic
929644955 2:43617251-43617273 TTGAAGAAAAACATTGCTAAGGG + Intergenic
930317952 2:49820478-49820500 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
930535086 2:52635966-52635988 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
930540884 2:52705179-52705201 GTAAAGAAAAGGAGGTTTAATGG + Intergenic
931101065 2:59001598-59001620 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
931549690 2:63429021-63429043 TTGAAGAACAAGATGGTTGTAGG - Intronic
931704964 2:64939642-64939664 TTGAAGAAAATGATGATAATTGG - Intergenic
933332679 2:80914309-80914331 TAGAAGGTGAGGATGGTTAATGG - Intergenic
933874009 2:86600373-86600395 TTGAAGAAATGGCTGATTACAGG + Intronic
935100862 2:99994692-99994714 TGAAAGAAAATGATGGTTTAAGG + Intronic
935957559 2:108393006-108393028 AGGAAGAAGGGGATGGTTAATGG - Intergenic
937573375 2:123391101-123391123 TTAAAGAAAAAGAGGTTTAACGG + Intergenic
938686654 2:133744354-133744376 TTGAAGAAATTGAGGCTTAAGGG + Intergenic
939466979 2:142569652-142569674 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
939879673 2:147615698-147615720 TTGATGAGAATGATGGTAAACGG + Intergenic
940164896 2:150760184-150760206 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
940359213 2:152779435-152779457 TTGAAGTTAAGTATGGTTTAAGG - Intergenic
940886838 2:158997543-158997565 TTGAAGAAATGGATAATTATAGG + Intronic
941040135 2:160612137-160612159 TTGAAGGGGAGGATGGTTAAAGG + Intergenic
941041650 2:160629781-160629803 CTGCAGAAAACAATGGTTAAAGG - Intergenic
941375304 2:164721514-164721536 TTGAAGATAAGGGTGCATAAAGG + Intronic
942118011 2:172748334-172748356 ATGAAGAAAAAGAGGTTTAATGG + Intronic
942234484 2:173890608-173890630 ATAAAGAAAAAGATGTTTAATGG - Intergenic
942834027 2:180271066-180271088 TGGAAGTTGAGGATGGTTAATGG - Intergenic
942980249 2:182071955-182071977 TTGGAGAAAAGGCTGGTTCTAGG - Intronic
943156699 2:184188462-184188484 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
943267743 2:185757267-185757289 TTTCAGGAAAGGATGGTCAATGG + Intronic
943296006 2:186140050-186140072 TTGAACAACATGAGGGTTAAGGG + Intergenic
943462976 2:188192619-188192641 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
943825596 2:192387288-192387310 TGGAAGAAAAAGAGGTTTAATGG + Intergenic
943942340 2:194014403-194014425 ATAAAGAAAAAGATGCTTAAGGG - Intergenic
944818249 2:203401803-203401825 TAGCAAAAAAGTATGGTTAAAGG - Intronic
944880316 2:204006754-204006776 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
945541705 2:211095878-211095900 ATGAAGAAATGGCTGGTTGACGG - Intergenic
946085272 2:217164250-217164272 TCCAGGAAAAGGATGATTAATGG - Intergenic
946217541 2:218196964-218196986 TTTAAGAAAAGAATGGTGCACGG + Intergenic
946264024 2:218522724-218522746 ATGAAGAAAAGGATTACTAAGGG - Intronic
946480777 2:220054531-220054553 TTGAAGGAAAAGATTGTAAATGG + Intergenic
946505389 2:220294909-220294931 ATAAAGAAAAAGATGTTTAATGG - Intergenic
946807066 2:223481468-223481490 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
947139162 2:227004986-227005008 GTGAAGAAAATAATGGTTTAAGG + Exonic
947156755 2:227170383-227170405 ATGAAGAAAAAGAGGTTTAATGG + Intronic
947183427 2:227432693-227432715 TAGGAGAAAAGAATGGTTATGGG - Intergenic
948071203 2:235127921-235127943 ATAAAGAAAAGGAAGTTTAATGG + Intergenic
948243652 2:236460161-236460183 TTGAAGTAATGGAAGGTCAAGGG - Intronic
1169499169 20:6142620-6142642 TGGAAGATAAGGAGGGTTATAGG - Intergenic
1169573587 20:6932732-6932754 TTGAGGAAAAGGATAGATAAAGG + Intergenic
1170015656 20:11778912-11778934 GAGAGGAAATGGATGGTTAAAGG + Intergenic
1170421996 20:16202346-16202368 TGGAAAAAAAGGATGGTACATGG + Intergenic
1170508430 20:17052988-17053010 ATGAAGAAAAAGATGTTTAATGG + Intergenic
1170527772 20:17258222-17258244 ATGAAGAAGAGGATGGTCATAGG + Intronic
1170721427 20:18883222-18883244 GAGAGGAAAAGGATGGTTGAGGG - Intergenic
1170843085 20:19939748-19939770 TAGAAGAAAAGGAGGGCTCAAGG - Intronic
1171031395 20:21680218-21680240 TAGAAGAATAGGCTGGTTTATGG + Intergenic
1173674907 20:44825215-44825237 ATGAAGAAAAGGAGGTTTAATGG + Intergenic
1174181638 20:48678793-48678815 ATAAAGAAAAGGAGGTTTAATGG - Intronic
1175033036 20:55974160-55974182 TTGCAGGAAAGGATTTTTAAAGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175587752 20:60158824-60158846 TTGAACAAAATAATGATTAATGG + Intergenic
1175680155 20:60981066-60981088 TTGGGGGGAAGGATGGTTAATGG + Intergenic
1175830675 20:61963898-61963920 ATGAAGAAAAAGAGGTTTAATGG + Intronic
1176223754 20:63982525-63982547 TTGAAGTAGAGGAAGGCTAAAGG + Intronic
1176658025 21:9605413-9605435 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1176797942 21:13386449-13386471 TTTAAGATAAGTATGTTTAATGG - Intergenic
1176989330 21:15476145-15476167 TTGCAAAAAAGTATGATTAAAGG - Intergenic
1177369623 21:20184803-20184825 CTGAAGAAAATTAAGGTTAAAGG - Intergenic
1179245877 21:39633860-39633882 TTGAAGAAACGGAGGCTTAGTGG + Intronic
1179398212 21:41060446-41060468 ATAAAGAAAAGGAGGCTTAATGG + Intergenic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1180457131 22:15519377-15519399 TGGAAGAATAGTAGGGTTAAGGG + Intergenic
1181130436 22:20728437-20728459 TTTAAGACAAGGATGGTGAAAGG - Intronic
1181924197 22:26345080-26345102 CTGAAGAACAGGAAGGTTATAGG + Intronic
1181967330 22:26666423-26666445 TTGAAGCAATGGATGGGAAATGG - Intergenic
1182039527 22:27225709-27225731 TTGGAGAAATGGATGGTTTAAGG - Intergenic
1182174009 22:28264350-28264372 ATAAAGAAAAGGAGGTTTAATGG - Intronic
949136195 3:569284-569306 TTGAAGAAAAGGAAGTTATATGG - Intergenic
949667088 3:6352174-6352196 TGGCAGAAAATGATGGTTATTGG - Intergenic
949696801 3:6706612-6706634 TGGAAGAAAAGGAAGGTTTTAGG - Intergenic
950149517 3:10675840-10675862 GTGAAGAAAAGGGTGGGGAAAGG - Intronic
950233460 3:11296790-11296812 ATGTTGAAAAGGATGGGTAAGGG - Intronic
950863344 3:16169727-16169749 GGGAAGAAAAAGATGTTTAATGG - Intergenic
951069839 3:18314570-18314592 TGGAAGATAGGGATGATTAATGG - Intronic
953502087 3:43446526-43446548 TTGAAGAAAATACTGGTTTATGG + Intronic
955061685 3:55497856-55497878 TGGAAGAAAAGGATGGAGAAGGG + Intergenic
955869178 3:63418567-63418589 ATGAAGAAAAAGAGGTTTAATGG + Intronic
956147028 3:66200477-66200499 TTTAAGAAAATGATGCTAAAAGG - Intronic
956654917 3:71540058-71540080 TTGAAGAAATGAATATTTAAGGG - Intronic
957224519 3:77426294-77426316 TTGAACAACAGGATGGATAAAGG + Intronic
957274279 3:78069992-78070014 TTGAATGAAAGAATGCTTAAAGG + Intergenic
957358489 3:79122738-79122760 TTGAAAAAAAGGATAATTAGGGG + Intronic
957857043 3:85892665-85892687 ATAAAGAAAAAGAGGGTTAATGG - Intronic
958029610 3:88091870-88091892 ATGAAGAAAAAGAGGTTTAATGG - Intronic
959873323 3:111353007-111353029 ATAAAGAAAAAGATGTTTAATGG - Intronic
960091552 3:113644934-113644956 TTGTAGAAAATGATAATTAAAGG - Intergenic
960146787 3:114212286-114212308 TTGAAGAAGATGTTGGCTAATGG - Intergenic
960263973 3:115599166-115599188 ATAAAGAAAAAGATGTTTAATGG + Intergenic
960696027 3:120397273-120397295 ATGAAGAAAATGATGTTAAATGG + Intronic
960973459 3:123155265-123155287 TGGAGGAGAGGGATGGTTAAAGG + Intronic
961022293 3:123518376-123518398 TGGAAGAAAAGCATGGTGACTGG - Intronic
962152268 3:132905207-132905229 CTGAAGGACAGGATAGTTAAAGG + Intergenic
962331449 3:134482620-134482642 TTGAAGAAAAATGTGGTTCAGGG - Intronic
962371677 3:134825791-134825813 AGGAAGAAAAGGATCGTGAAAGG - Intronic
962442878 3:135439133-135439155 TTAAAGAAAAGAATGGTCAGGGG + Intergenic
962884154 3:139608137-139608159 TGGAAGACAAAGATGGTTACTGG + Intronic
963036379 3:141033280-141033302 TTGAAGAAATGGTTGATTCAAGG - Intergenic
963261258 3:143193231-143193253 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
963577787 3:147083821-147083843 CTGAAGAAAAGAATGGATAGTGG - Intergenic
963614624 3:147520291-147520313 TTGGAGGGAGGGATGGTTAACGG - Intergenic
964284159 3:155099392-155099414 TTGAAGAAATGTAAGATTAAAGG - Intronic
964420422 3:156496520-156496542 ATAAAGAAAAGGAGGTTTAATGG - Intronic
964420912 3:156501800-156501822 GGGAAGAAAAAGATGTTTAATGG + Intronic
964832565 3:160901387-160901409 TTGAAGAAATGGATGCTGACTGG - Intronic
964836953 3:160949624-160949646 TGGCAGAAAAGGATGGGGAATGG - Intronic
964986626 3:162749296-162749318 CTGAAAAAAAGGATGGAAAAAGG - Intergenic
965024949 3:163290740-163290762 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
966491640 3:180533796-180533818 AGGAAGGTAAGGATGGTTAATGG + Intergenic
966889930 3:184399477-184399499 TTAGAGAAAGGGATGGATAACGG + Intronic
967449743 3:189610800-189610822 GTGAAGAAAAAGATGTTTCATGG + Intergenic
968392119 4:202279-202301 ATAAAGAAAAAGATGTTTAATGG - Intergenic
968795651 4:2702400-2702422 TTGGAGAAATGGCTGGTTCAGGG - Intronic
969003008 4:3997394-3997416 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
970099043 4:12499729-12499751 TTGGAGAAACAGATAGTTAATGG - Intergenic
970737015 4:19183279-19183301 TTGTGGAAAAGCATGGTAAATGG + Intergenic
970855447 4:20645900-20645922 TTGGAGCTGAGGATGGTTAATGG - Intergenic
970977534 4:22058261-22058283 AGGAAGAAAAAGAGGGTTAATGG - Intergenic
971036655 4:22700749-22700771 ATAAAGAAAAGGAAGTTTAATGG - Intergenic
971099099 4:23442682-23442704 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
971443550 4:26717074-26717096 TTGGAAAAAAGGATAGGTAATGG - Intronic
971746575 4:30587842-30587864 TTGAAAAAAAGGGTCATTAAGGG + Intergenic
971976261 4:33692122-33692144 ATGAAGAAAATGATTTTTAATGG + Intergenic
972119781 4:35685967-35685989 TTGAAGAAGAGGATGCAAAAAGG - Intergenic
973841567 4:54866429-54866451 TTAAAGAAATGGCTGGTTAATGG - Intergenic
974062424 4:57047367-57047389 TATAAGAAAAAGATGGTTAATGG - Intronic
974106568 4:57476339-57476361 TTGAAGAGATGGAGAGTTAAAGG - Intergenic
974551007 4:63374603-63374625 ATGAAGAAAAGGAAGTTTAATGG + Intergenic
974925291 4:68291345-68291367 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
975222970 4:71835099-71835121 TAGGAGAAAAGGATTGTTAAAGG - Intergenic
975525842 4:75350072-75350094 ATGAAGAAAAAGAGGCTTAAAGG - Intergenic
976051675 4:81017506-81017528 GGGAAGAAAAAGATGTTTAATGG + Intergenic
976680620 4:87752513-87752535 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
976749938 4:88443701-88443723 CATAAGAAAAGGAGGGTTAAAGG - Intergenic
977070412 4:92377634-92377656 GTGAAGAAAAAGAAGTTTAATGG + Intronic
977316844 4:95460661-95460683 ATGAAGAAAAAGACGTTTAATGG - Intronic
977874107 4:102129177-102129199 TAGGAGAAAAGAATGGTTTAGGG + Intergenic
978726063 4:111970997-111971019 TGGAAGAAAAGGATGGTGTGGGG - Intergenic
980954744 4:139416819-139416841 TTGAAGAAAGGCATCGATAAGGG - Intronic
981434735 4:144707239-144707261 TGGAAGAAATGGATGGGTTAAGG + Exonic
982079711 4:151777454-151777476 TTGCAGAAAAGGATACTTTATGG - Intergenic
982133289 4:152248942-152248964 TAAAAGAAAGTGATGGTTAATGG - Intergenic
982460313 4:155662239-155662261 TTCAAGAAAAAGAGGTTTAAGGG + Intergenic
982957982 4:161794630-161794652 TTTAGGAAAAGGATGTTAAAGGG - Intronic
983095069 4:163551889-163551911 ATGAAGAAAAAGAGGTTTAATGG - Intronic
983141808 4:164158832-164158854 TTGAAGAAAAGGAAGAATAGAGG - Intronic
984318677 4:178162229-178162251 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
984678392 4:182577535-182577557 TTGAAGAAATGAATGTCTAAAGG + Intronic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985171635 4:187156143-187156165 GGGAAGAAAAAGATGTTTAATGG - Intergenic
985417386 4:189750660-189750682 ATAAAGAAAAAGATGTTTAATGG + Intergenic
986069474 5:4268144-4268166 TTGCAGAACAAGATGGTCAATGG + Intergenic
986069517 5:4268544-4268566 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
987213898 5:15713115-15713137 ATGAAGAAAAAGAGGTTTAAGGG + Intronic
987500021 5:18697802-18697824 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
987581152 5:19794341-19794363 TAGAAGAAAAAGATGGAGAAAGG + Intronic
987817546 5:22922563-22922585 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
988045459 5:25945781-25945803 TTGAAAAAAAAAATGGTGAAAGG + Intergenic
988834474 5:35017618-35017640 TTTAAGAAAAAGAGGTTTAAAGG - Intronic
989110038 5:37898469-37898491 TTGAAGAAATGGCTGATTCAAGG - Intergenic
989343746 5:40406332-40406354 TTGAAGAAAAAGAGAGTTTAAGG + Intergenic
990046205 5:51434780-51434802 GTGAGGAAAAGGATGATGAAGGG - Intergenic
990137349 5:52662395-52662417 TTCCAGAAAAGGATGTTTACTGG + Intergenic
990397604 5:55399438-55399460 TTAAAGAAAAACATGATTAATGG - Intronic
990452596 5:55950039-55950061 TTGAAGAAAATGATGATGAAAGG + Intronic
990745256 5:58952454-58952476 ATGAAGTAGAGGTTGGTTAATGG + Intergenic
992168572 5:74078807-74078829 TTGAAGAAAAAAATGGGAAAAGG - Intergenic
992604791 5:78444275-78444297 ATAAAGAAAAAGATGTTTAATGG + Intronic
992883459 5:81133317-81133339 CTGAAACAAAGGATGGTTGATGG + Intronic
993683067 5:90903882-90903904 AGAAAGGAAAGGATGGTTAATGG - Intronic
994084159 5:95740216-95740238 ATAAAGAAAAGGAAGTTTAATGG - Intronic
994191018 5:96869535-96869557 TTATAGAAAAGGATGGTAGAAGG + Intronic
994243895 5:97456488-97456510 TCAAAGAAAAGTATAGTTAAGGG - Intergenic
994631087 5:102288727-102288749 CTGGAGAAAAATATGGTTAAGGG - Intronic
994986198 5:106936760-106936782 TAGAACAAAAGGATGAATAAGGG + Intergenic
995120427 5:108530806-108530828 TTAAAGAAAAGGAGGTTTAAAGG + Intergenic
995327002 5:110901869-110901891 ATGGAGAAAAGGATGTTCAATGG - Intergenic
995371325 5:111422028-111422050 TATAAGAAAAAGATGTTTAATGG - Intronic
996264609 5:121522992-121523014 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
996351714 5:122550635-122550657 TTCTGGAAAAGGATGATTAATGG + Intergenic
996883680 5:128330485-128330507 TTGAAGAAAATTATAATTAAAGG - Intronic
996929344 5:128867277-128867299 GGGAAGAAAAAGAGGGTTAATGG - Intronic
997720154 5:136071626-136071648 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
998981727 5:147711457-147711479 TTAAAGAAAAGGAAGGCAAAGGG + Intronic
999050813 5:148522207-148522229 ATAAAGAAAAGGAGGCTTAATGG - Intronic
999370612 5:151052816-151052838 GTGAACAAGAGGATGGTTAGGGG - Intronic
999412185 5:151360486-151360508 AGGAGGAAAAGGAGGGTTAATGG + Intergenic
1000238950 5:159391139-159391161 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1003107612 6:3227944-3227966 GTGAAGAAAAGGAGGGTGAGAGG + Intronic
1003348354 6:5292519-5292541 TTGAAGAGAAGGAAGACTAAAGG + Intronic
1003440562 6:6137458-6137480 GTGGAGATAAGGATGGTGAAAGG + Intergenic
1003779040 6:9402600-9402622 TTGAAGAAAAACATGATAAAGGG + Intergenic
1004245463 6:13971408-13971430 ATAAAGAAAAAGAGGGTTAATGG - Intronic
1004676196 6:17845018-17845040 TTAAAGAAAAAGAGGTTTAATGG + Intronic
1004920853 6:20374125-20374147 TTGATGAAATGAATGGTAAATGG + Intergenic
1004927070 6:20426231-20426253 TTGAAGAAAAGGTAAATTAAAGG - Intronic
1005085514 6:22002644-22002666 TTAAAGAAAAGGACCATTAATGG - Intergenic
1007051436 6:38835089-38835111 GTGTAGAAAAAGATGGTGAATGG - Intronic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1008828309 6:55726724-55726746 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1008923095 6:56863205-56863227 ATGAGGAAAAGGATGAATAAAGG - Intronic
1009399756 6:63240442-63240464 ATGAAGACAAGACTGGTTAAAGG + Intergenic
1010402874 6:75467031-75467053 TTCATGAACAGGATAGTTAAAGG - Intronic
1010489534 6:76458714-76458736 TTTAAAAAAAAGATGGTTCATGG - Intergenic
1010626783 6:78146332-78146354 TTGGAGATCGGGATGGTTAATGG + Intergenic
1010645958 6:78387775-78387797 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1010825696 6:80471119-80471141 TTGTAGCAAAGACTGGTTAAAGG + Intergenic
1011598419 6:89038170-89038192 ATGAAGAAAAAGAGGTTTAAAGG + Intergenic
1011875211 6:91951000-91951022 TTCAAGAAAAGGATGGGGAGTGG + Intergenic
1012556915 6:100524791-100524813 TTGAAGAGGAGGAAGGATAAAGG - Intronic
1012756553 6:103239537-103239559 TTACAGAAAAGGAGGTTTAATGG - Intergenic
1013014889 6:106151980-106152002 ATGAAGAAAAAGAAGCTTAATGG - Intergenic
1013197849 6:107861432-107861454 TTGAGGAAAAAGAGGTTTAATGG + Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1013698586 6:112734251-112734273 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1014143460 6:117970611-117970633 ATAAAGAAAAGGAGGTTTAATGG + Intronic
1014541837 6:122685768-122685790 TGGTAGTAAAGGATGGTTAATGG - Intronic
1014768519 6:125434807-125434829 TTGAAGAAAAGTATGGGTAAAGG + Intergenic
1014780617 6:125560506-125560528 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1014830046 6:126092279-126092301 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1015056924 6:128914055-128914077 TTGAGGAAAAAAATGGATAAGGG - Intronic
1015471270 6:133609556-133609578 TTGAAGAGAAGGAAGATCAATGG + Intergenic
1015846499 6:137525622-137525644 TTGAACAAAAGGAGGTTGAAAGG - Intergenic
1018626803 6:165787652-165787674 AAGAAAAAAATGATGGTTAAAGG - Intronic
1018674205 6:166205188-166205210 GTGAGGAAGAGGATGGGTAACGG - Intergenic
1019288719 7:236673-236695 ATGATGATAAGGATGGTTGATGG + Intronic
1020218191 7:6212055-6212077 GGGGAGATAAGGATGGTTAATGG - Intronic
1020653046 7:10898048-10898070 GAGTATAAAAGGATGGTTAACGG + Intergenic
1021130107 7:16901050-16901072 TATAAGAAGAGGAAGGTTAAAGG - Intergenic
1021458055 7:20851070-20851092 TTGAGGAAAAGAGTGGTTACAGG + Intergenic
1021641498 7:22742044-22742066 GGGCAGAAAAGGATGGTTAATGG + Intergenic
1021775735 7:24053564-24053586 CTGAAGAAAGAGATGGGTAAAGG - Intergenic
1022399473 7:30023638-30023660 ATAAAGAAAAGGAGGTTTAATGG + Intronic
1023274170 7:38499999-38500021 ATAAAGAAAAAGAGGGTTAATGG - Intronic
1023293898 7:38695047-38695069 ATAAAGAAAAAGAAGGTTAATGG + Intergenic
1023890102 7:44385886-44385908 TTGAAAGAAAGGATGGCTAGGGG + Exonic
1024169078 7:46765635-46765657 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1024369428 7:48563346-48563368 CTGAAGAAAGAGAGGGTTAAAGG + Intronic
1025465512 7:60697622-60697644 TTTATGAAAAGAAAGGTTAAAGG - Intergenic
1025568152 7:62515995-62516017 TTTATGAAAAGAAAGGTTAAAGG - Intergenic
1026330788 7:69350954-69350976 ATAAAGAAAAAGAGGGTTAATGG + Intergenic
1026483458 7:70798169-70798191 TTGAAGTAGAGGATGGTTTGGGG - Intergenic
1026502477 7:70954720-70954742 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
1026583752 7:71638955-71638977 GGGGAGATAAGGATGGTTAATGG + Intronic
1026677004 7:72436442-72436464 ATAAAGAAAAAGATGTTTAATGG - Intronic
1027441304 7:78221866-78221888 TTAAACAAAAGGATCGTTTAAGG - Intronic
1027500315 7:78941837-78941859 TTGAAGAAAAGGAGGGGTAGGGG - Intronic
1027581410 7:80001028-80001050 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1027687643 7:81296799-81296821 GGGAAGAAAAGGAGGTTTAATGG - Intergenic
1027838444 7:83277320-83277342 TTGAAGACAAGGCTTTTTAATGG - Intergenic
1027967532 7:85031564-85031586 TAGAACAAAAGGTAGGTTAATGG + Intronic
1027989632 7:85341233-85341255 ATAAAGAAAGGGTTGGTTAATGG - Intergenic
1028125994 7:87114173-87114195 GTGAAGAAAAAGAAGTTTAATGG - Intergenic
1028388139 7:90283244-90283266 TTGAAGAAATAAATGCTTAAAGG - Intronic
1028679298 7:93507048-93507070 ATAAAGAAAAAGATGCTTAATGG - Intronic
1029099572 7:98117613-98117635 TTGAAGAAAAGGCTGATTCTAGG - Intronic
1029129106 7:98316748-98316770 ATGAAGGAGAGGTTGGTTAATGG - Intronic
1029600424 7:101560028-101560050 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1030373949 7:108733081-108733103 TTGAAGAAAAGGATTCTGATAGG - Intergenic
1030791092 7:113729998-113730020 TTGAACAACTGGAGGGTTAAGGG - Intergenic
1030832457 7:114242469-114242491 TTGGAAAAAAGAATGGTTATGGG - Intronic
1031407784 7:121406679-121406701 TTGAAGAAATGGAAGGATATGGG + Intergenic
1031638278 7:124128996-124129018 TTTAAGAAAAGGAAGGGAAAGGG + Intergenic
1031925392 7:127633787-127633809 ATGAAGAAAAAGAGGCTTAATGG + Intergenic
1032107776 7:129049124-129049146 TTGAAGAAAGGGTTGGGAAAGGG + Intronic
1032349837 7:131151075-131151097 TTAAAGAAAAATATAGTTAACGG - Intronic
1032561300 7:132895783-132895805 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1032959295 7:137012358-137012380 TTGCAAAAAAGGATTGTCAAAGG + Intronic
1032988262 7:137362546-137362568 ATAAAGAAAAGGAGGTTTAAAGG + Intergenic
1033028437 7:137800587-137800609 TTGTAAAAAAAGATGTTTAATGG - Intronic
1033778644 7:144643485-144643507 ATGAAGACAAGCTTGGTTAAGGG - Intronic
1033898297 7:146103268-146103290 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1035090202 7:156304123-156304145 TTGGAGAAAAGGTTGATTTAAGG - Intergenic
1035196148 7:157222337-157222359 TTAAAGAAAAAAATGGTAAATGG - Intronic
1035413075 7:158661021-158661043 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1036053439 8:5225639-5225661 TTAAGGAAAAAGATGGTTAAGGG + Intergenic
1036094020 8:5703432-5703454 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
1036290091 8:7480043-7480065 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1036331385 8:7831480-7831502 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1036489516 8:9212023-9212045 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1037139820 8:15506515-15506537 GTAAAGAAAAGGAGGTTTAATGG + Intronic
1037310162 8:17547154-17547176 ATGAAGAAAAAGAGGTTTAATGG + Intronic
1037388170 8:18365124-18365146 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038159289 8:25021427-25021449 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1038845943 8:31229719-31229741 TTGGAGACAAGAATGGTTGAGGG + Intergenic
1039073446 8:33667080-33667102 GTGAAGAAAAAGAGGTTTAATGG + Intergenic
1039525500 8:38211771-38211793 TTTAAGAAAAGGATATTGAAAGG + Exonic
1040579669 8:48687465-48687487 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1040813570 8:51482813-51482835 ATAAAGAAAAGGAGGTTTAATGG - Intronic
1041681288 8:60595089-60595111 TTGCATAAAAGAATGGCTAAAGG + Intronic
1042008334 8:64208871-64208893 ATGCAGAAAGTGATGGTTAAGGG + Intergenic
1042332890 8:67599678-67599700 TTGAAGTAAAGAGTGTTTAAAGG + Intronic
1042477969 8:69270843-69270865 GTGATGAAAAAGATGGCTAAAGG + Intergenic
1042596521 8:70453710-70453732 TTAATGAAAAGGATGGAGAAAGG - Intergenic
1042853877 8:73244969-73244991 TTAAAGAAAAAGAGGTTTAATGG + Intronic
1043099328 8:76020555-76020577 TTGAAGAAATTGATTTTTAAAGG + Intergenic
1043297312 8:78682354-78682376 ATAAAGAAAAGGAGGTTTAAGGG + Intronic
1043336151 8:79179607-79179629 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1043505409 8:80897346-80897368 ATAAAGAAAAAGAGGGTTAATGG + Intergenic
1043731820 8:83693485-83693507 TTGAAGAAGAGGATGGCAGAGGG + Intergenic
1043777338 8:84286583-84286605 TTGTAGATAAGGAGGTTTAAAGG + Intronic
1044275162 8:90290769-90290791 TTGCAGAAGAAGATGATTAAAGG - Intergenic
1045369255 8:101505186-101505208 ATGAAGAAAAGGATGGGGGAGGG - Intronic
1045739811 8:105343925-105343947 ATAAAGAAAAGGAGGTTTAATGG + Intronic
1045756122 8:105544597-105544619 CTGAAGAAAAGGAGGTCTAATGG + Intronic
1045820740 8:106335065-106335087 ATTAGGACAAGGATGGTTAAAGG - Intronic
1046279251 8:112003876-112003898 GGGGAGATAAGGATGGTTAATGG - Intergenic
1046304455 8:112345589-112345611 ATTAAGAAAATGTTGGTTAAAGG + Intronic
1046407812 8:113797701-113797723 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1046585117 8:116141236-116141258 TTAAAGAAAAAGATGTTTAATGG - Intergenic
1046640087 8:116720453-116720475 TTGAAGAAAAAGAGATTTAATGG - Intronic
1046845127 8:118907010-118907032 ATGAAGAAAAAGAGGATTAATGG - Intergenic
1047267808 8:123324649-123324671 TTGAAGGCAAGGATGATTTAAGG + Intronic
1047310584 8:123688382-123688404 ATAAAGAAAAAGATGCTTAATGG - Intronic
1047325130 8:123828684-123828706 TGGAAGAAAACGAGGTTTAATGG - Intergenic
1047570454 8:126093412-126093434 TTGGATTAAAGGATAGTTAATGG + Intergenic
1047753511 8:127900409-127900431 ATGAAGAGAAGGATGGGGAATGG - Intergenic
1048115867 8:131521093-131521115 ATAAAGAAAAGGAGGTTTAATGG - Intergenic
1048769614 8:137881793-137881815 GGGAAGAAAAAGAGGGTTAATGG - Intergenic
1049985259 9:944568-944590 CTGAAGAAACGGATCTTTAATGG + Intronic
1050156146 9:2667985-2668007 GGGAAGAAAAGGAGGTTTAATGG - Intergenic
1050162149 9:2730201-2730223 TTGAAGAAACTGAGGCTTAAAGG - Intronic
1050204489 9:3182354-3182376 TTGAAGAAAAGGTCCGTTTATGG - Intergenic
1050481195 9:6088429-6088451 AAGAAGAAAAGGAAGGGTAAAGG - Intergenic
1051448906 9:17173014-17173036 GTGGAGAAAAGGAAAGTTAATGG + Intronic
1052000858 9:23278301-23278323 TTGAGGAAAAGAATGTTTTAAGG + Intergenic
1052055445 9:23901943-23901965 TTAAAGAAAAGTATCATTAAAGG + Intergenic
1052265000 9:26561712-26561734 ATAAAGAAAAGGAAGTTTAATGG - Intergenic
1052463069 9:28792275-28792297 TTAAAGAAAAAGATGGAAAATGG + Intergenic
1053136816 9:35656152-35656174 TGGAAGACAAGGATGGGGAAAGG + Intergenic
1053229090 9:36390628-36390650 AGGAAGAAAAGGATAGTTCATGG + Intronic
1053541911 9:38982430-38982452 TTGACGAAAAGGATGAAAAAAGG - Intergenic
1053588975 9:39491221-39491243 TTGAAGAGGAGGTGGGTTAAGGG - Intergenic
1053806255 9:41805061-41805083 TTGATGAAAAGGATGAAAAAAGG - Intergenic
1054577327 9:66874074-66874096 TTGAAGAGGAGGTGGGTTAAGGG + Intronic
1054624229 9:67381480-67381502 TTGACGAAAAGGATGAAAAAAGG + Intergenic
1055413045 9:76052340-76052362 ATAAAGAAAAGGAGGTTTAATGG + Intronic
1055902102 9:81252250-81252272 CTGAAATAAAGGAAGGTTAATGG + Intergenic
1055975834 9:81954567-81954589 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
1057108749 9:92446887-92446909 ATGAAGAAAAGGAGGGAAAAAGG + Intronic
1058583834 9:106485873-106485895 ATAAAGAAAAAGAGGGTTAATGG - Intergenic
1059363515 9:113767041-113767063 ATAAAGAAAAAGAGGGTTAATGG - Intergenic
1059589826 9:115646685-115646707 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1060255057 9:122020018-122020040 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1060300576 9:122372375-122372397 TTGAATAAAAGTCTGGTTTATGG + Intronic
1060448965 9:123719127-123719149 TTAAAGAAAAAGAGGTTTAATGG - Intronic
1060702084 9:125763705-125763727 TTGAAGAAAGCAATGATTAATGG + Intronic
1203635754 Un_KI270750v1:108988-109010 ATAAAGAAAAAGATGTTTAATGG - Intergenic
1186016620 X:5202508-5202530 TTGAACAAAATGGGGGTTAAGGG - Intergenic
1186113995 X:6286189-6286211 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1186241417 X:7571172-7571194 ATGAAGAAAAAGAAGTTTAATGG + Intergenic
1186815139 X:13229404-13229426 TTGAAGACATGGATGGTTTGTGG + Intergenic
1186943717 X:14541253-14541275 TAGAAGAAAAGATTGGGTAAGGG + Intronic
1187191670 X:17041491-17041513 GTAAAGAAAAGGATAGCTAATGG - Intronic
1187625599 X:21109542-21109564 TTGAAGGAAAGGAGGGTATAGGG + Intergenic
1187631229 X:21174941-21174963 TTGAAGGAAAGCAAGGTCAAAGG + Intergenic
1187902198 X:24035523-24035545 TTGAAAAAGAACATGGTTAAAGG + Intergenic
1188042434 X:25384867-25384889 TTAAAGGAAAGGAAGGTTATAGG + Intergenic
1188052811 X:25508471-25508493 TTAAAGAAAAAGAGGTTTAATGG + Intergenic
1188545776 X:31305028-31305050 TGGAAGCAAAGTATGGCTAATGG + Intronic
1188894025 X:35644150-35644172 TTGAAGAAAAGGAGGTTGGAAGG - Intergenic
1188926403 X:36050078-36050100 ATGAAGAAAAAGAGGTTTAATGG - Intronic
1188926694 X:36052063-36052085 TTAAAGAAAAAGAGGTTTAATGG - Intronic
1188969428 X:36595873-36595895 GTGAAGAAAAGAATGATAAAAGG - Intergenic
1188973555 X:36646544-36646566 ATGAAGAAAAAGAGGTTTAATGG - Intergenic
1189138996 X:38581296-38581318 ATGAAGAAAAAGATGTTTAATGG + Intronic
1189644950 X:43118177-43118199 TTGAAGAAATGGCTGATTATAGG - Intergenic
1189711016 X:43811959-43811981 AGGAAGATAAGGATGGTTAATGG - Intronic
1190013949 X:46810565-46810587 ATAAAGAAAAGGAGGTTTAATGG + Intergenic
1191060376 X:56289336-56289358 TTGAAGAAATGGCTGATTATAGG - Intergenic
1191930681 X:66368031-66368053 TAGAGGCAAATGATGGTTAAAGG - Intergenic
1193302847 X:79912515-79912537 TTAAAGAAAAAGAGGTTTAATGG - Intergenic
1193376319 X:80766163-80766185 TAGAACAAAAGGCAGGTTAAGGG + Intronic
1193415111 X:81212458-81212480 TTGAAAAAGAGGATGTTGAAAGG + Intronic
1193938345 X:87650777-87650799 GGGAAGAAAAAGATGTTTAATGG + Intronic
1194190592 X:90832060-90832082 TTGAAGAACATAAAGGTTAAGGG - Intergenic
1194395930 X:93386218-93386240 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1194762154 X:97808055-97808077 TTGAAAAACAGGTTGATTAATGG - Intergenic
1195031043 X:100928183-100928205 GTGGAGAAAAGGATGCTAAATGG + Exonic
1195496501 X:105541407-105541429 TTGAAGAAAAGGAGAGTAAGTGG + Intronic
1196151794 X:112382405-112382427 TTAAAGAAAAAGCTAGTTAAGGG - Intergenic
1196219584 X:113097050-113097072 TGGCTGAAAAGGTTGGTTAATGG - Intergenic
1196893948 X:120315015-120315037 TTGAGGAAAACCATAGTTAAGGG + Intergenic
1197442697 X:126510990-126511012 ATAAAGAAAAAGATGTTTAATGG + Intergenic
1197609201 X:128619978-128620000 CTGAAGAAAAGGAGAGGTAAAGG - Intergenic
1198526306 X:137504506-137504528 TTGAAGAAAGGGATGGAAAGGGG + Intergenic
1199210552 X:145205005-145205027 TTGAAAAAAAGTATTTTTAATGG + Intergenic
1199336681 X:146626907-146626929 TTGGAGAAAACTATGTTTAAAGG - Intergenic
1199683493 X:150243707-150243729 ATGAAGAAAAAGAGGTTTAATGG + Intergenic
1200537252 Y:4414483-4414505 TTGAAGAACATAAAGGTTAAGGG - Intergenic
1201912335 Y:19145480-19145502 TTAAAGAAAAAGAAGTTTAATGG - Intergenic
1201957968 Y:19647099-19647121 TTGGAGAGAAGGATGGTGTAAGG + Intergenic