ID: 908588164

View in Genome Browser
Species Human (GRCh38)
Location 1:65597269-65597291
Sequence GGTATATGGAGCACTGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 13, 3: 56, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908588164 Original CRISPR GGTATATGGAGCACTGCAAT GGG (reversed) Intronic
900812526 1:4817941-4817963 GGCATAAGGACCACTGCAAAGGG + Intergenic
903517968 1:23925160-23925182 GGTATAAAGACCACTTCAATGGG - Intergenic
904588797 1:31595917-31595939 AGTATAGGGACCACTGCAACAGG - Intergenic
904819961 1:33235585-33235607 GGTGTAGGGACCACTGCAATAGG + Intergenic
906128641 1:43442794-43442816 GAGAGATGGAGCATTGCAATGGG - Intronic
906587812 1:46995099-46995121 GGTGGATGGAGCACTGGACTTGG + Intergenic
908395970 1:63725910-63725932 GGTATAGGGAGCACTGCAATGGG - Intergenic
908588164 1:65597269-65597291 GGTATATGGAGCACTGCAATGGG - Intronic
909141940 1:71878168-71878190 AATATATTGAGCACTGAAATTGG - Intronic
910100120 1:83566756-83566778 GGTAGATGGAGCACTGGAATTGG + Intergenic
910310876 1:85823069-85823091 GGTATAGCGACCACTGCAATGGG - Intronic
910719694 1:90272460-90272482 AGTAGAGGGACCACTGCAATAGG - Intergenic
911936753 1:103986318-103986340 GATATAGGGACAACTGCAATAGG + Intergenic
915035893 1:152924556-152924578 GGGAAATGGACCATTGCAATAGG - Intergenic
916047725 1:161013271-161013293 GGGAGCTGGAGCCCTGCAATAGG + Intronic
920286279 1:204882113-204882135 GGTGCAGGGAGCACTGCAATAGG - Intronic
920709270 1:208279541-208279563 GCTATTTGGGGCACTGTAATAGG - Intergenic
922232625 1:223700001-223700023 GGCATAGGGGCCACTGCAATGGG - Intergenic
1066486784 10:35853510-35853532 GTAATATGGAACTCTGCAATAGG - Intergenic
1066528215 10:36305915-36305937 GGCATTTGGAGCACAGCAAAAGG - Intergenic
1067101467 10:43337741-43337763 AGTAGATGGAGCATTACAATCGG - Intergenic
1067307778 10:45081084-45081106 GTAATATGGAACTCTGCAATAGG - Intergenic
1067773761 10:49146318-49146340 GGTTTCTGGAGCACTGACATTGG - Intergenic
1069367508 10:67709861-67709883 AGTATAGGGACCACTGCAATAGG - Intergenic
1069484958 10:68816155-68816177 GGTATAGGAACTACTGCAATGGG - Intergenic
1069666659 10:70166505-70166527 GGTAAATGGAGCAGGGCAAGTGG - Intronic
1075316818 10:121459706-121459728 GATATATTGAGAAATGCAATCGG + Intergenic
1078529285 11:12124414-12124436 AGTAGATGCAGAACTGCAATGGG - Intronic
1078911687 11:15738645-15738667 GGGATATGGGGCATCGCAATTGG + Intergenic
1080040584 11:27755427-27755449 GGTATTGGTAGCATTGCAATAGG - Intergenic
1081195038 11:40151004-40151026 GGCATATGGAGCATGGCAGTGGG - Intronic
1082939524 11:58689461-58689483 GGTATAGGGACCACTGCAATGGG + Intronic
1086453714 11:86941650-86941672 TGTATATAGAACACTGGAATGGG - Intronic
1086836534 11:91631245-91631267 GGTGTAGGGGCCACTGCAATTGG + Intergenic
1087083297 11:94192932-94192954 GGTATCAGGACCACTGCAATGGG + Intergenic
1088681553 11:112247698-112247720 TGTATAGGGACCACTGCAACAGG - Intronic
1090286809 11:125506658-125506680 AGCATAGGGACCACTGCAATAGG - Intergenic
1090522610 11:127495385-127495407 GATATAGGGAGCACTGTGATGGG + Intergenic
1091408459 12:223724-223746 GGTATGTGGAGCATTGGATTGGG - Intronic
1092000707 12:5029801-5029823 GGTATGCGGACCACTGCAAAGGG + Intergenic
1094125120 12:27015215-27015237 GGCATAGGGACCACTGCAACTGG + Intergenic
1096091591 12:48905507-48905529 GTTGAATGGAGCACTGCAGTGGG - Intronic
1097328894 12:58311974-58311996 GGTATAGGGACCATAGCAATGGG + Intergenic
1100498200 12:95145656-95145678 GACATAGGGACCACTGCAATGGG - Intronic
1100950428 12:99842733-99842755 GGTATAGGGACCACTGCAATGGG - Intronic
1100989212 12:100234222-100234244 GGTACAGGGACCACTGCTATGGG + Intronic
1103373500 12:120437468-120437490 AGTATAAAGAGCACTGAAATTGG - Intergenic
1106948248 13:34853215-34853237 GATATAAGGACCACTGCAATTGG + Intergenic
1107446481 13:40474162-40474184 GGTATGAGGACCACTGCAGTGGG + Intergenic
1108291479 13:48966192-48966214 GGTAGAGGGACCACTGCAATGGG + Intergenic
1110893231 13:80716117-80716139 GGTATAGGGACCACTGCAATAGG + Intergenic
1111647267 13:91046747-91046769 GGTATAGAGACTACTGCAATGGG - Intergenic
1112606960 13:100915848-100915870 GGTATAAGGATCCCTGAAATGGG - Intergenic
1113087997 13:106587447-106587469 AGAGTAGGGAGCACTGCAATAGG - Intergenic
1117525964 14:56604733-56604755 GGTATAGGGACAACTGCAATGGG + Intronic
1119998031 14:79274277-79274299 GGTATGGGGACCACTGCAAATGG - Intronic
1120395289 14:83960000-83960022 GGTATAGGAACTACTGCAATGGG - Intergenic
1120517680 14:85489894-85489916 GGTATAGCAATCACTGCAATGGG - Intergenic
1121138233 14:91517997-91518019 GGTATAGGGACCATTGCAATGGG + Intergenic
1123020554 14:105395952-105395974 GTAAGATGGAGCACTGCAAAAGG + Exonic
1124705094 15:31957094-31957116 GGCATAAGGATGACTGCAATTGG + Intergenic
1125382245 15:39099139-39099161 GGTATTTTGAGGACTACAATGGG + Intergenic
1125552612 15:40558016-40558038 GCCATATGGAGCACTGTCATGGG - Intronic
1126899912 15:53304486-53304508 GGGATATGGACTAATGCAATGGG + Intergenic
1128480364 15:68032326-68032348 GGTATAGGGACCACTGCAACAGG - Intergenic
1128825459 15:70711612-70711634 GGTATATCTAGCACTGTAAATGG - Intronic
1132276278 15:100567328-100567350 GATACATGCAGCACTGCATTAGG - Exonic
1134037442 16:11041831-11041853 GGAATATGGAGCACCCCAACTGG + Intronic
1135045796 16:19154103-19154125 GGAGGATGTAGCACTGCAATTGG - Intronic
1135160503 16:20090972-20090994 GGGAGATGGAGCACTGCTACTGG + Intergenic
1137417148 16:48293529-48293551 CGTATAAGAAACACTGCAATGGG + Intronic
1138620103 16:58204341-58204363 GGTATAGGGACCACTGCAAGGGG - Intergenic
1140648966 16:77065999-77066021 GGTATAGGACCCACTGCAATGGG - Intergenic
1141013575 16:80426450-80426472 GGTATCAGGACCACTCCAATGGG + Intergenic
1141252880 16:82374770-82374792 TGTTTGTGGAGCACTGCAATGGG + Intergenic
1141509474 16:84503501-84503523 GGTATAGGGACCACAGCAATGGG - Intronic
1141862828 16:86729608-86729630 GGTTTAAGGAGCATTGCACTAGG - Intergenic
1144566585 17:16364424-16364446 GGTATAGGAACCACTGTAATGGG + Intergenic
1144623363 17:16832186-16832208 GGTGTATGGAGCACTGAGAGAGG - Intergenic
1144883070 17:18440530-18440552 GGTGTATGGAGCACTGAGAGAGG + Intergenic
1145149161 17:20503856-20503878 GGTGTATGGAGCACTGAGAGAGG - Intergenic
1146765461 17:35516726-35516748 GGTATATGGATCATTAAAATAGG - Intronic
1147577687 17:41612123-41612145 GGTGTATGGAGCACTGAGAGAGG - Intronic
1148372883 17:47114237-47114259 GGTATAGGGCCTACTGCAATGGG - Intergenic
1149702654 17:58668284-58668306 GGTATAGAGACCGCTGCAATGGG - Intronic
1151425224 17:74026667-74026689 GGTCTAGGGGACACTGCAATAGG + Intergenic
1152219708 17:79056531-79056553 GGTACAGGGACCATTGCAATGGG + Intergenic
1153134910 18:1905711-1905733 GGTACAGGGGCCACTGCAATGGG + Intergenic
1153354646 18:4121726-4121748 GGTACAGGGACCACTGCAACAGG - Intronic
1153902085 18:9626261-9626283 GGTATATGCAGAAATGCAAAGGG + Intergenic
1156774633 18:40772060-40772082 GGTATAGGGACCACTGCAATAGG - Intergenic
1159757200 18:72380249-72380271 GGTATAAAGACCACTGCAACAGG - Intergenic
1162250620 19:9440104-9440126 GGTATAGGGACCACTGCAGTAGG + Intergenic
1165553584 19:36609344-36609366 GGTATATGGAGATAGGCAATGGG - Intronic
1168517925 19:57023935-57023957 GGTATAGGGGCCACAGCAATGGG + Intergenic
925715472 2:6780801-6780823 GGTACTTGGAGCACTGCCAGTGG - Intergenic
925911263 2:8574974-8574996 GGTATAGCAAGCAGTGCAATGGG + Intergenic
926104653 2:10142612-10142634 GCTATACTGAGCACTGGAATGGG - Intronic
926653062 2:15367667-15367689 GATATATGGAGAACAGCCATGGG - Intronic
927485530 2:23486153-23486175 GGCCTATGGAGAACTGGAATAGG - Intronic
927974252 2:27326290-27326312 GGTGTATGGAGAACTGAAAAGGG - Exonic
928004970 2:27556454-27556476 GGTATATGGGACACAGTAATAGG - Intronic
928724920 2:34161262-34161284 GGCACATGCAGCACTGAAATGGG + Intergenic
928824985 2:35409666-35409688 GGTATAGGGACCACTGAAACAGG + Intergenic
929341773 2:40827772-40827794 GGTAGATAGAGCACTGTGATTGG + Intergenic
930447022 2:51486799-51486821 GGTATATGGAACATTGTACTAGG + Intergenic
931058851 2:58503822-58503844 GGTATAGAGACCACTGTAATGGG + Intergenic
931837979 2:66119357-66119379 GTGATATGGTGCAATGCAATGGG + Intergenic
932005039 2:67919225-67919247 GTTATAAGGACTACTGCAATGGG + Intergenic
932019288 2:68066160-68066182 GGTAAATGGATCAATTCAATAGG + Intronic
932853558 2:75211471-75211493 GGTATATATAGCAATGCCATAGG - Intergenic
933947797 2:87301840-87301862 GGTATCTGAAACACTGCAAAAGG + Intergenic
934103672 2:88676882-88676904 GGTATAGGGACCACTGCAAATGG - Intergenic
935504777 2:103887081-103887103 GGTATAGGGACCATTGCAATGGG + Intergenic
935736314 2:106109191-106109213 GGAATACGGATCACTGCAGTGGG - Intronic
936332402 2:111559733-111559755 GGTATCTGAAACACTGCAAAAGG - Intergenic
936476857 2:112847039-112847061 GATATAGGAAACACTGCAATGGG - Intergenic
936781069 2:116033365-116033387 GGTACAGGGAGTACTGCAATGGG - Intergenic
939739818 2:145892722-145892744 GGTATAGGGAACACTGGAATGGG + Intergenic
939923013 2:148140154-148140176 GGTAAAAAGAGCACTGAAATGGG - Intronic
940176257 2:150880790-150880812 AATACAGGGAGCACTGCAATGGG - Intergenic
942871374 2:180738271-180738293 GGTAAAGGGATCACTGGAATGGG - Intergenic
943012276 2:182464281-182464303 GGCATAGGGACCACTGCAACAGG + Intronic
943227747 2:185202794-185202816 GGTCTATGGTGCATAGCAATTGG - Intergenic
944135775 2:196397855-196397877 GGTATATGAAGCAATGGTATTGG - Intronic
945293781 2:208150590-208150612 GGAATAGGGATCATTGCAATGGG + Intergenic
1168975824 20:1965179-1965201 GGTATAGGGATCGCTGCAGTGGG - Intergenic
1169859880 20:10140299-10140321 GGTATATAGAGGAATGGAATGGG + Intergenic
1171452389 20:25245421-25245443 GGTACAGGGACCACTGCAACGGG + Intergenic
1173059031 20:39644313-39644335 AGTATAGGGACCATTGCAATGGG + Intergenic
1173447672 20:43134613-43134635 GGTATAGGGACTACTGCAATGGG - Intronic
1173484416 20:43429919-43429941 AGTATAGGGACCACTGGAATGGG + Intergenic
1177403427 21:20636105-20636127 GGTATAGAGATAACTGCAATGGG + Intergenic
1177751189 21:25286018-25286040 GGTACATGTAACACTACAATAGG + Intergenic
1179677797 21:42996251-42996273 GGTATAGGGACTGCTGCAATGGG + Intronic
1182137754 22:27921522-27921544 AGTATACGGACCACTGTAATGGG + Intergenic
1183941937 22:41301012-41301034 GGTGTAGGGACCACTGCAGTGGG - Intergenic
1184908511 22:47509248-47509270 GCTATAGGGACCACTGAAATGGG + Intergenic
1184910727 22:47532232-47532254 GGTATAGGGGCCACTGCAAAGGG + Intergenic
951461723 3:22958241-22958263 TGTACAGGGACCACTGCAATGGG - Intergenic
953898919 3:46827378-46827400 GGTTTAGGGATCACTGCAATAGG - Intergenic
956707046 3:72008038-72008060 GGTATGAGGAGCACTGCAAAAGG - Intergenic
956866815 3:73377146-73377168 GGAAAATGGAGCACTGGATTGGG + Intergenic
956988915 3:74739483-74739505 GGTATAGGAACCACTGCAACAGG - Intergenic
957884931 3:86274405-86274427 GGTATTTGGAGCACAGGAAGAGG + Intergenic
958621448 3:96567946-96567968 GTCAAATGGAGCACTGTAATGGG - Intergenic
960876070 3:122296331-122296353 GGTGTAGGGACCACTGCAACAGG - Intergenic
962153971 3:132924380-132924402 GGTGTAGGGAGCACTGCAATGGG - Intergenic
962165723 3:133045694-133045716 GGTACCTGGATCACTGCATTAGG + Intronic
963060494 3:141221127-141221149 GGTTTAGGGACCACTGCAATGGG - Intergenic
963780254 3:149479666-149479688 CTTCTGTGGAGCACTGCAATAGG + Intronic
964310197 3:155384417-155384439 GGCGTAGGGACCACTGCAATGGG + Intronic
964992095 3:162827204-162827226 AGTCTATTGAGCATTGCAATAGG - Intergenic
965770488 3:172176823-172176845 GCTATAGGGACCACTGCAATAGG + Intronic
966021029 3:175210768-175210790 GGTAAATAGAGCACTGGATTAGG - Intronic
966119192 3:176503568-176503590 GGTATAGGAAGCACTGTAAGGGG + Intergenic
970855571 4:20646895-20646917 GGTATAGGGACCACTGCAATGGG - Intergenic
971390883 4:26184282-26184304 GGTACAGGGATCACTGCAATGGG + Intronic
976158316 4:82171928-82171950 GATATAGGGACCACTGCAATGGG + Intergenic
977165007 4:93683937-93683959 GGTATAGGGACCACTGCAATGGG + Intronic
978090546 4:104709291-104709313 GGTAAAGGGATCAATGCAATAGG + Intergenic
979266552 4:118710058-118710080 GGAATTAGGAGCACTGAAATAGG - Exonic
979300469 4:119080779-119080801 GGTATAGGGACCATTGCAGTGGG + Intergenic
980132091 4:128826313-128826335 GGTATAGGGAACACTGCAATGGG - Intronic
980132201 4:128827174-128827196 GGTACAGGGAACACTGCAATGGG - Intronic
980149642 4:129029733-129029755 GGTAAATGGATCAATGCAACAGG + Intronic
980224798 4:129968493-129968515 TGTATATGCAGCACTGAAAGAGG + Intergenic
980459107 4:133082056-133082078 GGTCTAGGGACCATTGCAATGGG - Intergenic
982022692 4:151219423-151219445 GGTATAGGGACAACTGCAATGGG - Intronic
982793782 4:159621698-159621720 GGTATAGGAAGAACAGCAATAGG - Intergenic
983165325 4:164469321-164469343 GGTATATGGAGCTCTATGATGGG + Intergenic
984522702 4:180820317-180820339 GGTAGAGGGAACACTGCAACAGG + Intergenic
984727432 4:183035323-183035345 GGTTGATAGAGAACTGCAATGGG - Intergenic
986134294 5:4959780-4959802 GGTATAGGGACCACTGCAACAGG + Intergenic
986254421 5:6090213-6090235 GGGAAATGGTGCTCTGCAATGGG + Intergenic
986613631 5:9594391-9594413 GGCATAGGGACTACTGCAATGGG + Intergenic
987148167 5:15012754-15012776 GGTATAGGGACCATGGCAATGGG + Intergenic
988131813 5:27116279-27116301 AGTATAGAGACCACTGCAATGGG + Intronic
989208135 5:38831713-38831735 GGTATAGGGACCACAGCAATGGG - Intergenic
990276416 5:54201724-54201746 GGTATAGGGACCACTGCATTGGG - Intronic
991139769 5:63226700-63226722 GGTGCAGGGACCACTGCAATGGG + Intergenic
991257764 5:64634030-64634052 GGTACAGGGACCACTGCAATGGG + Intergenic
992376210 5:76190223-76190245 GGTCTAGGGACCACTGCAATGGG + Intronic
993399392 5:87430177-87430199 GGTATAGGAACCACTACAATGGG + Intergenic
993922270 5:93820222-93820244 GATATATTGAGCACTGCAAACGG + Intronic
993953321 5:94201767-94201789 GGTATAGGGACCACTTCAATGGG + Intronic
994877419 5:105442727-105442749 GGTTTAAGGATCACTGCAATGGG - Intergenic
995356483 5:111243132-111243154 TGAATAGGGACCACTGCAATGGG + Intronic
996787551 5:127256608-127256630 GGTATAGGGACCACAGTAATAGG - Intergenic
999223729 5:150002415-150002437 GGTATAATGAGCACTGCATGTGG - Intronic
999642184 5:153682755-153682777 GGTATAGAGACCCCTGCAATGGG - Intronic
1000299263 5:159940573-159940595 GGTATAGGAACTACTGCAATGGG - Intronic
1003330413 6:5124220-5124242 GGTATGTGGAGCCCTACAAGTGG - Intronic
1003753472 6:9089102-9089124 TGTACACAGAGCACTGCAATTGG + Intergenic
1004144882 6:13056612-13056634 AGGATAGGGACCACTGCAATAGG + Intronic
1004280209 6:14274165-14274187 GGTATGGGGACCACAGCAATGGG + Intergenic
1007044605 6:38759934-38759956 GGTATAGGGACCACTGCAATGGG - Intronic
1008157610 6:48035941-48035963 AGTACAGGGAGCACTGCAATGGG - Intronic
1008333899 6:50276408-50276430 GGTATAGGGATCACTGCAAGGGG - Intergenic
1009380776 6:63026211-63026233 GGTATAGGGGCCACTGTAATAGG + Intergenic
1010004770 6:70983765-70983787 GGTATAGGGACCACTGCAATGGG + Intergenic
1010578731 6:77566901-77566923 GGTCTAGGGACCACTGCAATGGG - Intergenic
1010720785 6:79281257-79281279 GGTTTAGGGACCACTGCAACAGG + Intergenic
1012406633 6:98908006-98908028 GGTATAGGGACCACTACAATGGG - Intronic
1012497062 6:99844965-99844987 GGTATAGGGACCACTGCAATGGG - Intergenic
1012867836 6:104639196-104639218 TGTATATGGAGCACTCAGATTGG - Intergenic
1013962040 6:115912169-115912191 GGTATAGAGACCACTGCAAAGGG + Intergenic
1014648326 6:124003827-124003849 GGTGAATGGAGGTCTGCAATGGG + Intronic
1014995965 6:128144835-128144857 GGTTTCTGGAGAACTGCAAAAGG + Intronic
1015043086 6:128744993-128745015 GGTATAGGAACCCCTGCAATGGG + Intergenic
1015646235 6:135391788-135391810 GGTACAGGGACTACTGCAATGGG + Intronic
1016393994 6:143603300-143603322 GGTATAGGGACCACTGCCATGGG + Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017144020 6:151217548-151217570 TGTATAGGGACCACTGCAATGGG - Intergenic
1019364262 7:623723-623745 GGTACAGGGATCACTGCAATGGG - Intronic
1024188230 7:46976603-46976625 GGGCTATTGAGCACTGGAATGGG + Intergenic
1025963400 7:66245232-66245254 GGTACAGGGACCACTGCAGTCGG + Intronic
1027700000 7:81457738-81457760 GGTATAGGAATCATTGCAATGGG - Intergenic
1028994070 7:97079962-97079984 GGTATAGGGCCCACTGCACTGGG - Intergenic
1030845208 7:114400843-114400865 GGTACAGGGACCACTGCAATGGG + Intronic
1031136951 7:117894942-117894964 GGTATAGGGACTACTACAATGGG - Intergenic
1032635037 7:133697615-133697637 GGTATGGGGACCACTGCGATGGG + Intronic
1033990997 7:147287064-147287086 GGTATGGGGACCACAGCAATGGG + Intronic
1036151637 8:6304732-6304754 GGCATAGAGACCACTGCAATAGG + Intergenic
1036622041 8:10430629-10430651 GGGATATGGAGCAGGGCAGTTGG + Intergenic
1038713728 8:29973002-29973024 GCTATAGAGACCACTGCAATGGG - Intergenic
1039573242 8:38603577-38603599 GGTCTTTGGAACACTGCAGTGGG - Intergenic
1039850293 8:41358917-41358939 GGTATAGGGAACACTGAAATAGG + Intergenic
1040428518 8:47313990-47314012 GGAATGAAGAGCACTGCAATTGG + Intronic
1040512881 8:48110717-48110739 GGGAAATGGAGCACTGGGATGGG - Intergenic
1041929153 8:63268121-63268143 GTACTATGGAGCTCTGCAATAGG - Intergenic
1042318710 8:67452234-67452256 GGGATATGGAGCAGGGAAATAGG + Intronic
1045469771 8:102501803-102501825 GGAATATGTAGCACTTCAGTTGG - Intergenic
1047757287 8:127928414-127928436 GGTATAGGGACCACGGCAATGGG - Intergenic
1049076136 8:140397850-140397872 GGTATCTGGAGCCCTGTGATGGG - Intronic
1050054519 9:1637700-1637722 GGTAAAGGGAACACTGCAAGTGG + Intergenic
1050164288 9:2747970-2747992 GGCATATAGACTACTGCAATGGG + Intronic
1051851185 9:21510274-21510296 GGTACATGGAACTCTGCAAAAGG + Intergenic
1052726560 9:32234939-32234961 GGTATAGGGACCATTGTAATGGG - Intergenic
1052947315 9:34178891-34178913 GCAACATGGAGCATTGCAATTGG - Intergenic
1053185330 9:36011639-36011661 TGTATAGGGACCACTGCCATGGG + Intergenic
1055060454 9:72063300-72063322 GGAATATGGAGCCCTGAAAGTGG + Intronic
1057587204 9:96339706-96339728 AGTATTTGAATCACTGCAATAGG - Intronic
1059350260 9:113659352-113659374 GGTATAGGGACCATTGCAACAGG + Intergenic
1059353262 9:113680912-113680934 GGTAGATGGAGCACTGAATTGGG + Intergenic
1060148908 9:121274577-121274599 GGCATAGGGACCACTGCAACAGG + Intronic
1187138374 X:16570247-16570269 GGTGTAGGGATCACTGCTATGGG - Intergenic
1187827459 X:23346301-23346323 GGTATAGGGACTACTGCAGTGGG + Intronic
1189362977 X:40367738-40367760 GGTATAGGGAACACTACAATGGG + Intergenic
1189650235 X:43181013-43181035 GGTATAGGGACCACTGTAATGGG - Intergenic
1190110138 X:47583938-47583960 GGTATAGGAACCACTGCAATGGG + Intronic
1190175607 X:48146546-48146568 GGTACAGGGACCACCGCAATGGG - Intergenic
1190182893 X:48208438-48208460 GGCACAGGGACCACTGCAATGGG - Intronic
1190186371 X:48238090-48238112 GGTATAGGGACCACCGCAATGGG - Intronic
1190195768 X:48317040-48317062 GGTATAGGGACCACCGCAATGGG - Intergenic
1190201714 X:48367476-48367498 GGTACAGGGACCACTGCAATGGG + Intergenic
1190208825 X:48427935-48427957 GGTACAGGGACCACTGCAATGGG - Intergenic
1190379689 X:49828080-49828102 GGTATAGGGACCATTGCAATGGG + Intergenic
1190662469 X:52667403-52667425 GGCACAGGGACCACTGCAATGGG - Intronic
1190761903 X:53443955-53443977 GGTATGCAGACCACTGCAATGGG + Intergenic
1190952832 X:55162742-55162764 GGTGTAGGGACCACTGCTATGGG - Intronic
1192811717 X:74553069-74553091 GGTATAAGAACCACTGCAACGGG + Intergenic
1194280609 X:91948670-91948692 GGTGTAGGGACCACTGCAATGGG + Intronic
1194600105 X:95910031-95910053 GGTATAGGGACCACTTGAATGGG - Intergenic
1194770866 X:97903094-97903116 GGTATAAGGATCACTACAACGGG - Intergenic
1198504967 X:137292492-137292514 GGTATAGGGATCACTGCAATGGG + Intergenic
1200598085 Y:5172166-5172188 GGTGTAGGGACCACTGCAATGGG + Intronic