ID: 908589563

View in Genome Browser
Species Human (GRCh38)
Location 1:65615283-65615305
Sequence CTGCCATAGGTGAAGTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908589559_908589563 19 Left 908589559 1:65615241-65615263 CCTTCTCTGTCTTTATAAGGGAT No data
Right 908589563 1:65615283-65615305 CTGCCATAGGTGAAGTTGATTGG No data
908589560_908589563 -6 Left 908589560 1:65615266-65615288 CCAGCATTTAATCTTACCTGCCA 0: 1
1: 0
2: 0
3: 11
4: 174
Right 908589563 1:65615283-65615305 CTGCCATAGGTGAAGTTGATTGG No data
908589556_908589563 23 Left 908589556 1:65615237-65615259 CCAGCCTTCTCTGTCTTTATAAG No data
Right 908589563 1:65615283-65615305 CTGCCATAGGTGAAGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908589563 Original CRISPR CTGCCATAGGTGAAGTTGAT TGG Intronic
No off target data available for this crispr