ID: 908592852

View in Genome Browser
Species Human (GRCh38)
Location 1:65652134-65652156
Sequence CTGTTCACTCCCATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908592847_908592852 10 Left 908592847 1:65652101-65652123 CCCATTGGCATGTGGATCACCAG No data
Right 908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG No data
908592848_908592852 9 Left 908592848 1:65652102-65652124 CCATTGGCATGTGGATCACCAGC No data
Right 908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG No data
908592849_908592852 -9 Left 908592849 1:65652120-65652142 CCAGCAAGACAGTACTGTTCACT No data
Right 908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG No data
908592846_908592852 11 Left 908592846 1:65652100-65652122 CCCCATTGGCATGTGGATCACCA No data
Right 908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908592852 Original CRISPR CTGTTCACTCCCATGGAAAA GGG Intergenic
No off target data available for this crispr