ID: 908587359

View in Genome Browser
Species Human (GRCh38)
Location 1:65584954-65584976
Sequence CTAGGTCAGCACTACTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908587358_908587359 -7 Left 908587358 1:65584938-65584960 CCTTGATAAGATTTATCTAGGTC No data
Right 908587359 1:65584954-65584976 CTAGGTCAGCACTACTTACTTGG No data
908587356_908587359 -4 Left 908587356 1:65584935-65584957 CCTCCTTGATAAGATTTATCTAG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 908587359 1:65584954-65584976 CTAGGTCAGCACTACTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908587359 Original CRISPR CTAGGTCAGCACTACTTACT TGG Intronic
No off target data available for this crispr