ID: 908591324

View in Genome Browser
Species Human (GRCh38)
Location 1:65638596-65638618
Sequence GCTCACTTCATAGCCACAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908591324 Original CRISPR GCTCACTTCATAGCCACAAC TGG (reversed) Exonic
907023755 1:51094955-51094977 GCTCTCCCCATAGCCACCACAGG - Intergenic
908591324 1:65638596-65638618 GCTCACTTCATAGCCACAACTGG - Exonic
911038851 1:93576577-93576599 TCTCACTTAACAGCCACAGCTGG + Intronic
913359175 1:117960658-117960680 GCTCACTGCATAGCAACAGGAGG + Exonic
913706066 1:121424110-121424132 CCTCACTTCCTAGTCACAAGGGG - Intergenic
921974015 1:221181739-221181761 TCTCACTACAAAGCGACAACTGG + Intergenic
924718313 1:246599472-246599494 GCTCACTTCAAAGCCACTGCTGG - Intronic
1069626634 10:69871990-69872012 GCTTTCTTCAGAGCCAGAACTGG + Intronic
1072165177 10:92806090-92806112 GCTCAATTCATAGACAAAAGGGG + Intergenic
1076827182 10:132974924-132974946 GCTCCCTTCATAGGGACAGCAGG + Intergenic
1077512587 11:2976826-2976848 TGCCACTTCATAGTCACAACTGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079455276 11:20630979-20631001 GCTCACTGCAGAGTCAGAACTGG + Intronic
1081267391 11:41042532-41042554 GCACACTTCCTTGCCGCAACTGG + Intronic
1083368329 11:62157238-62157260 GCTCACTTCAAAGCTACAGGAGG + Intergenic
1087222365 11:95560245-95560267 GCCCACTCCATAGTCACAACAGG + Intergenic
1087935357 11:104027617-104027639 TGTTACTTCAAAGCCACAACAGG + Intronic
1092034415 12:5319157-5319179 TCTAACTCCACAGCCACAACTGG - Intergenic
1093566605 12:20613648-20613670 GCTCTCTTCAGAGTCAGAACAGG - Exonic
1100457056 12:94762788-94762810 GCTCACTTCATGTCATCAACAGG + Intergenic
1101050046 12:100852613-100852635 GATTACTTCATGGCCAGAACTGG + Intronic
1103945518 12:124524148-124524170 GTTTTCTTCATGGCCACAACTGG - Intronic
1108545188 13:51486562-51486584 GCTCATTTCATTGCCACACAAGG - Intergenic
1108665145 13:52622203-52622225 GTTCACTTAAAAGCTACAACTGG + Intergenic
1110456672 13:75696902-75696924 CGTTACCTCATAGCCACAACTGG - Intronic
1110833972 13:80063428-80063450 ACTCACTTCATAGCCAAAACAGG - Intergenic
1113331212 13:109329641-109329663 GCCCACGTCATAGCAAGAACTGG - Intergenic
1117880049 14:60304460-60304482 CCTCACGTCCTAGCCACAACTGG - Intergenic
1118395484 14:65332679-65332701 GCTCACTTCCTTGTAACAACAGG - Intergenic
1121928948 14:97954592-97954614 GATCACTTCATACCCACAGAAGG - Intronic
1122668024 14:103347422-103347444 GCTCTCTTCACAGCCTCACCTGG - Intergenic
1123718340 15:23045030-23045052 GCGGACTTCATAACCACACCTGG + Intergenic
1123718645 15:23046105-23046127 GCGGACTTCATAACCACACCTGG + Intergenic
1123719764 15:23049993-23050015 GCGGACTTCATAACCACACCTGG + Intergenic
1132027541 15:98416111-98416133 GCTGACTTGATATCAACAACTGG - Intergenic
1133428294 16:5712576-5712598 GCTCACTTAATTCCCATAACAGG + Intergenic
1148930209 17:51121202-51121224 ACTCACTTCATCCCCACAACAGG + Intergenic
1149407738 17:56371676-56371698 GGTCACTTCAGAGCCCCACCTGG - Intronic
1163446602 19:17350595-17350617 TCTCACTATATTGCCACAACTGG + Intergenic
1163649778 19:18510479-18510501 CCTCACTGCAGAGCCACACCGGG + Intronic
1167964685 19:53133412-53133434 GCTAACTTAATATCCACAGCAGG + Intronic
925790701 2:7483946-7483968 GCTTTATTCATAACCACAACTGG + Intergenic
929281736 2:40087496-40087518 TCTCACCCCATAGCCACGACAGG + Intergenic
930994000 2:57694425-57694447 TCTCACTTCATATCCACTACTGG - Intergenic
932749539 2:74362604-74362626 GCTCACTTCACAGCATAAACTGG - Intronic
940483879 2:154273356-154273378 GCTCACTTCATAGCTGCATAAGG - Intronic
943967325 2:194353844-194353866 TCTCACCTCATAGCCTCCACAGG - Intergenic
944118197 2:196211502-196211524 AGTCACTTCATAACCACAAGAGG + Intronic
945405291 2:209440186-209440208 ATTCCCTTCATAGACACAACTGG - Intronic
1168986877 20:2056527-2056549 GCTCACTTCAGATACACACCAGG + Intergenic
1169987317 20:11459987-11460009 AATCAATTCATAGCCACCACAGG - Intergenic
1173905400 20:46624794-46624816 TCTCACTTCAGAACCACATCTGG - Intronic
1174929030 20:54793602-54793624 GCTCACCTCAGAGCCACAGTAGG - Intergenic
1178397681 21:32256970-32256992 GCTCCCTTAACAGCCACATCAGG + Intergenic
1181533380 22:23529750-23529772 GCTGACTTCACAGCCACAGCTGG + Intergenic
1181772301 22:25134601-25134623 GCTCATTTCACAACCCCAACTGG - Intronic
1181910512 22:26234656-26234678 GCTGGCTTGATAGCCACAATAGG + Intronic
957053614 3:75428187-75428209 CATCCCTTCATAGCCACACCTGG - Intergenic
965313743 3:167164423-167164445 GCCCTCTGCCTAGCCACAACAGG - Intergenic
965883156 3:173411632-173411654 CCTCACTTCATATACACAAAAGG - Intronic
968282866 3:197490247-197490269 GCCCACATCATAGCCCCACCAGG + Intergenic
968291025 3:197539955-197539977 GCTCACTGCCTAGACAGAACCGG - Intronic
969173896 4:5384856-5384878 ACTCACTCCATGGCCACACCTGG - Intronic
977060853 4:92255273-92255295 GCTCACCTGAGAGCCACACCTGG - Intergenic
977403425 4:96564110-96564132 GCTCCTTTCATAGACAAAACTGG - Intergenic
995229491 5:109743099-109743121 GGTCACTTCAAAGCCAAAAGAGG - Intronic
996645060 5:125804163-125804185 GCTCACTTCCAAGCCACCATGGG + Intergenic
999576417 5:152982914-152982936 GCTGACTTCATTGCTATAACAGG - Intergenic
1001774664 5:174320231-174320253 CCTGACTTCCTAGCAACAACAGG + Intergenic
1002451985 5:179324418-179324440 TCTCACTCTATAGCCCCAACTGG + Intronic
1002579869 5:180201410-180201432 GTGCACTTCATAACAACAACAGG + Intronic
1002792604 6:447061-447083 CCTCACTTCATAAACACAACAGG - Intergenic
1004759997 6:18656281-18656303 GCCCACCTCAGAGCCACAAAAGG + Intergenic
1005121139 6:22390188-22390210 GCCCACTTCAGAGCCACACAAGG - Intergenic
1012098969 6:95005792-95005814 GCTCACTGTATTGCCACCACTGG + Intergenic
1014905501 6:127022029-127022051 GCTGTCTTCATAGCTACATCAGG - Intergenic
1016699887 6:147042290-147042312 GCTCACTTCATCATCACTACTGG + Intergenic
1024043124 7:45570215-45570237 ACCCAGTTCATAGCCACCACAGG - Intergenic
1025000166 7:55309276-55309298 GCTCATTTCATTACCACACCAGG + Intergenic
1025997568 7:66537683-66537705 GCACACCTCAGAGCCCCAACAGG + Intergenic
1033439074 7:141362357-141362379 GTACACTTCAAAGCCAAAACAGG - Intronic
1035096866 7:156362910-156362932 GCTAATTTCCTATCCACAACAGG + Intergenic
1035557911 8:580195-580217 GGTCATTTGATAGCCACCACAGG - Intergenic
1039399659 8:37258697-37258719 GCTCACTTCAAAACCACTGCTGG - Intergenic
1045930646 8:107621956-107621978 GCTCTCTTTATAGACACATCTGG + Intergenic
1048945336 8:139441796-139441818 TCCCACTACATACCCACAACAGG - Intergenic
1052251279 9:26400507-26400529 CATCACTTCATAGCCACATTAGG + Intergenic
1057796709 9:98162979-98163001 GCCCACATCAAAGCCACAACAGG + Intronic
1057892284 9:98878473-98878495 CCTCTCTTCAAAGGCACAACTGG - Intergenic
1062433671 9:136536655-136536677 CCTCACTTGAAAGCCACAGCAGG + Intronic
1185721458 X:2385415-2385437 TCTCATTCCATAGCCACAGCAGG + Intronic
1187497850 X:19811817-19811839 GTTCACAGCACAGCCACAACTGG + Intronic
1192232808 X:69277754-69277776 GCTCATTCCACAGCCACCACTGG - Intergenic
1194466733 X:94242829-94242851 GCTCACTACATACCCAGAAAAGG + Intergenic
1198788233 X:140314115-140314137 CCTCACCCCATAGCCACCACAGG - Intergenic
1199752207 X:150830682-150830704 GCTCAAGTCATAGCCCCTACTGG - Intronic
1200122119 X:153796073-153796095 CCTCAATTCAGAGCCACAAACGG - Intronic