ID: 908588123

View in Genome Browser
Species Human (GRCh38)
Location 1:65596979-65597001
Sequence GCAGAGTTCTTTGCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 5, 1: 24, 2: 64, 3: 66, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908588123_908588126 10 Left 908588123 1:65596979-65597001 CCAGTTTTAGCAAAGAACTCTGC 0: 5
1: 24
2: 64
3: 66
4: 181
Right 908588126 1:65597012-65597034 TAGCAGGAACACCCCCACCCTGG No data
908588123_908588125 -6 Left 908588123 1:65596979-65597001 CCAGTTTTAGCAAAGAACTCTGC 0: 5
1: 24
2: 64
3: 66
4: 181
Right 908588125 1:65596996-65597018 CTCTGCTAGGTCATTTTAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908588123 Original CRISPR GCAGAGTTCTTTGCTAAAAC TGG (reversed) Intronic
900842951 1:5070493-5070515 GCAGAGTTCTTTGCCAAAACTGG - Intergenic
900846638 1:5108564-5108586 GCAAGGCTCTTTTCTAAAACTGG + Intergenic
900913688 1:5619821-5619843 GCATGGTTCTTTGCTAAAACTGG + Intergenic
902453861 1:16517457-16517479 ACAGTATTCTTTCCTAAAACTGG + Intergenic
902763767 1:18601340-18601362 GCAGTTTTATTTGCTAAATCTGG + Intergenic
904413529 1:30340591-30340613 GAAGAGTTCTTTGCTGAAACTGG + Intergenic
905159979 1:36024027-36024049 TCATAGTGCTCTGCTAAAACTGG + Intronic
907028997 1:51152369-51152391 GTATAGTTCTTGGCTAAAGCTGG - Intergenic
907856731 1:58311034-58311056 GCAGGATTCTTTGCTAAAACTGG - Intronic
908588123 1:65596979-65597001 GCAGAGTTCTTTGCTAAAACTGG - Intronic
909611031 1:77552033-77552055 GCAGAGTTCTTTGCTAAAACTGG - Intronic
910310829 1:85822735-85822757 GCAGGGTTCGTTGCTAAAACTGG - Intronic
911726752 1:101249519-101249541 GCAGTGTTCTTTCCTTAAAGGGG + Intergenic
912048965 1:105499035-105499057 GCAGAATTCTTTGCTAAGACTGG - Intergenic
913650169 1:120906142-120906164 GCAGTGTTCTTTGCTAATGCTGG - Intergenic
914005994 1:143732797-143732819 ACAGTATTCTTTTCTAAAACTGG + Intergenic
914076503 1:144357364-144357386 GCAGTGTTCTTTGCTAATGCTGG + Intergenic
914102675 1:144609133-144609155 GCAGTGTTCTTTGCTAATGCTGG - Intergenic
914170949 1:145222944-145222966 GCAGTGTTCTTTGCTAATGCTGG + Intergenic
914518169 1:148391821-148391843 ACAGTATTCTTTTCTAAAACTGG + Intergenic
914526065 1:148466912-148466934 GCAGTGTTCTTTGCTAATGCTGG + Intergenic
914640339 1:149600211-149600233 GCAGTGTTCTTTGCTAATGCTGG - Intergenic
916217510 1:162410059-162410081 GTAGGGTTCTTTGCTAAAACTGG - Intronic
916721623 1:167488625-167488647 GCAGAGTTCTTTGCTAAACCTGG + Intronic
916842711 1:168616127-168616149 GCAGGGCTCTTTGCCAAGACTGG - Intergenic
916951734 1:169787351-169787373 GCAGAGCTCTTTACTAAAACTGG - Intronic
918439891 1:184556250-184556272 GCAGGTTCCTTTTCTAAAACTGG - Intronic
919309102 1:195884050-195884072 CCAGAGTTCTTTGCTATTGCAGG + Intergenic
920055887 1:203191395-203191417 GCAGGGCTCTTTGCTAAAACTGG - Intergenic
920189189 1:204181566-204181588 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
920772808 1:208905657-208905679 GCAGAGGACTTTGCAAAAATTGG - Intergenic
921086615 1:211799858-211799880 GCAGTGTTCTTTGCTAAGATGGG - Intronic
921524350 1:216199061-216199083 GTAAAGTTATTTGGTAAAACTGG - Intronic
923264108 1:232296642-232296664 GCAGAGCTCTATGCTAATGCTGG + Intergenic
923649797 1:235863906-235863928 GCAGGGTTCTTTGCTAATACTGG - Intronic
923689308 1:236177082-236177104 ACAAAGTTCTTTGGTAGAACTGG + Intronic
924841793 1:247718610-247718632 GCTGAGTACTTTGGAAAAACTGG + Intergenic
1066443591 10:35461527-35461549 GCAGGGTGCTTTGCTAAAAGTGG + Intronic
1066577805 10:36845706-36845728 GCAGAGTTCTTGTCTCAAACGGG + Intergenic
1067101964 10:43340368-43340390 GCAGAATTCCATTCTAAAACAGG + Intergenic
1067545449 10:47189520-47189542 GTAGGATTCTTTGCTAAAACTGG + Intergenic
1068768043 10:60786239-60786261 GCAGAGTGGTTTGGTAGAACTGG - Intronic
1070018702 10:72561860-72561882 GAAGAGTTCTTTGTAAAATCTGG - Intronic
1071302401 10:84265805-84265827 ATAGGGTTCTTTGCTACAACTGG - Intergenic
1071586740 10:86830286-86830308 GCAGGGTTCTTTGCTAAAACAGG + Intronic
1071821041 10:89281220-89281242 GCAGGATTCTTTGCTAAAACTGG - Intronic
1071849032 10:89549935-89549957 GTAGAGTTCTCTGCTTAAAGAGG - Intronic
1073033970 10:100550198-100550220 GCTGAGTTATTTGCTGACACAGG + Exonic
1073318014 10:102596547-102596569 CCAGAGTCCTTTGCTAAACAAGG + Intronic
1073531535 10:104237030-104237052 GCAGTGTTCTTTGCTAAAACCGG - Intronic
1074548479 10:114420943-114420965 GCATAGTTCTGTGCTTAATCAGG + Intergenic
1074839888 10:117340309-117340331 GCAGAGTTCTTTGCTGAAACTGG - Intronic
1074848053 10:117416221-117416243 GTGAGGTTCTTTGCTAAAACTGG + Intergenic
1075624764 10:123954266-123954288 CAAATGTTCTTTGCTAAAACTGG + Intergenic
1077968977 11:7167533-7167555 GCAGAATTGTTTGCTCAAACTGG + Intergenic
1081649268 11:44812743-44812765 GCAGGATTCTTAGCTAAAGCGGG + Intronic
1082173630 11:49035882-49035904 GGGAAGTTCTTTGCTAAAAGGGG + Intronic
1082939561 11:58689738-58689760 GCAAGGTTGTTTGATAAAACTGG + Intronic
1083712332 11:64556864-64556886 GCAGGGTTCTTTGCTAAAACTGG + Intronic
1085002816 11:73056376-73056398 GCAGTGTTCTTTACTAATACCGG - Intronic
1086692137 11:89800215-89800237 GGGAAGTTCTTTGCTAAAAGGGG - Intronic
1086713662 11:90039445-90039467 GGGAAGTTCTTTGCTAAAAGGGG + Intronic
1088234217 11:107705176-107705198 GCAGAGTTCTGTGATGAATCAGG + Intergenic
1088678734 11:112221358-112221380 GAAGAGTTCTTGGCTACAATGGG - Intronic
1091307000 11:134542696-134542718 TCAGACTTCTGTGTTAAAACTGG - Intergenic
1093019235 12:14187733-14187755 GTAGTGTTCTTTGCTAAAACTGG + Intergenic
1093177485 12:15928969-15928991 GCAGCGTTCTCTGTGAAAACTGG + Intronic
1094125162 12:27015461-27015483 AGGGGGTTCTTTGCTAAAACTGG + Intergenic
1094177181 12:27553008-27553030 GCAGGGTTCTTTGCTAAACTTGG + Intronic
1094375919 12:29787110-29787132 GTAGTGTTCTTTGCTAAAACTGG - Intergenic
1094642591 12:32290587-32290609 GCAGAATTCCTTGCTAAGGCTGG - Intronic
1095443262 12:42259391-42259413 GCAGGGTTCTTTGCTAAAATGGG + Intronic
1095970251 12:47896865-47896887 GCAGAGTTCTTTGTTCCAAACGG - Intronic
1097443073 12:59634677-59634699 GCAGGGCTCTTTGCTAAAACTGG + Intronic
1097557455 12:61156888-61156910 ACACCTTTCTTTGCTAAAACAGG - Intergenic
1098878393 12:75891220-75891242 GCAGGATTCTTTGTTAAAACTGG - Intergenic
1099242199 12:80151548-80151570 GCAGAGTTCTATCCAAAAAAAGG + Intergenic
1099834758 12:87895379-87895401 GCAGTGTTATTTGTTGAAACTGG + Intergenic
1100019817 12:90055843-90055865 GTAGAGTTCTTTGCCAGAAGAGG - Intergenic
1100989256 12:100234533-100234555 GCAGGGTTCTTTGCTAAAATGGG + Intronic
1101153837 12:101908747-101908769 CCAGGGTTCTTTGCTAAAACTGG + Intronic
1105370305 13:19796243-19796265 GCAAGGTTCTTTGCTAAAACTGG + Intergenic
1107655164 13:42585483-42585505 TCAGAGTTCTGTGCTAAAGGGGG - Intronic
1108481238 13:50874114-50874136 GCAGGGCTCTTTTCTAAAACTGG + Intergenic
1109089039 13:58015820-58015842 GCAGGGTTCTTTGCTACAACTGG - Intergenic
1109577160 13:64274614-64274636 ACAGAGTTCTTGCCTAAGACAGG + Intergenic
1109935815 13:69282883-69282905 TCAGGGTTCTTTGCTAAAAGTGG + Intergenic
1110893158 13:80715164-80715186 GCAGAGTTCTTTGCTTCCAATGG + Intergenic
1111339916 13:86870939-86870961 GCAGGGTTCTTTGCTAAAGCTGG - Intergenic
1112264843 13:97913874-97913896 GCAGGATTCTTTGCTAAAACTGG - Intergenic
1113473835 13:110565628-110565650 GCACATTTCTTTGATGAAACTGG - Intergenic
1114676783 14:24446504-24446526 GCAAGGCTCTTTGCGAAAACTGG - Intergenic
1115219875 14:31048553-31048575 GCAGAGATTTTTGGCAAAACGGG - Intronic
1116189797 14:41649569-41649591 GCAGGGTTCTTTGCTAAAACTGG - Intronic
1116452715 14:45083253-45083275 GCAAAGTTCTTTGCTTAAACTGG - Intergenic
1116578870 14:46612213-46612235 GCAGAGTCCTTGACTAATACCGG - Intergenic
1118368133 14:65113092-65113114 TTAGGGTTCTTTGCTAAAACCGG + Intergenic
1118506730 14:66421610-66421632 GCAGTTTTATTTGCTAAATCTGG - Intergenic
1120517641 14:85489583-85489605 ACAGGGTTCTTTGCTAAAACTGG - Intergenic
1121003809 14:90473431-90473453 ACTGAGTTTTTTCCTAAAACGGG - Intergenic
1121037231 14:90716367-90716389 ACAGATTCTTTTGCTAAAACTGG + Intronic
1121284732 14:92726433-92726455 GCAGAGTTTTTTTCTATAAAGGG - Intronic
1121909517 14:97776345-97776367 GCAGGGTTCTTTGATAAAACTGG - Intergenic
1126438487 15:48661709-48661731 GCAGGGTCCTGTGCTAAAATGGG - Intergenic
1128480327 15:68032037-68032059 GCAGGGTTCTTTGCTGAAACTGG - Intergenic
1128820698 15:70650155-70650177 GTAGGGTTCTTTGCTAAAACTGG + Intergenic
1130686160 15:86039739-86039761 ACAGTGTTCTTTGTTAAAACTGG - Intergenic
1131300083 15:91191341-91191363 GTAGGATTCTTTGCTAGAACTGG - Intronic
1132012891 15:98291612-98291634 GGAGAGATCCTTGCTCAAACAGG - Intergenic
1132137118 15:99352089-99352111 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1135054708 16:19221247-19221269 GCAGCGTTCTTTGCAGAAACTGG + Intronic
1137331287 16:47499529-47499551 GCTGAGTCCTTTCCTAAAACTGG + Intronic
1139449324 16:67017234-67017256 CCAGAGTCCTGTCCTAAAACAGG - Intergenic
1140038406 16:71389018-71389040 GCAGACTTCCTTGCTTAAATAGG + Intronic
1140062207 16:71580569-71580591 TCAGGGTTCTTTGCTAAAACTGG + Intergenic
1141521100 16:84580155-84580177 GCAGAATTCTTTGCTTATTCAGG + Intronic
1141529111 16:84633948-84633970 GCAGGATTCTTTACTAAAACGGG - Intergenic
1143902029 17:10181690-10181712 GCAGAGTTCCGTGATCAAACTGG + Intronic
1144220758 17:13097738-13097760 CCAGGGTTCTTTGCTAAAACTGG + Intergenic
1149254879 17:54814645-54814667 GCAGGGTTCTTTGGTAAAACTGG + Intergenic
1149707003 17:58704137-58704159 GCAGGATTCTTTGCTAAGACTGG - Intronic
1153983767 18:10334869-10334891 GCATAGTGCTTTACTTAAACAGG + Intergenic
1157427450 18:47595938-47595960 GCAGGATTCTTTGCTAAAGCTGG + Intergenic
1157510494 18:48268624-48268646 GCAGGATTCTTTGCTAAAACTGG + Intronic
1158038534 18:53065160-53065182 GTAAAATTCTTTGATAAAACTGG - Intronic
1158094848 18:53758714-53758736 ACAGTGTTCTTTGCTAAAACTGG + Intergenic
1158232461 18:55273001-55273023 GCAGAGTTCTTTTTAAGAACAGG - Intronic
1159053967 18:63447119-63447141 GCAGAGTTCTGTCCTGTAACAGG + Intergenic
1159901631 18:74052780-74052802 GAAGAGTTATTTCCTAAAGCGGG + Intergenic
1161347521 19:3775658-3775680 TCAGACTTCAGTGCTAAAACAGG - Intergenic
1162348131 19:10133002-10133024 GCAGAGCTCTGTGCTGCAACTGG - Intergenic
1164633891 19:29778855-29778877 GGAGAGTCCTTTGCTCAAATGGG - Intergenic
1165492403 19:36132095-36132117 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
1165722147 19:38087065-38087087 GCAGGGTTCTTTGTTAAAACTGG + Intronic
1168500169 19:56886145-56886167 GCAGGGTTCTTCCCTGAAACTGG + Intergenic
927064776 2:19460450-19460472 GCAGGGTTCTTTGCTAAAAGTGG - Intergenic
927582821 2:24269563-24269585 GGAGAGGTCTGTGCTAAAGCTGG + Intronic
928340840 2:30441848-30441870 GGAGAGTTATTTGCTAACCCTGG + Intergenic
928348962 2:30529284-30529306 GCACATTTCTGTGCTAAAAGAGG + Intronic
930176253 2:48304325-48304347 GCAGAGTTCTTTGCTAAAAATGG - Intergenic
930904058 2:56544635-56544657 GCAGAAATTTTTGCTAAGACTGG + Intergenic
931947128 2:67322659-67322681 TCAAAGCTCTTTCCTAAAACAGG + Intergenic
932090056 2:68798458-68798480 GCCCAGTTCTATGCTAACACTGG + Intronic
933248688 2:80004055-80004077 CCAGGCTTCTTTACTAAAACTGG + Intronic
933293245 2:80461164-80461186 ACAGGATTCTTTGTTAAAACTGG - Intronic
934940837 2:98500800-98500822 GCAGGGTTCTTTGCTAAAACTGG + Intronic
935628059 2:105187286-105187308 GCAGGATTCTTTGCTAGGACTGG + Intergenic
935897962 2:107757912-107757934 AAACAGTTCTTTGCTAAAATTGG + Intergenic
937840943 2:126524022-126524044 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
939877725 2:147596946-147596968 GCAGATTGCTTTGCTTAAAGTGG + Intergenic
943218115 2:185065490-185065512 GCAGGGTTCTTTGCTGAAAATGG + Intergenic
943370516 2:187010409-187010431 GCAGAATTTCTTGCTAAGACTGG + Intergenic
945302988 2:208231681-208231703 GCAGGGTCCTTTGCTAAAACTGG - Intergenic
946015997 2:216604453-216604475 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
946494745 2:220184508-220184530 GCAGGGCTCTTTCCTAAAACTGG - Intergenic
1169816773 20:9665279-9665301 GCTGAGTTATTTGATAAAGCAGG + Intronic
1169830328 20:9818106-9818128 GCAGGGTATTTTGTTAAAACTGG - Intronic
1171256674 20:23693741-23693763 GCAGGATTCTTTCCTAAAACTGG - Intergenic
1171264028 20:23755673-23755695 GCAGGATTCTTTCCTAAAACTGG - Intergenic
1171273215 20:23832517-23832539 GCAGGATTCTTTCCTAAAACTGG - Intergenic
1171284640 20:23926793-23926815 GCAGGATTCTTTCCTAAACCTGG - Intergenic
1173985573 20:47259115-47259137 GAATAGCTCTTTGCTGAAACTGG - Intronic
1175004612 20:55668958-55668980 GTTTTGTTCTTTGCTAAAACTGG + Intergenic
1177013384 21:15754991-15755013 GCAGAGGTTTTTGCAAAATCAGG + Intronic
1177403465 21:20636384-20636406 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
1177668645 21:24195605-24195627 GCGGGGTTCTTTGCTAAAACTGG - Intergenic
1178241029 21:30900864-30900886 GCGGAGTTCTTGGCTAAAACTGG + Intergenic
1178299785 21:31442677-31442699 GCAGGATTCTTTGCGAAGACTGG + Intronic
1178664183 21:34532257-34532279 GCGGGGTTCTTTGCTAAAACTGG + Intronic
1179057350 21:37948362-37948384 GCAAAATTCTTTGCTAAAACTGG + Intergenic
1179455838 21:41499416-41499438 GCAAGGTTTTTTGCTAAAACTGG - Intronic
1179648662 21:42792388-42792410 GCAGGATTCTTTGCTAAAGCTGG + Intergenic
1180727127 22:17954533-17954555 GCAATGTTCTTTGCTAAAACTGG + Intronic
1180891671 22:19293061-19293083 GCAGAGGTCTTGGCTAATACTGG - Intergenic
1181904919 22:26186697-26186719 GCAGGATTCTTTGCTAAAACTGG + Intronic
1183576302 22:38692063-38692085 GCAGATTTCTTTGCTAGCCCTGG - Intronic
1183682903 22:39344360-39344382 GGAGGGTTCTTTGCTAAAACTGG + Intergenic
949915876 3:8964110-8964132 GCAGGGTTTTTTGCTAAAACTGG - Intergenic
951591244 3:24267535-24267557 GCAGGGTTCTTTGCTAAAACTGG - Intronic
951964940 3:28371739-28371761 ACAGGATTCTTTGCTAAGACTGG + Intronic
953478474 3:43227159-43227181 GCAGAGGGCTTTGCTCAAAGTGG + Intergenic
954685536 3:52368207-52368229 GCAGGGTTCTTTACTGAAACTGG + Intronic
956099505 3:65752743-65752765 GTAGGATTCTTTGCTAAGACTGG - Intronic
957117169 3:76041448-76041470 GCAGAGTTCTGTGATTAGACAGG - Intronic
957315197 3:78567791-78567813 ATAGGGTTCTTTGCTAAAACTGG - Intergenic
957615454 3:82520354-82520376 GCAAAGTGATTTGTTAAAACTGG - Intergenic
957767264 3:84640986-84641008 GCAGGACTCTCTGCTAAAACTGG + Intergenic
957915266 3:86680834-86680856 GTAGAGGTCTTAGGTAAAACTGG + Intergenic
958520195 3:95175474-95175496 GCTGGATTCTTTGCTAAAACTGG - Intergenic
959051572 3:101529368-101529390 GCAGGGTTCTTTACTAAAATTGG - Intergenic
959770597 3:110090527-110090549 GCAGGGTTCTTTTCTAAAACTGG + Intergenic
959842515 3:110994565-110994587 GTTGGGTTCTTTACTAAAACTGG + Intergenic
960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG + Intergenic
960924934 3:122785352-122785374 GCAAGGTTCTTTCCTAAAACTGG - Intronic
962153934 3:132924080-132924102 GCAGTGTTCTTTGCTAAAACTGG - Intergenic
962467683 3:135675336-135675358 TTAGAGTTCTTTGCTAATCCTGG - Intergenic
962581746 3:136804284-136804306 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
963774405 3:149423371-149423393 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
964212307 3:154241903-154241925 GTAGGGTTCTTTGCTAAAACTGG + Intronic
964275128 3:155001363-155001385 GCAGGGTTTTTTGCTAAAACTGG - Intergenic
964331305 3:155606308-155606330 ACAGAGTTTTTTCCTAAAACGGG - Intronic
965243832 3:166239614-166239636 TCTGAGTTCTCTGCCAAAACTGG + Intergenic
965580642 3:170264245-170264267 GCAGTGTTTTTTACTTAAACAGG + Intronic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
967247100 3:187499082-187499104 GCACAGTTCTCTGGTGAAACTGG + Intergenic
967615191 3:191556576-191556598 GCAGTGTTCATTTCTACAACTGG - Intergenic
968847347 4:3052440-3052462 ACAGAGTTTTTTCCCAAAACGGG - Intergenic
969891693 4:10265863-10265885 TTAGGGTTCTTTGCTAAAACTGG + Intergenic
970855529 4:20646584-20646606 GTGGAGTTCTTTGCTGAAACTGG - Intergenic
971345293 4:25806470-25806492 GCAGAGGTCCATGCTAAAAATGG + Intronic
971659084 4:29388995-29389017 GCAAAGTTTGTTGTTAAAACTGG + Intergenic
971939335 4:33194020-33194042 GCACAGTTCTTTGCATAAAGAGG + Intergenic
971983079 4:33780337-33780359 GCAGTAGTCTTTGCTAAAACTGG - Intergenic
973034786 4:45392105-45392127 GCATAGTTCTTTGGGAAAATAGG - Intergenic
973647957 4:52968941-52968963 GCAGAATTCTTTGCCAAAACTGG - Intronic
974724414 4:65780153-65780175 GCATAGGTCTTTGAGAAAACAGG + Intergenic
975170089 4:71223489-71223511 GCAGAGATCTGTGCTCAATCAGG + Intronic
975431947 4:74303782-74303804 ACAGGATTCTTTGCTAAAACTGG + Intergenic
976332982 4:83852992-83853014 GCAGCGTTCTTTGCTAAAGCTGG - Intergenic
976807877 4:89068536-89068558 GCAGATTTTTATGCTAAATCAGG + Intronic
978144775 4:105359530-105359552 GCAGAGTTGTTTGTTCCAACCGG - Intergenic
978926182 4:114248437-114248459 GAAAGGTTCTTTGCTAAAACTGG - Intergenic
979170386 4:117594700-117594722 TCAGAGATTTTTCCTAAAACTGG + Intergenic
979292596 4:118994216-118994238 GCAGGGTTTTCTGCTAAAATTGG - Intronic
979300500 4:119081014-119081036 GCAGGATTCTTTGCTAAAACTGG + Intergenic
979525009 4:121707268-121707290 GCAGTGTTACTTACTAAAACTGG + Intergenic
979902254 4:126236314-126236336 GCAGAATTCCTTGCTAAAATTGG + Intergenic
981008801 4:139903269-139903291 GCAGAATTCATTGCTGAAGCTGG - Intronic
981903099 4:149889704-149889726 GTAGGGTTCTTTGCTAAAACTGG - Intergenic
982333210 4:154205491-154205513 GCAGAATCATATGCTAAAACAGG + Intergenic
984597936 4:181692939-181692961 GAAGAGTTCAGTGCTAGAACAGG + Intergenic
985130710 4:186735810-186735832 GCATAGTTCTTTTTTAAACCAGG - Intergenic
986396597 5:7336650-7336672 GCAGATTTCTTTTCTAGTACAGG - Intergenic
987693766 5:21301872-21301894 GCAGGAGTCTTTGCTAAAACTGG + Intergenic
987854103 5:23396576-23396598 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
989981274 5:50648677-50648699 GCAGTGTTCTTTGCTAAAGCTGG - Intergenic
992262430 5:74984716-74984738 GCTGGGCTCTTTGCTAAAACTGG + Intergenic
992288625 5:75262050-75262072 GCAGGGCTCTTTGCTAAAACTGG - Intergenic
993821679 5:92625717-92625739 GCAGATTTTTTTTGTAAAACTGG - Intergenic
995647659 5:114330707-114330729 GAAGAATTCTTTGCAAAAATTGG - Intergenic
996087444 5:119319550-119319572 GGAGAGTTCTCTGCTAGAATTGG + Intronic
997384667 5:133463260-133463282 TCAGGATTCTTTGCTAAAACTGG - Intronic
998646410 5:144067087-144067109 GCAGTGTTCTTTGCTAAAACTGG + Intergenic
999576417 5:152982914-152982936 GCTGACTTCATTGCTATAACAGG - Intergenic
999615395 5:153417551-153417573 GCAAAGTCCTTTCCTCAAACAGG - Intergenic
1000594115 5:163194308-163194330 GCAGGATTCTTGGCTAAAATTGG - Intergenic
1000857956 5:166422891-166422913 ACAGAGTTCTTTTCTAAAGCTGG + Intergenic
1002783688 6:385432-385454 GCATTTTTATTTGCTAAAACTGG + Intergenic
1002875303 6:1204601-1204623 GCAATGTTCTTTGCTAAAGCTGG + Intergenic
1004440801 6:15651334-15651356 GCAGAGTACTTTGGCAAAAATGG + Exonic
1004446007 6:15699151-15699173 GCAATGCTCTTTGCAAAAACAGG + Intergenic
1005557143 6:26998065-26998087 GCAGGAGTCTTTGCTAAAACTGG - Intergenic
1005762273 6:28978138-28978160 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1007318631 6:41010197-41010219 GCCCAGATCTTTGGTAAAACAGG + Intergenic
1007356925 6:41327207-41327229 GCTGATTTCTTTTCTAAAATGGG + Intergenic
1008334129 6:50279767-50279789 GCAGAATTATTTGCTAAGACTGG + Intergenic
1010300416 6:74253546-74253568 GCCGTATTATTTGCTAAAACTGG + Intergenic
1010508825 6:76692122-76692144 GCAGAGTTCTTTGCTAAAACTGG + Intergenic
1011417094 6:87133292-87133314 TTAGGGTTCTTTGCTAAAACTGG - Intergenic
1011698658 6:89935314-89935336 GCAGATTTCTGTACTAAAAGGGG - Intronic
1011779564 6:90771784-90771806 GCAGGATTCTTTGCTAAAACTGG - Intergenic
1011802821 6:91036927-91036949 GAAAAGTTCTTTGCTAACCCAGG + Intergenic
1012669312 6:102020613-102020635 ACAGGGTTCTTTGCTAAAACTGG + Intronic
1013659244 6:112278037-112278059 GCAGAGGGCTTTGCTAATTCTGG - Intergenic
1014854315 6:126380954-126380976 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1015381438 6:132574041-132574063 GGACAGGTTTTTGCTAAAACAGG - Intergenic
1015460084 6:133480517-133480539 GCAGTGTTCTATGCTTATACTGG - Intronic
1016028785 6:139316255-139316277 ATAGTGTTCTTTTCTAAAACTGG - Intergenic
1016583956 6:145662803-145662825 GCTGGGTTCTTTGCTAAAAATGG + Intronic
1016677370 6:146787095-146787117 GCAGGATTTTTTGCTAAAACTGG + Intronic
1017926705 6:158917035-158917057 GCATACTTGGTTGCTAAAACAGG - Intergenic
1019869887 7:3750665-3750687 ACTGAGTTCTTTGCTCAAATTGG + Intronic
1022303373 7:29122502-29122524 CTAGTGTCCTTTGCTAAAACTGG + Intronic
1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG + Intronic
1024104124 7:46064324-46064346 GCAGTTTTCTTAGCTAAAATGGG + Intergenic
1025006911 7:55362664-55362686 GCAAGGCTGTTTGCTAAAACTGG + Intergenic
1025963447 7:66245537-66245559 GCAGGGTTCTTTGCTAAAACTGG + Intronic
1028137015 7:87232586-87232608 GCAGAGTTCTCTTCTACAACTGG + Intergenic
1028261006 7:88665145-88665167 ACAGAGTTCTTTACTACATCAGG - Intergenic
1029199430 7:98828708-98828730 GAGGACATCTTTGCTAAAACTGG + Intergenic
1030274495 7:107705516-107705538 GAAGACTTCTTGGTTAAAACAGG - Intronic
1032985296 7:137330686-137330708 GAAGAGTTCCTTCCCAAAACAGG - Intronic
1033308987 7:140245882-140245904 GCAGGATTCTTTGCTAAGACTGG - Intergenic
1033576871 7:142693932-142693954 GCAGTGTTCTTTGGGAAGACAGG + Intergenic
1034211610 7:149368466-149368488 GCAGAACTCTTGGCTAAAACTGG - Intergenic
1035403247 7:158582016-158582038 GCAGAGTTCTTAGAGATAACAGG + Intronic
1036039368 8:5057794-5057816 GAAGAGTCTTTTCCTAAAACAGG + Intergenic
1036221222 8:6923072-6923094 GCAGGATTCTTTGCTAAGATGGG - Intergenic
1036600803 8:10258736-10258758 GCAGAGGTCTTGGCAAAACCAGG + Intronic
1036731787 8:11271871-11271893 GCAGGGCTCTTTACCAAAACTGG + Intergenic
1040680127 8:49798467-49798489 GCAGGCTTCTTTGCTAGAACTGG + Intergenic
1040853030 8:51921669-51921691 GCAGTGCACTTTGCTAAAACTGG + Intergenic
1041760586 8:61362073-61362095 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1042666267 8:71209928-71209950 TCACATTTCTTTGCTGAAACAGG + Intronic
1043230556 8:77795022-77795044 GCTGAGTTCTTTGCTAAAACTGG - Intergenic
1043342274 8:79254643-79254665 GCAGGGCTCTTTGCTAAAATTGG + Intergenic
1043526371 8:81101045-81101067 GCTGAGTTATTTGCTAATAGTGG - Intronic
1044123089 8:88422653-88422675 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1044340580 8:91041813-91041835 GTAGGGTTCTTTGCTAAAACTGG - Intergenic
1044882054 8:96733466-96733488 GAAAAGTTCATTGTTAAAACTGG - Intronic
1046946083 8:119975643-119975665 TCAGGGTTATTTGCTAAAACTGG + Intronic
1048388242 8:133933842-133933864 GCAAGATTCTTTGTTAAAACTGG + Intergenic
1048567320 8:135615150-135615172 GCAAGGTTCTTTTTTAAAACTGG + Intronic
1048949464 8:139483380-139483402 GCAAGGTTCTTTGCTAAAATGGG + Intergenic
1049087926 8:140492589-140492611 GAGGAGTTCTTTGCTAAAATTGG - Intergenic
1050459446 9:5864800-5864822 GCAGAGTTCTTTGCAACTATTGG + Intergenic
1051147118 9:14039020-14039042 TCAGAGTTCTTGGCTGAACCCGG + Intergenic
1051464392 9:17360578-17360600 GTGGAGTTCCTTGCTAAGACTGG + Intronic
1052726524 9:32234653-32234675 GCAGTGTTCTTTGCTAAAATTGG - Intergenic
1056658659 9:88529033-88529055 ACAGGATTCTTTGCTAAGACTGG + Intergenic
1057377032 9:94534465-94534487 GCAGGGCTCTTTGCTAAAACTGG - Intergenic
1058355749 9:104081930-104081952 GCAGAGGTTTTTCCTCAAACAGG + Intergenic
1061494455 9:130963724-130963746 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
1062007503 9:134248311-134248333 ACAGAGTTCCTTGCTTTAACTGG + Intergenic
1062037236 9:134387915-134387937 TCAGAGTTCTTTGCTGCAAGAGG - Intronic
1185940126 X:4308589-4308611 GGCAGGTTCTTTGCTAAAACTGG + Intergenic
1186216742 X:7308559-7308581 GCAGGGTTGTATGATAAAACTGG - Intronic
1186244340 X:7605132-7605154 GCAGGGTTCTCTGCTAAAACTGG - Intergenic
1186607191 X:11104630-11104652 GCAAAGTTCTTTGGTAAATTTGG + Intergenic
1187895823 X:23978546-23978568 GCAGATTACTTTGTTAAAAGAGG - Intergenic
1188537301 X:31211775-31211797 GCAGTGTGCTCTGCTAAAACTGG + Intronic
1190379743 X:49828386-49828408 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
1194146398 X:90270589-90270611 GCAAGATTTTTTGCTAAAACTGG - Intergenic
1194187817 X:90794911-90794933 ACAGAGGTTTTTCCTAAAACAGG - Intergenic
1194336955 X:92659921-92659943 GCACAATTATTTGCTAAAACTGG - Intergenic
1194770825 X:97902797-97902819 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1195264301 X:103164864-103164886 CCATTGTTCTTTGCTAAAATAGG + Intergenic
1195652371 X:107298550-107298572 GCAGGGTCCTTTGCTAAAACTGG + Intergenic
1195983052 X:110600739-110600761 GCACAGTTCTGTGGAAAAACTGG - Intergenic
1196078155 X:111600373-111600395 GAAGGGTTCTTTGCTAAAACTGG - Intergenic
1196294727 X:113984592-113984614 ACAGAGTTCCTTGCTTAAAGGGG - Intergenic
1196323420 X:114371593-114371615 GCAGGATTATTTGCTAAAACTGG + Intergenic
1198016740 X:132619113-132619135 GGTGTTTTCTTTGCTAAAACTGG - Intergenic
1198206421 X:134469460-134469482 GCAGAGATGTATTCTAAAACAGG - Intronic
1198505018 X:137292817-137292839 TCAGTGTTCATTACTAAAACTGG + Intergenic
1199890565 X:152075016-152075038 GCAGAGTGCTTTGCTCATAGTGG - Intergenic
1200492136 Y:3839767-3839789 GCAAGATTTTTTGCTAAAACTGG - Intergenic
1200534404 Y:4376860-4376882 ACAGAGGTTTTTCCTAAAACAGG - Intergenic
1200645389 Y:5776656-5776678 GCACAATTATTTGCTAAAGCTGG - Intergenic
1201463565 Y:14255415-14255437 GCAGGGTTCTGTGCTAAAACTGG - Intergenic