ID: 908586700

View in Genome Browser
Species Human (GRCh38)
Location 1:65577736-65577758
Sequence ACTTGGACCTTGAGTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908586697_908586700 26 Left 908586697 1:65577687-65577709 CCATCACATCATCAATTTTGTTT 0: 1
1: 0
2: 2
3: 34
4: 505
Right 908586700 1:65577736-65577758 ACTTGGACCTTGAGTGAATCAGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908586700 Original CRISPR ACTTGGACCTTGAGTGAATC AGG Intronic
902742940 1:18452577-18452599 TCTGGGACCCTGAGTGACTCTGG - Intergenic
903286230 1:22278461-22278483 TCTTAGACCTTGAGTGAACTTGG + Intergenic
903853562 1:26322211-26322233 ACGTGGAGCATCAGTGAATCGGG - Exonic
905263536 1:36735580-36735602 TCTTGGACCTTGGCTGAACCTGG + Intergenic
907783134 1:57585585-57585607 TCTTGGACCTTGAATGCATCTGG + Intronic
907891604 1:58641881-58641903 ACTTAGACCTTCAGGGAATCTGG - Intergenic
908116152 1:60942329-60942351 ACATGCACCTTGGGTGACTCTGG + Intronic
908586700 1:65577736-65577758 ACTTGGACCTTGAGTGAATCAGG + Intronic
911299007 1:96150649-96150671 AATTGAACCTTGAGTGAGCCGGG - Intergenic
912871672 1:113312077-113312099 CCTAGGGCCTTGAGTGAATGTGG + Intergenic
915260605 1:154674228-154674250 AATTGACCCTTGAGTGATTCGGG - Intergenic
915712367 1:157912657-157912679 ACTTTGACATTGAGTAAAGCTGG - Intergenic
915906202 1:159879176-159879198 TCTTGGACATTGAGTGGAGCTGG - Intronic
916057627 1:161079043-161079065 ATATGGACCTTCAGTGAATGTGG - Intronic
916114475 1:161475305-161475327 AGTTGACCCTTGAGTGATTCAGG - Intergenic
916939568 1:169664750-169664772 AATTGACCCTTGAGTGATTCGGG - Intronic
918092044 1:181305476-181305498 ACTTGGAGCTAGATGGAATCAGG + Intergenic
919882664 1:201911135-201911157 CCTTGGCACTTGAGTGCATCTGG - Intronic
924254039 1:242164450-242164472 ACATGGCCCGTCAGTGAATCTGG - Intronic
1063600337 10:7475069-7475091 ACCTGGACCTGGATTGAATGTGG + Intergenic
1067203928 10:44197853-44197875 ACTTGGAACCTGCGTGAATGTGG - Intergenic
1067248238 10:44564722-44564744 ACATCAACCTGGAGTGAATCAGG + Intergenic
1067970286 10:50962182-50962204 TGTTGAACGTTGAGTGAATCTGG + Intergenic
1068303407 10:55175320-55175342 AGTTGTACCTTGATTGAATCAGG - Intronic
1073729290 10:106270657-106270679 AATTGTCCCTTGACTGAATCAGG - Intergenic
1075210296 10:120485268-120485290 ACTTGGACCCAGAGTGAATAAGG - Intronic
1075464592 10:122642203-122642225 ACTTGGTATTTGAGAGAATCTGG + Intronic
1079188092 11:18254987-18255009 ACGTGGTCCTTGAGTGATTAGGG - Intergenic
1081330385 11:41793385-41793407 AGTTGTCCCTTGACTGAATCAGG - Intergenic
1083435373 11:62639378-62639400 AGATGGACCGTGAGGGAATCAGG + Exonic
1084470890 11:69358439-69358461 ACTGGGTCCTTGAGGGAATAGGG - Intronic
1086011913 11:82115022-82115044 ACATGGACCTTTAGGGATTCTGG + Intergenic
1086201535 11:84209061-84209083 ATTTGTCCCTTGAGAGAATCTGG + Intronic
1087138797 11:94745665-94745687 ACTGGGACCTTGCGTGGATATGG + Intronic
1087258799 11:95987056-95987078 ATTTGGACTTTGAGTGATTTCGG + Intronic
1090609321 11:128456128-128456150 ACTGGAACATTGAGTAAATCAGG + Intergenic
1093021238 12:14206270-14206292 TCTTGGAACTTGAATGAAGCAGG - Intergenic
1093216449 12:16367556-16367578 ACTGGGACATGGAGTGACTCTGG - Intronic
1093259418 12:16917390-16917412 CCTTGGTCCTTGAGTGAAATTGG - Intergenic
1094319912 12:29172692-29172714 AATTGACCCTTGAGTGAGTCAGG + Intronic
1096107565 12:49005769-49005791 ATTTGGAGCTTGTGGGAATCAGG + Exonic
1099347631 12:81522940-81522962 CCTGGGTCCTTGAGTGAATGTGG - Intronic
1101779719 12:107824444-107824466 AGTTGACCCTTGAGTGAGTCGGG - Intergenic
1103265085 12:119622904-119622926 AGGGAGACCTTGAGTGAATCTGG - Intronic
1105407513 13:20144395-20144417 ACTTGCACCCTGACTGAGTCTGG - Intronic
1105654939 13:22426246-22426268 ACTTGCTCCTTGAGTGAACGTGG - Intergenic
1106165391 13:27241257-27241279 ACATTGACCATTAGTGAATCAGG + Intergenic
1107741028 13:43450663-43450685 ACCTGGCCCTGGAGTGATTCAGG + Intronic
1110115404 13:71808759-71808781 ACTTTGACCTTCTCTGAATCAGG + Intronic
1110451542 13:75642295-75642317 ACTTGTACCTTTAGTAAAACAGG + Intronic
1111275301 13:85938790-85938812 AGTTGTCCCTTGACTGAATCAGG - Intergenic
1111667789 13:91291598-91291620 GCATGGACCCTGGGTGAATCTGG + Intergenic
1111757067 13:92411529-92411551 ACTTGGACCTTATGTTTATCAGG + Intronic
1121722176 14:96117057-96117079 TCTTGGCCCTTGAGTGTAACAGG + Intergenic
1125243218 15:37600777-37600799 AATTTGACCTGGAGTGCATCTGG - Intergenic
1125276960 15:38003715-38003737 CCTTGGGCCTTGAGTGAACATGG - Intergenic
1137794238 16:51201703-51201725 ACTTTGACACTGAGTGCATCTGG - Intergenic
1140138128 16:72226372-72226394 ACTTGGACCTTGACAGAACCAGG - Intergenic
1140227872 16:73093248-73093270 ACGTGGCCTTTGAGTGAACCTGG - Intergenic
1140499476 16:75421277-75421299 ATTTGAAGCTTGAGTAAATCAGG - Intronic
1140688609 16:77458593-77458615 GTTTGGACCTTGAGTGGACCAGG - Intergenic
1144679989 17:17186901-17186923 ACAGGGACCTGGAGTGCATCAGG + Exonic
1146886197 17:36472551-36472573 ACTTGTCCCTTGATGGAATCAGG + Intergenic
1155644839 18:28064757-28064779 ACTGGAGCCTTGAGAGAATCAGG + Intronic
1156273878 18:35562709-35562731 ACTTTGACATTGAGTGAAGGAGG + Intergenic
1156701706 18:39834032-39834054 AATTGGAGCTTGAGTGAAAATGG - Intergenic
1156904537 18:42337482-42337504 ACTTTGAACTTGAGAGAGTCTGG - Intergenic
1157201670 18:45664737-45664759 AAATGGACTTTGAGTGAATATGG + Intronic
1163766432 19:19165872-19165894 ACCTTGACCTTGGGTGAAACTGG + Intronic
1163783735 19:19263758-19263780 ACTTGGGCCTGGAGTAAGTCAGG - Intergenic
1165154303 19:33777911-33777933 ACTGGGACCCTGAGTGTGTCGGG + Intergenic
1165847132 19:38825439-38825461 AATTGACCCTTGAGTGATTCGGG - Intronic
1166992121 19:46698910-46698932 AGTTGGACCTTGAGGGATTGGGG - Intronic
928484200 2:31712581-31712603 TTTTGGGCCTTGAGTGAACCAGG + Intergenic
928594193 2:32844940-32844962 ACTTTGAACTTGAGAGTATCTGG + Intergenic
933970888 2:87468888-87468910 ACTTGGACGCTGTGTGATTCAGG + Intergenic
936322838 2:111481301-111481323 ACTTGGACGCTGTGTGATTCAGG - Intergenic
938195248 2:129321120-129321142 CCTTGGACCCTGAGTGATCCTGG - Intergenic
938806144 2:134808687-134808709 AATTGACCCTTGAGTGAGTCAGG + Intergenic
940369993 2:152890422-152890444 ACTTGGACCTCGAGTAAGTGAGG + Intergenic
941186361 2:162325457-162325479 AGTTGCCCCTTGACTGAATCAGG + Intronic
942294956 2:174508136-174508158 CCTTGGGCCTTGAGTGAACATGG + Intergenic
944962632 2:204892352-204892374 ACTTTGACTTGGAGTGAATTGGG + Intronic
945052377 2:205836334-205836356 GCTTGGAGGTTCAGTGAATCAGG + Intergenic
946509001 2:220334452-220334474 CATTGGGCCTTGAGTGAATATGG - Intergenic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
1168976099 20:1966907-1966929 ACTTAGCTCTTGAGTGAATCCGG + Intergenic
1172340690 20:34155148-34155170 AATTGGCCCTCGAGTGAGTCAGG - Intergenic
1173330624 20:42073521-42073543 ACTTGGACCTTCACTGGTTCTGG + Exonic
1176184854 20:63772869-63772891 GCTGGGACCTTGAGTGGTTCTGG - Intronic
1179420209 21:41229502-41229524 ACTTTGACCTTGATGGACTCTGG - Intronic
1180842055 22:18964063-18964085 GCTTGTTCCTTGAATGAATCAGG - Intergenic
1181059441 22:20274818-20274840 GCTTGTTCCTTGAATGAATCAGG + Intronic
949448940 3:4164833-4164855 AATTGACCCTTGAGTGAGTCAGG + Intronic
952003152 3:28809658-28809680 AGTTGTCCCTTGACTGAATCAGG + Intergenic
957887437 3:86306538-86306560 ATTTGGAACTTGGGTGAATTGGG + Intergenic
962462598 3:135628406-135628428 ACTTGGACCTTGAGGGATGAAGG - Intergenic
964064534 3:152562540-152562562 AATTGACCCTTGAGTGATTCGGG - Intergenic
965300400 3:166999783-166999805 AGTTGTCCCTTGACTGAATCGGG + Intergenic
976282927 4:83342827-83342849 ACATGCACCTTGGCTGAATCTGG - Intergenic
977884120 4:102238027-102238049 AATTGACCCTTGAGTGATTCGGG - Intergenic
982701158 4:158660709-158660731 AATTGAATCTTGAGTGATTCAGG - Intergenic
985159883 4:187033662-187033684 ACTTTGAACTTGAGAGTATCTGG + Intergenic
987631501 5:20478430-20478452 CCTTGGGCCTTGAGTGAACATGG + Intronic
988605473 5:32675255-32675277 CATTGAACCTTGAGTGATTCGGG + Intergenic
989821066 5:45796347-45796369 AGTTGTCCCTTGACTGAATCAGG - Intergenic
990480034 5:56201341-56201363 ACCTGGGCCCTGAGTCAATCTGG + Intronic
992545801 5:77812741-77812763 AATTGACCCTTGAGTGAGTCAGG - Intronic
995400520 5:111735950-111735972 ACATGGACTTGGAGAGAATCTGG - Intronic
997072422 5:130636325-130636347 TATTGGCCCTTGAGTGAGTCAGG - Intergenic
1006926946 6:37661746-37661768 CCTAGGAGCTTGAATGAATCTGG + Intronic
1011811377 6:91135878-91135900 ACTGGGCTCTTGTGTGAATCAGG + Intergenic
1012019539 6:93900248-93900270 ACTTTTACATTCAGTGAATCAGG + Intergenic
1015861501 6:137685626-137685648 GCTTGGACCTTGATTGGATATGG - Intergenic
1021687769 7:23204059-23204081 ACTTGGAAGTTGAGTGACTTTGG - Intergenic
1023074822 7:36472377-36472399 ACTTCCACTTTGAGGGAATCCGG + Intergenic
1023687027 7:42746491-42746513 ACTTGGACCTGCTGTTAATCAGG - Intergenic
1024140658 7:46460110-46460132 ACTTGGTCCTGGAGTGAACAGGG - Intergenic
1024387736 7:48772871-48772893 TTTTGGACCTTTAGTGAAACTGG - Intergenic
1030435858 7:109519558-109519580 ATTTGGACCTTTTATGAATCTGG + Intergenic
1031232187 7:119122660-119122682 GCATGGACCCTGGGTGAATCTGG - Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1039027221 8:33270933-33270955 ACTTGGAACAAAAGTGAATCAGG - Intergenic
1040883011 8:52228933-52228955 ATTTGTACCTTGAGTGACACAGG + Intronic
1044811298 8:96065412-96065434 AGATGGACCTTGAGAGAAACAGG + Intergenic
1044860821 8:96521925-96521947 ACTTGGAATTTTAGTGAATTAGG - Intronic
1048180701 8:132191976-132191998 ACTTGGACCTCAAGTGCAGCAGG - Intronic
1048209733 8:132444765-132444787 CATTGGACTTTGACTGAATCAGG + Intronic
1048965469 8:139611499-139611521 ACATGCACCATGAGTGACTCAGG - Intronic
1049362430 8:142218656-142218678 ATTTGGACCCTGAGTGTGTCGGG - Intronic
1058360363 9:104139227-104139249 ATTTTGACATTGAGTAAATCTGG - Exonic
1060400458 9:123345918-123345940 ATAAGGACCTTTAGTGAATCCGG - Intergenic
1060500669 9:124151503-124151525 ACTTGGGCCCTGTGGGAATCTGG + Intergenic
1187022180 X:15395153-15395175 GCTTGGAGCGTGAGTGAGTCAGG + Intronic
1188980087 X:36719845-36719867 ACTGGCACCTTGAGAGACTCAGG + Intergenic
1190360753 X:49645920-49645942 ACTTGGACATTAATGGAATCAGG - Intergenic
1193842096 X:86418928-86418950 ACTTTGAACTTGAGGGTATCTGG - Intronic
1195073886 X:101307799-101307821 ACAAGAACATTGAGTGAATCTGG - Intergenic
1199983400 X:152933514-152933536 TCTTGGACCTGGAGGGAGTCAGG + Intronic
1201493590 Y:14569325-14569347 AGTGGGAGCTTGAGTAAATCTGG - Intronic